![]() |
|
|
Vol. 19, Issue 1, 297-307, January 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institute of Molecular and Cell Biology, Singapore 138673, Republic of Singapore
Submitted June 5, 2007;
Revised September 24, 2007;
Accepted October 22, 2007
Monitoring Editor: Howard Riezman
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Actin assembly during endocytosis is initiated by the Arp2/3 complex, whose activity is stimulated by a number of nucleation promoting factors (NPFs) including Las17p (WASP), Pan1p, Abp1p, and Myo5p (Sun et al., 2006
). The need for involving multiple NPFs in endocytosis apparently stems from the requirement for actin assembly at different stages of endocytosis. While Las17p is responsible for the actin assembly at endocytic sites for membrane invagination, Myo5p is most important in the actin polymerization event during the inward movement of the vesicles (Sun et al., 2006
). Pan1p, on the other hand, functions redundantly with Las17p in promoting actin assembly at endocytic sites (Duncan et al., 2001
; Toshima et al., 2005
, 2007
; Sun et al., 2006
).
Pan1p is a special endocytic protein in that it is involved in a diverse range of events in endocytosis and actin dynamics. In addition to its part in promoting actin assembly as a nucleation promoting factor, Pan1p also acts as the root component of the endocytic complex by virtue of its ability to interact with many endocytic proteins including End3p, Sla1p (Cin85), Sla2p (Hip1), Ent1/2p (epsin), Yap1801/2p (AP180), and Scd5p (Wendland et al., 1996
; Tang et al., 1997
; Wendland and Emr, 1998
; Tang et al., 2000
; Huang et al., 2003
; Toshima et al., 2007
). Furthermore, Pan1p is able to bind directly to actin filaments (Toshima et al., 2005
), thus providing an anchor point for actin meshwork to associate with the endocytic complex. The fact that these functions are required at different phases of vesicle formation and internalization begs a regulatory mechanism to modulate and coordinate the activities of Pan1p during these stages. Pan1p appears on the cortical patches shortly before actin assembly can be detected (Kaksonen et al., 2003
). A recent study showed that, during this period of time, the ability of Pan1p to recruit and activate the Arp2/3 complex is inhibited by its binding protein Sla2p (Toshima et al., 2007
). This would conceivably enable Pan1p to assemble an early endocytic complex in place before membrane invagination is allowed to occur. Consistently, Las17p is similarly inhibited by Sla1p during this time (Rodal et al., 2003
; Sun et al., 2006
).
The overall function of Pan1p is under a negative regulation by Prk1p, a member of the Prk1 family of kinases, which is composed of Prk1p, Ark1p, and Akl1p (Smythe and Ayscough, 2003
). Although none is essential for life, deletion of PRK1 and ARK1 genes together renders the cell temperature sensitive and severely defective in actin organization and endocytosis, indicating that some crucial functions are shared between these two kinases (Cope et al., 1999
). Prk1p phosphorylates a number of endocytic proteins in vivo, including Pan1p, Sla1p, Scd5p, Yap1801/2p, and Ent1/2p (Zeng et al., 2001
; Watson et al., 2001
; Huang et al., 2003
; Henry et al., 2003
), with Pan1p and Sla1p containing most abundant consensus phosphorylation sites of (L/I/V/M)xx(Q/N/T/S)xTG (Huang et al., 2003
). Phosphorylation by Prk1p leads to dissociation between Pan1p and Sla1p (Zeng et al., 2001
) and inhibition of Pan1p's ability to activate the Arp2/3p complex and to bind to actin filaments (Toshima et al., 2005
). This suggests that phosphorylation of Pan1p by Prk1p is a regulatory step in endocytosis to allow the vesicles to be detached from actin and uncoated. Compared with Prk1p, Ark1p and Akl1p have been barely studied and their functional characteristics are essentially unknown. While they probably recognize the similar phosphorylation motifs as Prk1p (Zeng et al., 2001
; Henry et al., 2003
), the functions of the three kinases in vivo are not entirely identical, as they have distinct genetic interactions with other endocytic proteins (Cope et al., 1999
). Previous reports showed that the cortical patch localization of both Prk1p and Ark1p is mainly dependent on Abp1p, through the binding between their C-terminal polyproline motifs and the SH3 domain of Abp1p (Cope et al., 1999
; Fazi et al., 2002
). However, deletion of ABP1 does not result in a similar phenotype as seen in the ark1 prk1 mutant, suggesting that Abp1p is not the only anchor for the kinases.
