![]() |
|
|
Vol. 19, Issue 1, 216-225, January 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

*Department of Cell Research and Immunology, George Wise Faculty of Life Sciences, Tel Aviv University, Tel Aviv 69978, Israel; and
McGill Cancer Centre, McGill University, Montréal, Quebec, Canada H3G 1Y6
Submitted May 29, 2007;
Revised September 25, 2007;
Accepted November 1, 2007
Monitoring Editor: Reid Gilmorez
| ABSTRACT |
|---|
|
|
|---|
1,2-linked mannose residues. Using small interfering RNA knockdown of ERManI, we show that this enzyme is required for trimming to Man5–6GlcNAc2 and for ERAD in cells in vivo, leading to the accumulation of Man9GlcNAc2 and Glc1Man9GlcNAc2 on a model substrate. Thus, trimming by ERManI to the smaller oligosaccharides would remove the glycoprotein from reglucosylation and calnexin binding cycles. ERManI is strikingly concentrated together with the ERAD substrate in the pericentriolar ER-derived quality control compartment (ERQC) that we had described previously. ERManI knockdown prevents substrate accumulation in the ERQC. We suggest that the ERQC provides a high local concentration of ERManI, and passage through this compartment would allow timing of ERAD, possibly through a cycling mechanism. When newly made glycoproteins cannot fold properly, transport through the ERQC leads to trimming of a critical number of mannose residues, triggering a signal for degradation. | INTRODUCTION |
|---|
|
|
|---|
1,2-linked mannose residues, to form Man6GlcNAc2 (M6) or Man5GlcNAc2 (M5) (Ermonval et al., 2001
1,2 mannosidases were recently shown to accelerate the degradation and mannose trimming of an ERAD substrate, NHK
1-antitrypsin, when overexpressed, probably through recycling of this protein through the Golgi complex (Hosokawa et al., 2007
-mannosidase-like (EDEM) proteins. Recently, both EDEM1 and EDEM3 were reported to accelerate ERAD and to increase mannose trimming to M7-6 when overexpressed in vivo (Hirao et al., 2006
-mannosidases cause extensive mannose trimming.
|
1,2-linked mannose residues (Herscovics et al., 2002| MATERIALS AND METHODS |
|---|
|
|
|---|
Primers and Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
Total cell RNA was extracted with EZ-RNA kit (Biological Industries, Beit Haemek, Israel). ReddyMix (ABgene, Epsom, United Kingdom) was used for PCR. Reverse transcription was performed with a ProtoScript First Strand cDNA Synthesis kit using random primers. An aliquot (5%) of the RT product was used for PCR with the following primers: CCTTCAGTGAGTGGTTTGG and GTGGTCCATCTTGGCACTG for ERManI and ATAGTAGATGCCCTGGATAC and CAGATAGTTAGGATAAAGGC for Golgi ManIA.
Plasmids
H2a subcloned in pCDNA1 (Kamhi-Nesher et al., 2001
; Invitrogen, Carlsbad, CA). Inserts for pSUPER and pSUPER-retro-green fluorescent protein (GFP) short hairpin RNA (shRNA) vectors were constructed as described in Brummelkamp et al. (2002)
by using target sequences as follows: ACCAGCAAATCCACCCGTC for human ERManI, GAATTTAAGCAAGCCAGGA for mouse ERManI, and AGGAGGCCATTCAAGCAGT for human Golgi ManIA. pSUPER encoding anti-lacZ shRNA was a kind gift of S. Lavi (Tel Aviv University). GalT-YFP (β1,3-galactosyltransferase linked to yellow fluorescent protein [YFP]) in peYFP was a kind gift from K. Hirschberg (Tel Aviv University) Human ERManI-hemagglutinin (HA) (Hosokawa et al., 2003
) and Golgi ManIC-HA (Tremblay and Herscovics, 2000
) were cloned into pMH (Roche Diagnostics, Basel, Switzerland).
Antibodies
Rabbit polyclonal anti-human ERManI was described in Hosokawa et al. (2003)
. Rabbit polyclonal anti-H2 carboxy-terminal was used as in previous studies (Tolchinsky et al., 1996
) as well as rabbit anti-ERp57 (Frenkel et al., 2004
). Mouse anti-HA-tag was from Cell Signaling Technology (Danvers, MA); Mouse anti-
-tubulin, rabbit anti-ERGIC53, and anti-lamp1 were from Sigma-Aldrich Corp. Rabbit anti-CNX C terminus was from Assay Designs (Ann Arbor, MI). Secondary goat anti-mouse immunoglobulin (Ig)G-cyanine (Cy)5 or fluorescein isothiocyanate (FITC), and goat anti-rabbit IgG-Cy5 or -Cy3 antibodies were from The Jackson Laboratory (Bar Harbor, ME).
