![]() |
|
|
Vol. 19, Issue 10, 4020-4031, October 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Pathology and Laboratory Medicine, Emory University School of Medicine, Atlanta, GA 30322
Submitted December 10, 2007;
Revised June 19, 2008;
Accepted June 26, 2008
Monitoring Editor: John York
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The EF-hand–containing Nox subgroup evolved early and are the most widely distributed of all Nox enzymes in biology (Bedard et al., 2007
; Kawahara et al., 2007
). Members of this subgroup include animal Nox5 and Duox enzymes, higher plant rboh (respiratory burst oxidase homolog), moss rboh, oomycete rboh, and fungal and amoebal NoxC. Predicted Nox5 genes occur in the genomes of metazoans, such as the sea anemone, Nematostella vectensis; the limpet, Lottia gigantean; the sea urchin, Strongylocentrotus purpuratus; the insects Drosophila melanogaster, Apis mellifera, Anopheles gambiae, and Aedes aegypt; the water flea, Daphnia pulex; and most vertebrates, except for rodents (Kawahara and Lambeth, 2007
; Kawahara et al., 2007
). The human Nox5 gene is expressed predominantly as two alternatively spliced forms, Nox5
and β (Banfi et al., 2001
), as well as relatively minor isoforms, Nox5
and
(Banfi et al., 2001
), and a short form Nox5 (Nox5-S) that lacks the entire EF-hand region (Cheng et al., 2001
). Nox5
is strongly expressed in the spleen, especially in the area rich in mature B- and T-lymphocytes (Banfi et al., 2001
). Nox5β mRNA is expressed in the testis especially in pachytene spermatocyte (Banfi et al., 2001
). Nox5-S is expressed in most fetal tissues (Cheng et al., 2001
), Barrett's esophageal adenocarcinoma cells (Si et al., 2007
), and microvascular endothelial cells (BelAiba et al., 2007
).
The biological and pathobiological functions of Nox5 in animals have been studied by several groups. In ovarian smooth muscle of D. melanogaster, Nox5-derived ROS participates in calcium signal transduction linked to muscle contraction and ovulation. In this system, a peptide hormone-stimulated cytosolic calcium flux required Nox5-derived ROS as an upstream signal (Ritsick et al., 2007
). Recently, the proto-oncogene c-Abl was identified as a Nox5-binding protein, indicating that Nox5 is related to cell growth and signal transduction (El Jamali et al., 2008
). In addition, in vitro studies suggest that Nox5-derived ROS enhances cell growth of prostate cancer (Brar et al., 2003
), hairy cell leukemia cells (Kamiguti et al., 2005
), and human aortic smooth muscle cells (Jay et al., 2008
).
Originally, the regulation of Nox5 was not thought to be as complex as current investigation is revealing. Consistent with the presence of EF-hand calcium-binding motifs, human Nox5 is activated by calcium (Banfi et al., 2001
, 2004
). However, in this cell-free assay, a high concentration of calcium (>7 µM) is required to activate Nox5, which raised the question of whether it can be regulated within the physiological concentration range of intracellular calcium (Banfi et al., 2004
). Recently, it was shown that phorbol 12-myristate 13-acetate (PMA)-stimulated cells induced phosphorylation of Nox5 on Thr494 and Ser498, resulting in activation of Nox5 by lower levels of calcium (Jagnandan et al., 2007
; Serrander et al., 2007
). In addition, calmodulin has been proposed as a modulator of Nox5 activity, because its recombinant addition in vitro also sensitized Nox5 to lower calcium concentrations (Tirone and Cox, 2007
).
The present studies were motivated by our previous investigations of the structurally conserved regions specific for each Nox subfamily (Kawahara et al., 2007
). Detailed comparisons of 18 Nox5 ortholog sequences from eukaryotic genomes identified two highly conserved polybasic regions: an N-terminal polybasic region (PBR-N) and a C-terminal polybasic region (PBR-C). PBR-N consist of residues 187-197 located between the fourth EF-hand motif and first transmembrane region (GenBank accession no. AAK57338). PBR-C is located in primary sequence between first and second predicted NADPH-binding subregions at residues 578-583 of the human Nox5
sequence (see alignments of Supplemental Data S1 and S2, respectively).
The conservation of these polybasic regions among sequence Nox5 orthologues suggested that they might give important roles in Nox5 enzymatic activity, regulation, or other functions. Recently it was found that short regions of basic residues can bind to phosphorylated forms of phosphatidylinositol (PtdIns) lipids (McLaughlin et al., 2002
; Heo et al., 2006
), resulting in the protein's localization to the plasma membrane. Such a localization mechanism is used by various proteins including several small GTPases (Ueyama et al., 2005
; Heo et al., 2006
), Wiskott-Aldrich syndrome protein (Prehoda et al., 2000
), phospholipase D (Sciorra et al., 1999
), and MyD88 adaptor-like protein (Kagan and Medzhitov, 2006
). Herein, we tested the hypothesis that PtdIns phosphate modulates Nox5 activity or localization via these polybasic regions. PBR-N but not PBR-C was found to regulate the localization of Nox5, thereby affecting its production of extracellular ROS.
| MATERIALS AND METHODS |
|---|
|
|
|---|
. Because the PBR-C overlapped partially with the antigen, another rabbit anti-human Nox5 antibody, kindly provided by Dr. Karl-Heinz Krause (Geneva Medical Faculty and University Hospitals, Geneva, Switzerland), was also used in Figures 1F and 5B; this antibody was raised against recombinant protein corresponding to residues 1-169 of human Nox5
(Banfi et al., 2001
were synthesized by the Emory University Microchemical Facility (Atlanta, GA).