In this study, we set out to analyze the distinct functions between Prk1p and Ark1p. Through genetic and biochemical analysis, we discovered that the divergent nonkinase regions differentiate the functions of the two kinases. A unique sequence located next to the kinase domain of Prk1p is required for the kinase to interact with Arp2p and this interaction is principally responsible for phosphorylation of Pan1p in vivo.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
|
Two-Hybrid Assay, Protein Binding, and Coimmunoprecipitation
For the yeast two-hybrid assay, DNA fragments of ARP2 and PRK1D158Y were fused to the hemagglutinin (HA)-tagged GAL4 activation domain of pGADT7 or the Myc-tagged DNA-binding domain of pGBKT7 as described in Table 2. Plasmids were cotransformed into the strain SFY526 and the expression of each fusion protein was confirmed by Western blotting with anti-HA or anti-Myc antibodies. The β-galactosidase activities were measured as instructed by the manufacturer (CLONTECH, Palo Alto, CA). For glutathione S-transferase (GST) fusion protein binding, 400 µl of
3 mg of purified His-tag proteins was incubated with GST fusion protein coupled beads for 1 h at 4°C, washed five times with RIPA, and eluted into SDS-PAGE sample buffer. Coimmunoprecipitation of Prk1p and Arp2p followed the procedure described in Lechler et al. (2000)
.
Escherichia coli Coexpression Kinase Assay
The bicistronic expression plasmids for E. coli coexpression assay were generated as follows: The coding regions of the substrates (SR, SRmut, or LR1, LR2) followed by three stop codons, a translational enhancer, and a Shine-Dalgarno sequence (5'CGTGCTCGTGCTAATAATTTTGTTTAACTTTAAGAAGGAGATATA3'; Tan, 2001
) were fused to the kinase domains of either Ark1p or Prk1p (containing an HA tag at the C-termini) by PCR and then cloned in frame into the BamHI and XhoI sites of pGex-4T-1 (Amersham Biosciences, Piscataway, NJ). The expression plasmids were transformed into E. coli BL21. The expression of GST fusion proteins and HA-tagged kinases were induced with 1 mM isopropyl-1-thio-b-D-galactopyranoside at 30°C for 1 h. The purified GST-fusion substrates were subjected to SDS-PAGE and Western blot to show the phosphothreonine status. The nitrocellulose membranes with blotted GST fusion proteins were stained with Coomassie blue to visualize the GST fusion proteins.
| RESULTS |
|---|
|
|
|---|
60 kDa. The phosphorylation was confined to the predicted Prk1 recognition sites, as converting all the threonine residues in these consensus sites to alanine (GST-SRmut) by site-directed mutagenesis abolished phosphorylation by either Ark1p or Prk1p, even though numerous other threonine residues were still present. Similar experiments were also carried out with two Pan1p N-terminal long repeats (LR): LR1 and LR2 (Zeng and Cai, 1999
|
, ark1
, prk1
akl1
, and prk1
ark1
akl1
cells were examined by immunoblotting with an anti-phospho-threonine antibody. The level of Sla1p phosphorylation from prk1
, ark1
, prk1
ark1
, or prk1
akl1
cells was similar to that of wild-type cells, whereas no signal was detected from the triple deletion prk1
ark1
akl1
cells or after phosphatase treatment (CIP), indicating that Ark1p could indeed phosphorylate Sla1p in vivo (Figure 1C). In fact, the level of Sla1p phosphorylation remained essentially unchanged as long as one of the three kinases was functional (data not shown). In contrast, deletion of the PRK1 gene alone resulted in a drastic reduction in the Pan1p phosphorylation (Figure 1C), suggesting that Pan1p, unlike Sla1p, is more restricted to the regulation by Prk1p. These results revealed that, despite the presence of similar phosphorylation motifs in both proteins, Pan1p and Sla1p are subjected to different modes of regulation by different Prk1p-like kinases in vivo.