Cell Culture and Transfection
NIH 3T3 cells and a stable transfectant expressing H2a (Tolchinsky et al., 1996
) were grown in DMEM supplemented with 10% newborn calf serum. Transfections of NIH 3T3 cells were performed using the X-tremeGene small interfering RNA (siRNA) transfection reagent (Roche Diagnostics), with 1 µg of DNA per well in 24-well plates, according to the manufacturer's manual. Transfections of human embryonic kidney (HEK) 293 cells (grown in DMEM plus 10% fetal calf serum) were performed using a calcium phosphate procedure. Samples were processed 48-h posttransfection.
[35S]Cys Metabolic Labeling and Immunoprecipitation
Subconfluent (90%) cell monolayers in 60-mm dishes were labeled with [35S]Cys, lysed, and immunoprecipitated with anti-H2 antibodies, as described previously (Tolchinsky et al., 1996
; Shenkman et al., 1997
).
Gel Electrophoresis, Fluorography, and Quantitation
Reducing SDS-polyacrylamide gel electrophoresis (PAGE) was performed in 10% Laemmli gels. The gels were subjected to fluorography by using 20% 2,5-diphenyloxazole in acetic acid, and then they were exposed to Kodak BioMax MR film (Vancouver, BC, Canada). Quantitation was performed in a Fuji BAS 2000 phosphorimager (Fuji, Tokyo, Japan), by using Tina 2.1 software.
[2-3H]Man Labeling and Analysis of N-linked Oligosaccharides
Subconfluent (90%) monolayers of cells in 100-mm tissue culture dishes were metabolically labeled for 45–60 min with 350 µCi/ml [2-3H]Man, as described previously (Frenkel et al., 2003
). Cells were rinsed and chased with normal DMEM plus 10% fetal calf serum. Cell lysis, immunoprecipitation, and endo H treatment were performed as for the 35S-labeled samples. High mannose N-linked oligosaccharide isolation and separation by high-performance liquid chromatography (HPLC) was as described previously (Frenkel et al., 2003
) or using an NH2P-50E column from Shodex (Kawasaki, Japan) at a flow rate of 1 ml/min in acetonitrile:water (60:40, vol/vol ratio); fractions were monitored using a scintillation counter (Beckman Coulter, Fullerton, CA).
Immunofluorescence Microscopy
Cells were grown on glass coverslips overnight before transfection; 48 h after transfection the cells were fixed with methanol and methanol:acetone for 5 min at –20°C and processed as in [Kamhi-Nesher et al., 2001
]. The samples were analyzed using a Zeiss laser scanning confocal microscope (LSM 510; Carl Zeiss, Jena, Germany). The thickness of the optical slices was 0.6–0.9 µm.
For deconvolution pictures were taken with a Zeiss Axiovert 200M inverted microscope, coupled to a CoolSnap HQ2 camera with a 63x, 1.4 numerical aperture lens, with 2 x 2 binning. The acquisition and analysis were carried out with Slidebook 4.1 software (Intelligent Imaging Innovations, Denver, CO). Twenty to 35 optical slices were taken of each cell (depending on cell shape). Images were deconvolved with the Constrained Iterative algorithm making use of measured point spread functions. Identification of the different intracellular compartments was carried out by intensity-based thresholding. For quantitation, the background signal (calculated from untransfected cells) was subtracted.
| RESULTS |
|---|
|
|
|---|
-Mannosidase and Mannose Trimming to M6, M5 Are Required for ERAD of Asialoglycoprotein Receptor (ASGPR) H2a
as model ERAD substrate glycoproteins, suggested that mannose trimming of the sugar chains to M6 and M5 is involved in their targeting to ERAD (Frenkel et al., 2003
-mannosidase.