Nonkinase Domains Mediate Distinct Genetic Interactions
Previous genetic studies have suggested some functional differences between Ark1p and Prk1p (Cope et al., 1999
). Consistent with the Pan1p phosphorylation in vivo being primarily dependent on Prk1p, we also found that a temperature-sensitive mutant of PAN1, pan1-4, could be suppressed by deletion of PRK1 but not ARK1 (Zeng and Cai, unpublished data). pan1-4 is a nonsense mutation in the C-terminal part of LR2 near the End3p binding region (a C-to-T mutation at nucleotide 2545). The truncated protein of 848 aa is unable to bind to End3p at the nonpermissive temperature and therefore is hyperphosphorylated at 37°C (Tang and Cai, unpublished data). Consequently, the temperature sensitivity of pan1-4 can be suppressed by either deletion of PRK1 or overproduction of End3p (Tang et al., 1997
; Zeng and Cai, 1999
), both of which abrogate the hyperphosphorylation of the mutant protein. That deletion of ARK1 could not suppress pan1-4 implies that this kinase is not critical for the phosphorylation of Pan1p in vivo. As the two kinases share extensive sequence similarity in their N-terminal kinase domain, we suspected that any in vivo functional distinctions between them should be resulted from their divergent C-terminal regions. To evaluate the functional importance of the nonkinase domains, we swapped their kinase domains (1-298 aa of Prk1p and 1-299 aa of Ark1p) to create two chimeric kinases named Prk1n-Ark1c (with the Prk1p kinase domain) and Ark1n-Prk1c (with the Ark1p kinase domain), as shown in Figure 2A. Both fusion genes were expressed from the PRK1 promoter, and the expression levels of Prk1n-Ark1c and Ark1n-Prk1c were confirmed by Western blotting to be same as their wild-type counterparts (Supplementary Figure A). After introduction into prk1
ark1
cells, both fusion genes were able to rescue the mutant's temperature sensitivity at 37°C and its actin and endocytosis defects (Figure 2B, left panel and data not shown), indicating that the fusion kinases were functional. Interestingly, after they were introduced into pan1-4 prk1
cells, it was Ark1n-Prk1c that imitated the activity of Prk1p to reconstitute the temperature-sensitivity in the mutant (Figure 2B, right panel). Consistently, the level of Pan1p phosphorylation at 30°C was similarly high in the cells expressing Prk1p and Ark1n-Prk1c and equally low in Ark1p- and Prk1n-Ark1c–containing cells (Figure 2C). These results together confirmed our prediction that it is the nonkinase domain that is responsible for the distinct functions of Prk1p and Ark1p kinases.
|
ark1
. In addition, unlike Ark1p, whose cortical association was completely eliminated in the abp1 mutant, the cortical localization of some Prk1p proteins has been noted to be Abp1p-independent (Cope et al., 1999
ark1
cells. The expression levels of Prk1p
PP and Ark1p
PP were confirmed by Western blotting to be same as their wild-type counterparts (Supplementary Figure B). As shown in Figure 3A, Prk1p
PP could complement the temperature sensitivity of prk1
ark1
at 37°C, while Ark1p
PP could not. Consistent with this, Prk1p
PP was still able to localize to the cortical patches, while Ark1p
PP was diffused in the cell (Figure 3B). Moreover, Prk1p
PP also rescued the actin defects in the prk1
ark1
cells to the extent indistinguishable from the wild type, whereas considerable actin aggregates were still visible in the cells expressing Ark1p
PP, although in smaller sizes than those in prk1
ark1
cells (Figure 3C). These results suggest that Prk1p, but not Ark1p, could function independently of the polyproline motif. This also explains an earlier observation that the prk1
abp1
mutant acquired a similar actin defect as in the prk1
ark1
mutant whereas the ark1
abp1
mutant did not (Cope et al., 1999
|
PP with a number of known actin patch-associated proteins including Pan1p, Sla1p, End3p, Scd5p, Sac6p, Cap1p, Cap2p, Arp2p, and Arp3p. Among them, Arp2p, the core component of Arp2/3 complex, was found capable of binding to Prk1p
PP but not to Ark1p
PP (Figure 4A). Using various deletion constructs of Prk1p, the region necessary for interacting with Arp2p was localized to a 21-amino acid region (299-319 aa) next to the kinase domain. To determine whether the interaction between Prk1p and Arp2p is direct, the binding between His-tagged Arp2p and GST-Prk11-319 was investigated. Equal amounts of bead-immobilized GST-Prk11-319 and GST-Prk11-298 (kinase domain only) were mixed with equal amount of purified His-Arp2, respectively. After washing, the bound proteins were analyzed by Western blot with anti-GST and anti-His antibodies. As shown in Figure 4B, His-Arp2 could be precipitated by GST-Prk11-319 but not by GST-Prk11-298, indicating that the 21-amino acid motif is required for the direct binding of Prk1p to Arp2p. The interaction between Prk1p and Arp2p was further confirmed by coimmunoprecipitation. The PRK1 gene without the C-terminal poly-P region, PRK1
PP, was tagged with the Myc-epitope and placed under the GAL1 promoter to enhance its expression. After galactose induction for 2 h, cell lysates were prepared and Myc-Prk1p was precipitated. As shown in Figure 4C, HA-Arp2 could be coimmunoprecipitated by the anti-Myc antibody. The coimmunoprecipitation was abolished if the 21 aa region of Prk1p was replaced by the corresponding region from Ark1p (Prk1AR
PP).
|
PP were placed under the control of GAL1 promoter and transformed into wild-type cells. The cortical GFP signals were observed only in the cells expressing Prk1-GFP, Prk11-319-GFP, and Prk1AR-GFP. On the other hand, the GFP signals of Prk11-298-GFP and Prk1AR
PP-GFP were diffused in the cytoplasm (Figure 5). This result indicates that either the Arp2p-interacting region or the Abp1p-interacting region is sufficient for Prk1p to be localized to cortical patches. Moreover, we also noted that more than 90% of the Prk1-GFP and Prk11-319-GFP patches colocalized with the actin patches.
|
Pan1p Phosphorylation by Prk1p Depends on the Prk1p-Arp2p Interaction
To evaluate the functional significance of the Arp2p-Prk1p interaction, wild-type Prk1p, Prk11-319 and Prk11-298 and Prk1AR (with the polyproline region) were transformed into prk1
ark1
and pan1-4 prk1
cells, respectively, and their expressions were confirmed by Western analysis (Supplementary Figure C). The resultant strains were tested for growth at 37°C. Wild-type Prk1p, Prk11-319, and Prk1AR could rescue the temperature sensitivity of prk1
ark1
at 37°C, whereas the kinase domain alone (Prk11-298) failed to do the same (Figure 6A, left panel). Similarly, wild-type Prk1p, Prk11-319, and Prk1AR could rescue the actin defect and the defect in Lucifer Yellow uptake of the prk1
ark1
cells, whereas Prk11-298 and Prk1AR
PP could not (Figure 6B). This result suggests that so long as the localization to the cortical patches is achieved, either by the interaction with Arp2p or with Abp1p, Prk1p will be able to perform the essential functions shared between itself and Ark1p. However, only the interaction with Arp2p enables Prk1p to perform Prk1p-specific functions, as only wild-type Prk1p and Prk11-319 could restore the temperature sensitivity to pan1-4 prk1
cells at 37°C, whereas Prk1AR, despite its ability to localize to the cortical patches and to rescue the double kinase deletion mutant, failed to do so (Figure 6A, right panel). Consistently, replacement of the same region in Ark1p with the 21 aa Arp2p binding region of Prk1p allowed the new kinase (Ark1PR) to carry out Prk1p-specific functions, as it was now able to restore the temperature sensitivity in pan1-4 prk1
cells at 37°C (Figure 6C).
|
cells is an indicator of the ability to phosphorylate Pan1p in vivo. To verify the phosphorylation of Pan1p in vivo as the Prk1p-specific function mediated by Arp2p, we first analyzed the phosphorylation status of Pan1p in the prk1
ark1
mutant carrying Prk11-319, Prk11-298, or Prk1AR. Indeed, Prk11-319 restored Pan1p phosphorylation close to the wild-type level, whereas Prk11-298 had no effect (Figure 7A). Prk1AR, which is a functional equivalent of Ark1p, was able to increase the Pan1p phosphorylation level only slightly, approximately to the residual Pan1p phosphorylation level remained in the prk1
mutant (
20% of the wild-type level). The pan1-4 mutant protein (Pan1-4p), as noted previously, exhibited a high steady-state level of phosphorylation at 37°C in the presence of wild-type Prk1p (Figure 7B). The similar high level of phosphorylation was maintained by the kinase variants that possessed the Arp2p-binding capacity, i.e., Ark1n-Prk1c and Ark1PR, but not by those that did not (Ark1, Prk1n-Ark1c, and Prk1AR; Figure 7C). This result confirms that the interaction with Arp2p is responsible for the Prk1p-specific phosphorylation of Pan1p and suggests that Arp2p and Abp1p recruit the Prk1p kinase for different regulatory purposes.