Given that we had observed a relationship between the degree of mannose trimming to M6 and M5 and the stability of the glycoprotein (Frenkel et al., 2003
), it was of interest to test whether inhibition of trimming to M6 and M5 (without affecting trimming to M8) would decrease degradation. For this purpose, we incubated cells expressing H2a with increasing concentrations of dMNJ, which showed a progressive inhibition of the trimming that correlated with a progressive inhibition of degradation (Figure 1, A and B). We analyzed the N-linked sugar chains of H2a, released by endo H after pulse labeling with [2-3H]Man, including MG-132 during the chase to prevent H2a degradation. We studied which species accumulate upon incubation of cells with a low nonsaturating concentration of dMNJ that would have little effect on trimming to M8. Incubation with 50 µg/ml dMNJ completely blocked oligosaccharide trimming to M5, greatly reduced trimming to M6 by more than fourfold but had relatively little inhibitory effect on the formation of M7, and it did not affect the formation of M8 (Figure 1C). Nevertheless, this concentration of dMNJ inhibited the degradation of H2a to half the extent obtained with a saturating amount of the inhibitor (150 µg/ml) after 3-h chase (Figure 1, A and B). Together, these results suggest that trimming of
1,2-mannose residues (Figure 1D) by a class I
1,2-mannosidase to M6 and M5 is a prerequisite for maximal degradation and that formation of M8 cannot be the only determinant leading to ERAD, as has been suggested in previous studies (Cabral et al., 2001
).
ERManI Is Required for ERAD of Glycoprotein Substrates and for Mannose Trimming of Their Sugar Chains to M6 and M5
Several class I
1,2-mannosidases could be candidates for the mannose trimming activity leading to ERAD, all inhibited by dMNJ and KIF and insensitive to swainsonine (Herscovics, 2001
; Mast and Moremen, 2006
) as in the experiment of Figure 1A. In vitro ERManI efficiently converts M9 to M8 by removing residue b (Figure 1D), but it can remove additional
1,2-linked mannose residues at high concentrations (Herscovics et al., 2002
). Other candidates, as explained above, could be Golgi
-mannosidases, e.g., Man IA and/or EDEM 1-3.
Although overexpression of ERManI leads to accelerated substrate degradation (Hosokawa et al., 2003
; Wu et al., 2003
), it was important to determine whether endogenous levels of ERManI are sufficient to promote ERAD. We therefore knocked down ERManI expression using an shRNA in a pSUPER vector. This plasmid was cotransfected with a vector carrying H2a cDNA into HEK 293 cells, which were used to achieve much more efficient transfection than in NIH 3T3 cells. We chose a region of the ERManI sequence with little or no homology to other class I mannosidases, obtaining very efficient knockdown of ERManI as analyzed by RT-PCR. Transfection with 10 µg of pSUPER anti-ERManI decreased the ERManI mRNA to undetectable levels, whereas an shRNA directed against Golgi Man IA had no effect (Figure 2A). As another control we determined that anti-ERManI shRNA had no effect on the level of Golgi Man IA mRNA (Figure 2B). The effect of anti-ERManI shRNA on H2a degradation was tested in a pulse-chase experiment. Degradation of H2a is slower in HEK 293 cells than in NIH 3T3 cells, but anti-ERManI shRNA blocked it completely (Figure 2C, lanes 5 and 6). In contrast, overexpression of ERManI accelerated the degradation (Figure 2C, compare lanes 1 and 2 with 3 and 4). ERManI overexpression also caused 40% reduction in the level of the pulse-labeled H2a (Figure 2C, compare lane 1 with lane 3), probably by reducing the initial lag in degradation (Tolchinsky et al., 1996
).
|
To study the effect of ERManI knockdown on the trimming of the sugar chains, we compared the N-linked glycans of H2a in cells transfected with pSUPER anti-ERManI with those in cells transfected with pSUPER carrying the irrelevant anti-lacZ shRNA. The cells were pulse-labeled with [2-3H]Man and chased for 4 h. ERManI knockdown nearly completely blocked trimming of the sugar chains to M5, and partially to M6 and M8, with the level of M7 remaining almost unchanged after 4 h of chase (Figure 3, A–E). Concomitantly there was a large relative increase of M9 and of the glucosylated species G1M9. Glycoprotein molecules that were spared from degradation by ERManI knockdown accumulated with these larger sugar chains. When comparing the relative molar amounts of the smaller species (M5 + M6) with the sum of the larger species (M8 + M9 + G1M9), it is clear that ERManI knockdown blocked the trimming to M5 and M6 during the chase (Figure 3F). This is even more evident when comparing cells treated with a proteasomal inhibitor, MG-132, which led to a lesser relative amount of larger species and accumulation of the smaller species, but not in the presence of ERManI shRNA (Figure 3F). Although there was a very efficient knockdown of ERManI (Figure 2A), residual activity might still account for partial trimming of up to 3 mannose residues (Figure 3, D and E). Alternatively, other
1,2-mannosidases may be responsible for this partial trimming. However, the partial trimming to M6-M8 in the presence of ERManI shRNA is not sufficient to target the glycoprotein to ERAD (Figure 2C), perhaps pointing to the requirement for further processing to M5. Another possibility is that all three sugar chains of each molecule of the substrate H2a must be trimmed to M5-M6 for ERAD to take place, and the presence of one untrimmed chain might be sufficient for CNX association and prevention of degradation.
|
ERManI Is Concentrated in the ERQC Compartment
ERManI can cleave several mannose residues from the M9 precursor only at very high concentrations, as shown in vitro (Herscovics et al., 2002
). We investigated the subcellular localization of the enzyme to see whether it could point to relatively high local concentrations. We could not detect the enzyme at its endogenous level with the antibody in our possession, although it recognized specifically exogenously expressed ERManI (Supplemental Figure 1). Therefore, we expressed an HA-tagged version of ERManI and compared its location with a red fluorescent protein (RFP) fusion protein of the ERAD substrate H2a (H2a-RFP). H2a-RFP showed up in an ER pattern in untreated cells and concentrated in the ERQC compartment upon proteasomal inhibition (Figure 4, A and B, middle). As mentioned, we previously demonstrated the existence of this compartment in the centrosomal region of the cell (Kamhi-Nesher et al., 2001
; Frenkel et al., 2004
). Surprisingly, ERManI seemed concentrated in the centrosomal region with or without treatment with the proteasomal inhibitor lactacystin, with relatively little visible in the peripheral regions (Figure 4, A–C). In the presence of lactacystin H2a-RFP colocalized with ERManI in the ERQC (Figure 4B). We had seen previously that H2a and H2a-RFP accumulate in this pericentriolar compartment, together with calnexin and calreticulin upon proteasomal inhibition, but that the chaperones and the ERAD substrate are found throughout the ER in untreated cells (Kamhi-Nesher et al., 2001
; Frenkel et al., 2004
). Indeed, ERManI colocalized with accumulated CNX only after cell treatment with lactacystin (Figure 4, D and E). To rule out that ERManI localizes in untreated cells to the ERGIC or Golgi (also in the centrosomal region), we performed double labeling of cells with markers of these compartments and found basically no colocalization (Figure 4, F and G). There was no colocalization either with the ER-resident oxidoreductase ERp57 (Figure 4G), which we had shown to be distributed throughout the ER and not to concentrate in the ERQC (Frenkel et al., 2004
). The pattern of ERManI is most likely not the result of overexpression, because under the same conditions of expression HA-tagged Golgi mannosidase I C (homologous to ERManI) was located entirely in the Golgi, colocalizing with the Golgi marker β1,3-galactosyltransferase linked to YFP (GalT-YFP) (Figure 4H). ERManI showed no overlap with GalT-YFP (Figure 4G). Furthermore, ERManI occurred in the juxtanuclear pattern under a wide range of expression levels (Supplemental Figure 2).
|
We studied the three-dimensional distribution of ERManI compared with GalT-YFP by deconvolution analysis. ERManI showed a juxtanuclear concentration, surrounding the Golgi and with some continuity with the nuclear envelope (Figure 4, K–M, and Supplemental Video). This imaging allowed a quantitative analysis of the localization of ERManI. We calculated that the volume occupied by ERManI in the ERQC is on average
6% of the total volume that it occupies in the cell, namely, the ERQC plus the peripheral ER. Nevertheless, this relatively small compartment concentrates almost half of the total amount of ERManI in the cell. Therefore, we estimate that the concentration in the ERQC in NIH 3T3 cells is
10-fold higher than that in the peripheral ER (Table 1). The peripheral ERManI is distributed in a large volume, spreading that makes it hardly visible outside of the ERQC. The volume occupied by concentrated ERManI (and consequently by the ERQC) gave an average of 29 µm3 (Table 2). This was compared with the volume of the region occupied by GalT (medial- and trans-Golgi), which gave an average of 13 µm3, the same order of magnitude as that determined by stereological measurement from ultrathin sections by electron microscopy (Mironov and Mironov, 1998
). As expected, there was variation in the volume of the ERQC and of the Golgi between cells, but the ratio of the volumes of these compartments in any given cell was surprisingly constant, ERManI occupying a little over double the volume occupied by GalT (2.26 ± 0.14-fold; Table 2). The confinement of ERManI with ERAD substrates in the ERQC could provide the required relatively high concentration for the removal of all
1,2-linked mannose residues from the precursor oligosaccharide.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
1,2-linked mannose residues from N-linked oligosaccharide precursors targets glycoproteins that are misfolded or otherwise misprocessed to ERAD (Frenkel et al., 2003
-mannosidases might also be involved, evidence for their function at endogenous levels is still lacking. The ERManI knockdown experiments clearly indicate that endogenous ERManI can trim the oligosaccharides to species smaller than M8 in vivo, removing more than one and possibly all four