|
| DISCUSSION |
|---|
|
|
|---|
ark1
, but absent from prk1
akl1
cells (Toshima et al., 2005
It remains to be resolved whether Ark1p and Prk1p recognize the identical set of motifs in Pan1p and Sla1p. Henry et al. (2003)
previously showed by the in vitro kinase assay that the preferred recognition motif for Ark1p was LxxAxTG instead of LxxQ/TxTG, which had been determined for Prk1p (Zeng and Cai, 1999
; Huang et al., 2003
). The significance of this minor deviation, however, is not known. Interestingly, we found that the in vivo phosphorylation level of Pan1p was primarily dependent on Prk1p, as it decreased nearly 80% in the prk1 mutant, whereas the Sla1p phosphorylation level remained unchanged with any one of the three kinases present. This result could not be explained simply by the suggested motif preference mentioned above, as the vast majority (97%) of the 19 and 10 potential Prk1/Ark1 sites in Pan1p and Sla1p, respectively, are non-LxxAxTG sites (Huang et al., 2003
). Clearly, distinct regulatory mechanisms must be at work to allow different kinases to differentiate their targets.
The distinct functions of Prk1p and Ark1p were first uncovered by genetic analyses. Loss of Prk1p, but not Ark1p, was found to be lethal to the sla2
mutant and caused severe actin defects in abp1
cells (Cope et al., 1999
). We also knew that a temperature-sensitive mutant of Pan1p, pan1-4, could be suppressed by prk1
, but not by ark1
. Until the present study, the molecular basis underlining the distinct genetic interactions has remained unknown.
Nonkinase Regions Account for Distinct Functions of Ark1p and Prk1p
Prk1p and Ark1p share little sequence similarity beyond their highly homologous kinase domains. It is reasonable to speculate that the distinct functions of Ark1p and Prk1p may be mediated by the divergent C-terminal regions. This was proved to be the case by the domain swap experiments. It is rather striking that the Pan1p phosphorylation was recovered to the near wild-type level by the kinase domain of Ark1p fused to the nonkinase domain of Prk1p, whereas the Prk1p kinase domain became incompetent to perform what used to be its native task after it acquired the nonkinase domain of Ark1p. Clearly, the nonkinase domains are critical for the differential activities of Prk1p and Ark1p, at least as manifested in the phosphorylation of Pan1p.
The only element from the nonkinase region that has been known to be important for the function of the kinases is a short proline rich (poly-P) motif, which is thought to be responsible for the patch localization of Ark1p and Prk1p via interaction with Abp1p (Fazi et al., 2002
). The poly-P motif, however, ought not to be the sole determinant for patch localization of the kinases, as deletion of ABP1 elicited no obvious actin and endocytic defects (Holtzman et al., 1993
; Cope et al., 1999
), and no noticeable changes in the in vivo phosphorylation level of Pan1p (Supplementary Figure). In addition, while it is true that Ark1p depends exclusively on its poly-P motif for patch localization, Prk1p is able to achieve the same destination without it. By exploring this discrepancy between Prk1p and Ark1p, we identified another sequence element in the C-terminal region of Prk1p, a 21-aa motif adjacent to the kinase domain, as the second patch-anchoring point. This 21-aa motif, which is required for Prk1p to interact with Arp2p, accounts for
80% of the Pan1p phosphorylation level in vivo, whereas the remaining is contributed by the poly-P motif, which is also shared with Ark1p. Although the interaction with Abp1p via poly-P by itself is sufficient to allow Prk1p to support cell survival and apparently normal actin organization and endocytosis by maintaining an essential level of Pan1p phosphorylation, there may be some subtle events that will require more extensive phosphorylation of Pan1p achievable only through the interaction with Arp2p. While the functional difference between Abp1p- and Arp2p-anchored Prk1p kinase remains to be comprehended, it is clear that the interaction with Arp2p serves as the primary actin patch-anchoring point for Prk1p to efficiently phosphorylate Pan1p in vivo.