1,2-linked mannose residues (Figure 3). Its action is therefore not restricted to removing only the middle branch terminal mannose-b (see scheme in Figure 1D), as previously thought (Vallee et al., 2000
Figure 6 shows a working model of the early trafficking and sugar chain processing events for an N-glycosylated protein and that result either in its successful folding and exit to the Golgi or in its targeting to ERAD. These events start in the ER with binding of the newly synthesized glycoprotein to CNX or calreticulin, after removal of two glucose residues by glucosidases I and II. Some mannose residues may be removed in the ER by the relatively low concentration of ERManI. The incompletely folded (or misfolded) glycoprotein is then targeted to the pericentriolar ERQC. Removal of the last glucose residue by glucosidase II may take place just before or upon entry into the ERQC, where the relatively high concentration of ERManI can trim additional mannose residues. The glycoprotein might recycle to the peripheral ER, where it is reglucosylated by UGGT, an enzyme that is not located in the ERQC (Kamhi-Nesher et al., 2001
). It can then reassociate with CNX and return to the ERQC for another round of mannose trimming by ERManI. Proper folding releases the glycoprotein from this cycle, because it is no longer a substrate for UGGT and the glycoprotein can then be delivered to the Golgi. However, for a misfolded glycoprotein, mannose-a (Figure 1D) is ultimately trimmed to form M6 and M5, which prevents it from being reglucosylated and from reassociating with CNX; thus, it is marked for degradation. This process would be determined not simply by time of ER residence because when we had analyzed a more stable ERAD substrate (H1i5), it was trimmed more slowly to M6 and M5 (Frenkel et al., 2003
) and showed prolonged association with CNX (Shenkman et al., 1997
), compared with H2a (Frenkel et al., 2003
, 2004
). Therefore, the rate of mannose trimming and release from the CNX cycle is somehow linked to the stability of the glycoprotein. While remaining in the CNX cycle, the glycoprotein is spared from ERAD.
|
1,2-mannosidase activity in vivo (Hirao et al., 2006
Despite the appeal of the mannose trimming model, one cannot rule out that ERManI might also have another role in routing the glycoprotein to ERAD, possibly as a lectin, as was proposed in a study in Schizosaccharomyces pombe (Movsichoff et al., 2005
). This would be consistent with the location of ERManI in the ERQC, where we have found several components of the ERAD machinery, such as Derlin-1, HRD1, and p97/VCP, on the cytosolic side (Kondratyev et al., 2007
).
Contrary to what was proposed in a previous model (that mannose trimming leads to persistence of the monoglucosylated oligosaccharides due to decreased glucosidase activity (Cabral et al., 2001
), at least in our experimental system ERManI activity decreases reglucosylation (Figure 3), which would promote ERAD by removing the glycoprotein from the CNX cycle.
Knockdown of ERManI dramatically stabilizes the substrate (Figure 2) and prevents its accumulation in the ERQC (Figure 5). This would suggest that ERManI activity is necessary for retention of the substrate in the ERQC and its delivery to the final stages of ERAD. We can speculate that in the absence of ERManI the substrate would rapidly recycle back to the peripheral ER and remain trapped in the CNX cycle, thus avoiding degradation.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Address correspondence to: Gerardo Z. Lederkremer (gerardo{at}post.tau.ac.il)
Abbreviations used: dMNJ, 1-deoxymannojirimycin; endo H, endo-β-N-acetylglucosaminidase H; ER, endoplasmic reticulum; ERAD, endoplasmic reticulum-associated degradation; ERManI, ER mannosidase I; ERQC, endoplasmic reticulum-derived quality control compartment; KIF, kifunensine; lac, lactacystin; MG-132, N-carbobenzoxyl-leucinyl-leucinyl-leucinal; UGGT, UDP-Glc:glycoprotein glucosyltransferase.
| REFERENCES |
|---|
|
|
|---|
Bhamidipati, A., Denic, V., Quan, E. M., and Weissman, J. S. (2005). Exploration of the topological requirements of ERAD identifies Yos9p as a lectin sensor of misfolded glycoproteins in the ER lumen. Mol. Cell 19, 741–751.[CrossRef][Medline]
Bieberich, E., Treml, K., Volker, C., Rolfs, A., Kalz-Fuller, B., and Bause, E. (1997). Man9-mannosidase from pig liver is a type-II membrane protein that resides in the endoplasmic reticulum. cDNA cloning and expression of the enzyme in COS 1 cells. Eur. J. Biochem 246, 681–689.[Medline]
Brummelkamp, T. R., Bernards, R., and Agami, R. (2002). A system for stable expression of short interfering RNAs in mammalian cells. Science 296, 550–553.
Cabral, C. M., Liu, Y., and Sifers, R. N. (2001). Dissecting glycoprotein quality control in the secretory pathway. Trends Biochem. Sci 26, 619–624.[CrossRef][Medline]
Carvalho, P., Goder, V., and Rapoport, T. A. (2006). Distinct ubiquitin-ligase complexes define convergent pathways for the degradation of ER proteins. Cell 126, 361–373.[CrossRef][Medline]
Denic, V., Quan, E. M., and Weissman, J. S. (2006). A luminal surveillance complex that selects misfolded glycoproteins for ER-associated degradation. Cell 126, 349–359.[CrossRef][Medline]
Ermonval, M., Kitzmuller, C., Mir, A. M., Cacan, R., and Ivessa, N. E. (2001). N-glycan structure of a short-lived variant of ribophorin I expressed in the MadIA214 glycosylation-defective cell line reveals the role of a mannosidase that is not ER mannosidase I in the process of glycoprotein degradation. Glycobiology 11, 565–576.
Frenkel, Z., Gregory, W., Kornfeld, S., and Lederkremer, G. Z. (2003). Endoplasmic reticulum-associated degradation of mammalian glycoproteins involves sugar chain trimming to Man6–5GlcNAc2. J. Biol. Chem 278, 34119–34124.
Frenkel, Z., Shenkman, M., Kondratyev, M., and Lederkremer, G. Z. (2004). Separate roles and different routing of calnexin and ERp57 in endoplasmic reticulum quality control revealed by interactions with asialoglycoprotein receptor chains. Mol. Biol. Cell 15, 2133–2142.
Gauss, R., Jarosch, E., Sommer, T., and Hirsch, C. (2006). A complex of Yos9p and the HRD ligase integrates endoplasmic reticulum quality control into the degradation machinery. Nat. Cell Biol 8, 849–854.[CrossRef][Medline]
Hebert, D. N., Garman, S. C., and Molinari, M. (2005). The glycan code of the endoplasmic reticulum: asparagine-linked carbohydrates as protein maturation and quality-control tags. Trends Cell Biol 15, 364–370.[CrossRef][Medline]
Helenius, A., and Aebi, M. (2004). Roles of N-linked glycans in the endoplasmic reticulum. Annu. Rev. Biochem 73, 1019–1049.[CrossRef][Medline]
Herscovics, A. (2001). Structure and function of Class I alpha 1,2-mannosidases involved in glycoprotein synthesis and endoplasmic reticulum quality control. Biochimie 83, 757–762.[Medline]
Herscovics, A., Romero, P. A., and Tremblay, L. O. (2002). The specificity of the yeast and human class I ER alpha 1,2-mannosidases involved in ER quality control is not as strict as previously reported. Glycobiology 12, 14G–15G.[Medline]
Hirao, K. et al. (2006). EDEM3, a soluble EDEM homolog, enhances glycoprotein endoplasmic reticulum-associated degradation and mannose trimming. J. Biol. Chem 281, 9650–9658.
Hosokawa, N., Tremblay, L. O., You, Z., Herscovics, A., Wada, I., and Nagata, K. (2003). Enhancement of endoplasmic reticulum (ER) degradation of misfolded Null Hong Kong alpha1-antitrypsin by human ER mannosidase I. J. Biol. Chem 278, 26287–26294.
Hosokawa, N., Wada, I., Hasegawa, K., Yorihuzi, T., Tremblay, L. O., Herscovics, A., and Nagata, K. (2001). A novel ER {alpha}-mannosidase-like protein accelerates ER-associated degradation. EMBO Rep 2, 415–422.[Medline]
Hosokawa, N., Wada, I., Natsuka, Y., and Nagata, K. (2006). EDEM accelerates ERAD by preventing aberrant dimer formation of misfolded alpha1-antitrypsin. Genes Cells 11, 465–476.