The Implication of Arp2p as an Anchor Protein for Prk1p
Pan1p is a key component of the cellular machinery responsible for actin organization and endocytosis. It not only acts as a scaffold for assembly of the endocytic complex by interacting with End3p, Sla1p, Sla2p, Ent1/2p, Yap1801/2p, and Scd5p, among others, but also provides a link between the vesicle and its propulsion, i.e., the Arp2/3-containing actin polymerization initiation complex and, as an NPF, even helps fire it up. It is well established that phosphorylation of Pan1p by Prk1p is an important mode of regulation during endocytosis (Toshima et al., 2005
). It marks a turning point for actin assembly at the endocytic sites. The discovery of the novel function of Arp2p as a new Prk1p anchor protein raises an intriguing possibility that an auto-regulatory mechanism may at work in this process. As Arp2p and Prk1p come to the cortical patches at about same time, possibly recruited together by NPFs, it appears that the actin assembly machinery is equipped with a brake as it starts working. It is conceivable that the Pan1p-promoted actin assembly at the endocytic sites may only need to be very transient, and such brief burst of actin polymerization may be sufficient for that particular step of event, to induce membrane invagination, for instance. This hypothesis is in line with the recent finding that the NPF activity of Pan1p is kept inhibited by its binding protein Sla2p (Toshima et al., 2007
). Although it remains unknown how Pan1p is activated from Sla2p, the finding from this study has provided some insight into how it may be quickly inactivated again by the Arp2p-mediated phosphorylation.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Address correspondence to: Mingjie Cai (mcbcaimj{at}imcb.a-star.edu.sg)
| REFERENCES |
|---|
|
|
|---|
Duncan, M. C., Cope, M. J., Goode, B. L., Wendland, B., and Drubin, D. G. (2001). Yeast Eps15-like endocytic protein, Pan1p, activates the Arp2/3 complex. Nat. Cell Biol 3, 687–690.[CrossRef][Medline]
Engqvist-Goldstein, A. E., and Drubin, D. G. (2003). Actin assembly and endocytosis: from yeast to mammals. Annu. Rev. Cell Dev. Biol 19, 287–332.[CrossRef][Medline]
Fazi, B., Cope, M. J., Douangamath, A., Ferracuti, S., Schirwitz, K., Zucconi, A., Drubin, D. G., Wilmanns, M., Cesareni, G., and Castagnoli, L. (2002). Unusual binding properties of the SH3 domain of the yeast actin-binding protein Abp1, structural and functional analysis. J. Biol. Chem 277, 5290–5298.
Henry, K. R., D'Hondt, K., Chang, J. S., Nix, D. A., Cope, M. J., Chan, C. S., Drubin, D. G., and Lemmon, S. K. (2003). The actin-regulating kinase Prk1p negatively regulates Scd5p, a suppressor of clathrin deficiency, in actin organization and endocytosis. Curr. Biol 13, 1564–1569.[CrossRef][Medline]
Holtzman, D. A., Yang, S., and Drubin, D. G. (1993). Synthetic-lethal interactions identify two novel genes, SLA1 and SLA2, that control membrane cytoskeleton assembly in Saccharomyces cerevisiae. J. Cell Biol 122, 635–644.
Huang, B., Zeng, G., Ng, A. Y., and Cai, M. (2003). Identification of novel recognition motifs and regulatory targets for the yeast actin-regulating kinase Prk1p. Mol. Biol. Cell 14, 4871–4884.
Kaksonen, M., Sun, Y., and Drubin, D. G. (2003). A pathway for association of receptors, adaptors, and actin during endocytic internalization. Cell 115, 475–487.[CrossRef][Medline]
Kaksonen, M., Toret, C. P., and Drubin, D. G. (2005). A modular design for the clathrin- and actin-mediated endocytosis machinery. Cell 123, 305–320.[CrossRef][Medline]
Kaksonen, M., Toret, C. P., and Drubin, D. G. (2006). Harnessing actin dynamics for clathrin-mediated endocytosis. Nat. Rev. Mol. Cell Biol 7, 404–414.[CrossRef][Medline]
Lechler, T., Shevchenko, A., and Li, R. (2000). Direct involvement of yeast type I myosins in Cdc42-dependent actin polymerization. J. Cell Biol 148, 363–373.
Moseley, J. B., and Goode, B. L. (2006). The yeast actin cytoskeleton: from cellular function to biochemical mechanism. Microbiol. Mol. Biol. Rev 70, 605–645.