Hosokawa, N., You, Z., Tremblay, L. O., Nagata, K., and Herscovics, A. (2007). Stimulation of ERAD of misfolded null Hong Kong alpha1-antitrypsin by Golgi alpha1,2-mannosidases. Biochem. Biophys. Res. Commun 362, 626–632.[CrossRef][Medline]
Igdoura, S. A., Herscovics, A., Lal, A., Moremen, K. W., Morales, C. R., and Hermo, L. (1999). Alpha-mannosidases involved in N-glycan processing show cell specificity and distinct subcompartmentalization within the Golgi apparatus of cells in the testis and epididymis. Eur. J. Cell Biol 78, 441–452.[Medline]
Kamhi-Nesher, S., Shenkman, M., Tolchinsky, S., Fromm, S. V., Ehrlich, R., and Lederkremer, G. Z. (2001). A novel quality control compartment derived from the endoplasmic reticulum. Mol. Biol. Cell 12, 1711–1723.
Kim, W., Spear, E. D., and Ng, D. T. (2005). Yos9p detects and targets misfolded glycoproteins for ER-associated degradation. Mol. Cell 19, 753–764.[CrossRef][Medline]
Kitzmuller, C., Caprini, A., Moore, S. E., Frenoy, J. P., Schwaiger, E., Kellermann, O., Ivessa, N. E., and Ermonval, M. (2003). Processing of N-linked glycans during endoplasmic-reticulum-associated degradation of a short-lived variant of ribophorin I. Biochem. J 376, 687–696.[CrossRef][Medline]
Kondratyev, M., Avezov, E., Shenkman, M., Groisman, B., and Lederkremer, G. Z. (2007). PERK-dependent compartmentalization of ERAD and unfolded protein response machineries during ER stress. Exp. Cell Res 313, 3395–3407.[CrossRef][Medline]
Lederkremer, G. Z., and Glickman, M. H. (2005). A window of opportunity: timing protein degradation by trimming of sugars and ubiquitins. Trends Biochem. Sci 30, 297–303.[CrossRef][Medline]
Mast, S. W., Diekman, K., Karaveg, K., Davis, A., Sifers, R. N., and Moremen, K. W. (2005). Human EDEM2, a novel homolog of family 47 glycosidases, is involved in ER-associated degradation of glycoproteins. Glycobiology 15, 421–436.
Mast, S. W., and Moremen, K. W. (2006). Family 47 alpha-mannosidases in N-glycan processing. Methods Enzymol 415, 31–46.[CrossRef][Medline]
Mironov, A. A., Jr, and Mironov, A. A. (1998). Estimation of subcellular organelle volume from ultrathin sections through centrioles with a discretized version of the vertical rotator. J. Microsc 192, 29–36.[Medline]
Moremen, K. W., and Molinari, M. (2006). N-linked glycan recognition and processing: the molecular basis of endoplasmic reticulum quality control. Curr. Opin. Struct. Biol 16, 592–599.[CrossRef][Medline]
Movsichoff, F., Castro, O. A., and Parodi, A. J. (2005). Characterization of Schizosaccharomyces pombe ER alpha-mannosidase: a reevaluation of the role of the enzyme on ER-associated degradation. Mol. Biol. Cell 16, 4714–4724.
Olivari, S., Cali, T., Salo, K. E., Paganetti, P., Ruddock, L. W., and Molinari, M. (2006). EDEM1 regulates ER-associated degradation by accelerating de-mannosylation of folding-defective polypeptides and by inhibiting their covalent aggregation. Biochem. Biophys. Res. Commun 349, 1278–1284.[CrossRef][Medline]
Olivari, S., Galli, C., Alanen, H., Ruddock, L., and Molinari, M. (2005). A novel stress-induced EDEM variant regulating endoplasmic reticulum-associated glycoprotein degradation. J. Biol. Chem 280, 2424–2428.
Olivari, S., and Molinari, M. (2007). Glycoprotein folding and the role of EDEM1, EDEM2 and EDEM3 in degradation of folding-defective glycoproteins. FEBS Lett 581, 3658–3664.[CrossRef][Medline]
Parodi, A. J. (2000). Protein glucosylation and its role in protein folding. Annu. Rev. Biochem 69, 69–93.[CrossRef][Medline]
Ruddock, L. W., and Molinari, M. (2006). N-glycan processing in ER quality control. J. Cell Sci 119, 4373–4380.
Sayeed, A., and Ng, D. T. (2005). Search and destroy: ER quality control and ER-associated protein degradation. Crit. Rev. Biochem. Mol. Biol 40, 75–91.[CrossRef][Medline]
Shenkman, M., Ayalon, M., and Lederkremer, G. Z. (1997). Endoplasmic reticulum quality control of asialoglycoprotein receptor H2a involves a determinant for retention and not retrieval. Proc. Natl. Acad. Sci. USA 94, 11363–11368.
Szathmary, R., Bielmann, R., Nita-Lazar, M., Burda, P., and Jakob, C. A. (2005). Yos9 protein is essential for degradation of misfolded glycoproteins and may function as lectin in ERAD. Mol Cell 19, 765–775.[CrossRef][Medline]
Tolchinsky, S., Yuk, M. H., Ayalon, M., Lodish, H. F., and Lederkremer, G. Z. (1996). Membrane-bound versus secreted forms of human asialoglycoprotein receptor subunits: role of a juxtamembrane pentapeptide. J. Biol. Chem 271, 14496–14503.
Tremblay, L. O., and Herscovics, A. (1999). Cloning and expression of a specific human alpha 1,2-mannosidase that trims Man9GlcNAc2 to Man8GlcNAc2 isomer B during N-glycan biosynthesis. Glycobiology 9, 1073–1078.
Tremblay, L. O., and Herscovics, A. (2000). Characterization of a cDNA encoding a novel human Golgi alpha 1, 2-mannosidase (IC) involved in N-glycan biosynthesis. J. Biol. Chem 275, 31655–31660.
Trombetta, E. S., and Parodi, A. J. (2003). Quality control and protein folding in the secretory pathway. Annu. Rev. Cell Dev. Biol 19, 649–676.[CrossRef][Medline]
Vallee, F., Karaveg, K., Herscovics, A., Moremen, K. W., and Howell, P. L. (2000). Structural basis for catalysis and inhibition of N-glycan processing class I alpha 1,2-mannosidases. J. Biol. Chem 275, 41287–41298.
Velasco, A., Hendricks, L., Moremen, K. W., Tulsiani, D. R., Touster, O., and Farquhar, M. G. (1993). Cell type-dependent variations in the subcellular distribution of alpha-mannosidase I and II. J. Cell Biol 122, 39–51.
Wu, Y., Swulius, M. T., Moremen, K. W., and Sifers, R. N. (2003). Elucidation of the molecular logic by which misfolded alpha 1-antitrypsin is preferentially selected for degradation. Proc. Natl. Acad. Sci. USA 100, 8229–8234.
Wu, Y., Termine, D. J., Swulius, M. T., Moremen, K. W., and Sifers, R. N. (2007). Human endoplasmic reticulum mannosidase I is subject to regulated proteolysis. J. Biol. Chem 282, 4841–4849.
Yuk, M. H., and Lodish, H. F. (1993). Two pathways for the degradation of the H2 Subunit of the asialoglycoprotein receptor in the endoplasmic reticulum. J. Cell Biol 123, 1735–1749.
Zuber, C., Cormier, J. H., Guhl, B., Santimaria, R., Hebert, D. N., and Roth, J. (2007). EDEM1 reveals a quality control vesicular transport pathway out of the endoplasmic reticulum not involving the COPII exit sites. Proc. Natl. Acad. Sci. USA 104, 4407–4412.
This article has been cited by other articles:
![]() |
N. Hosokawa, Y. Kamiya, D. Kamiya, K. Kato, and K. Nagata Human OS-9, a Lectin Required for Glycoprotein Endoplasmic Reticulum-associated Degradation, Recognizes Mannose-trimmed N-Glycans J. Biol. Chem., June 19, 2009; 284(25): 17061 - 17068. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Termine, K. W. Moremen, and R. N. Sifers The mammalian UPR boosts glycoprotein ERAD by suppressing the proteolytic downregulation of ER mannosidase I J. Cell Sci., April 1, 2009; 122(7): 976 - 984. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Jablonka-Shariff, C. A. Pearl, A. Comstock, and I. Boime A Carboxyl-terminal Sequence in the Lutropin {beta} Subunit Contributes to the Sorting of Lutropin to the Regulated Pathway J. Biol. Chem., April 25, 2008; 283(17): 11485 - 11492. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Caramelo and A. J. Parodi Getting In and Out from Calnexin/Calreticulin Cycles J. Biol. Chem., April 18, 2008; 283(16): 10221 - 10225. [Full Text] [PDF] |
||||
![]() |
U. R. Mbonye, C. Yuan, C. E. Harris, R. S. Sidhu, I. Song, T. Arakawa, and W. L. Smith Two Distinct Pathways for Cyclooxygenase-2 Protein Degradation J. Biol. Chem., March 28, 2008; 283(13): 8611 - 8623. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||