Rodal, A. A., Manning, A. L., Goode, B. L., and Drubin, D. G. (2003). Negative regulation of yeast WASp by two SH3 domain-containing proteins. Curr. Biol 13, 1000–1008.[CrossRef][Medline]
Sekiya-Kawasaki, M. et al. (2003). Dynamic phosphoregulation of the cortical actin cytoskeleton and endocytic machinery revealed by real-time chemical genetic analysis. J. Cell Biol 162, 765–772.
Shaywitz, A. J., Dove, S. L., Greenberg, M. E., and Hochschild, A. (2002). Analysis of phosphorylation-dependent protein-protein interactions using a bacterial two-hybrid system. Sci. STKE 2002, L11.
Smythe, E., and Ayscough, K. R. (2003). The Ark1/Prk1 family of protein kinases. Regulators of endocytosis and the actin skeleton. EMBO Rep 4, 246–251.[CrossRef][Medline]
Sun, Y., Martin, A. C., and Drubin, D. G. (2006). Endocytic internalization in budding yeast requires coordinated actin nucleation and myosin motor activity. Dev. Cell 11, 33–46.[CrossRef][Medline]
Tan, S. (2001). A modular polycistronic expression system for overexpressing protein complexes in Escherichia coli. Protein Expr. Purif 21, 224–234.[CrossRef][Medline]
Tang, H. Y., Munn, A., and Cai, M. (1997). EH domain proteins Pan1p and End3p are components of a complex that plays a dual role in organization of the cortical actin cytoskeleton and endocytosis in Saccharomyces cerevisiae. Mol. Cell. Biol 17, 4294–4304.[Abstract]
Tang, H. Y., Xu, J., and Cai, M. (2000). Pan1p, End3p, and S1a1p, three yeast proteins required for normal cortical actin cytoskeleton organization, associate with each other and play essential roles in cell wall morphogenesis. Mol. Cell. Biol 20, 12–25.
Toshima, J., Toshima, J. Y., Duncan, M. C., Cope, J. T., Sun, Y., Martin, A. C., Anderson, S., Yates, J. R., III, Mizuno, K., and Drubin, D. G. (2007). Negative regulation of yeast Eps15-like Arp2/3 complex activator, Pan1p, by the Hip1R-related protein, Sla2p, during endocytosis. Mol. Biol. Cell 18, 658–668.
Toshima, J., Toshima, J. Y., Martin, A. C., and Drubin, D. G. (2005). Phosphoregulation of Arp2/3-dependent actin assembly during receptor-mediated endocytosis. Nat. Cell Biol 7, 246–254.[CrossRef][Medline]
Watson, H. A., Cope, M. J., Groen, A. C., Drubin, D. G., and Wendland, B. (2001). In vivo role for actin-regulating kinases in endocytosis and yeast epsin phosphorylation. Mol. Biol. Cell 12, 3668–3679.
Wendland, B., and Emr, S. D. (1998). Pan1p, yeast eps15, functions as a multivalent adaptor that coordinates protein-protein interactions essential for endocytosis. J. Cell Biol 141, 71–84.
Wendland, B., McCaffery, J. M., Xiao, Q., and Emr, S. D. (1996). A novel fluorescence-activated cell sorter-based screen for yeast endocytosis mutants identifies a yeast homologue of mammalian eps15. J. Cell Biol 135, 1485–1500.
Yue, B. G., Ajuh, P., Akusjarvi, G., Lamond, A. I., and Kreivi, J. P. (2000). Functional coexpression of serine protein kinase SRPK1 and its substrate ASF/SF2 in Escherichia coli. Nucleic Acids Res 28, E14.[CrossRef][Medline]
Zeng, G., and Cai, M. (1999). Regulation of the actin cytoskeleton organization in yeast by a novel serine/threonine kinase Prk1p. J. Cell Biol 144, 71–82.
Zeng, G., Yu, X., and Cai, M. (2001). Regulation of yeast actin cytoskeleton-regulatory complex Pan1p/Sla1p/End3p by serine/threonine kinase Prk1p. Mol. Biol. Cell 12, 3759–3772.
This article has been cited by other articles:
![]() |
L. Ungar, N. Yosef, Y. Sela, R. Sharan, E. Ruppin, and M. Kupiec A genome-wide screen for essential yeast genes that affect telomere length maintenance Nucleic Acids Res., April 22, 2009; (2009) gkp259v1. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||