Constructs
Mutations were introduced by PCR-mediated mutagenesis as described previously (Kawahara et al., 2005
). Nox5-R190A (Arg190 of human Nox5
substituted with Ala) was constructed by amplifying human Nox5
cDNA (GenBank accession No. AAK57338) using primer set A (primer-1: GCATGGATCCACCATGAACACATCTGGAGA; R190A-primer 2, TGACGGCTCCTGCTCCTGCTCCAAGACCTAGACGTCCT) and primer set B (R190A-primer 3, AGGACGTCTAGGTCTTGGAGCAGGAGCAGGAGCCGTCA, primer-4 GCATAAGCTTCTAGAAATTCTCTTGGAAAAATCTGAAGCCGAAC). Nucleotides encoding the mutated amino acid are underlined in primers 2 and 3. These PCR products contain BamHI (italics) and HindIII (underlined) with primers 1 and 4, respectively. Following a second round of PCR using primers 1 and 4 and digestion by each enzyme, the nucleotide fragments were subcloned into the pCMV-tag 5A (Stratagene, La Jolla, CA). R192A, R194A, R195A, R194A/R195A, R197A, R197E, and P195A of Nox5 were generated using a similar strategy. Nox5-PBR-N-mut-A, PBR-N-mut-E, PBR-N-mut-Q, and PBR-C-mut-Q were generated by specific primers 2 and 3: PBR-N-mut-A-primer 2 (TGGCTGACGGCACCAGCACCAGAACCAGCACCGGCAGCACCGGCACAGCTGACCCGAGCATACTG), PBR-N-mut-A-primer 3 (CAGTATGCTCGGGTCAGCTGTGCCGGTGCTGCCGGTGCTGGTTCTGGTGCTGGTGCCGTCAGCCA), PBR-N-mut-Q-primer 2 (CACCACAACCACAACCGCAACAACCGCAACAGCTGACCCGAGCATACTG), PBR-N-mut-Q-primer 3 (TCAGCTGTTGCGGTTGTTGCGGTTGTGGTTGTGGTGCTGGTGCCGTCAGCCAGTG), PBR-N-mut-E-primer 2 (CACCAGAACCAGAACCGGAAGAACCGGAACAGCTGACCCGAGCATACTG), PBR-N-mut-E-primer 3 (TCAGCTGTTCCGGTTCTTCCGGTTCTGGTTCTGGTGCTGGTGCCGTCAGCCAGTG), PBR-C-mut-Q- primer 2 (AGTATCATGTACCAGCACCAGCAACAACAGCATACTTGCCCCAGCT), and PBR-C-mut-Q-primer 3 (AGCTGGGGCAAGTATGCTGTTGTTGCTGGTGCTGGTACATGATACT).
To visualize the Nox5 protein, an N-terminal GFP fusion of Nox5 was made using the pEGFP-C3 vector (BD Biosciences, San Jose, CA). Human-type I PtdIns-4-phosphate 5-kinase (PtdIns(4)P-5K) and the PH-domain of human PLC
-1 (residues 1-183) were amplified from the IMAGE clones (GenBank accession No. BC007833 and BC050382, respectively) obtained from Invitrogen (Carlsbad, CA) using primers for PtdIns(4)P-5K (TTTTGAATTCGGCGTCGGCCTCCTCCGGGCCGTCGTCTTC and TTTTGTCGACTTAATGGGTGAACTCTGACTCTGCAAC) and PH-PLC
-1 (TTTTGTCGACCACCATGGACTCGGGCCGGGACTTCCTG and TTTTGGATCCTTCCGGGCATAGCTGTCGTCCACCTG). The nucleotide fragments were digested by restriction enzymes, EcoRI (italics) and SalI (underlined) for PtdIns(4)P-5K or SalI (italics) and BamHI (underlined) for PH-PLC
-1, and were subcloned into pCMV-tag 3A (Stratagene) and pDsRed-N1 (BD Biosciences) vectors, respectively. The N-terminally myc-tagged PtdIns(4,5)P2-5-phosphatase domain (residues 214–644) was amplified from its cDNA (GenBank accession No. NM_019892), which was kindly provided by Dr. Balla Tamas (National Institute of Child Health and Human Development, Bethesda, MD), with primer-A, TTTTGAATTCGTCGGATCTTGCAGACTACAAGCT and primer-B, TTTTGTCGACTCAAGAAACGGAGCAGATGGTGCTGGAGTTCT. The PCR fragment was subcloned into the pCMV-tag 3A after digestion with EcoRI (italics in primer-A) and SalI (underlined in primer-B).
Measurement of ROS
HEK293 cells were grown for 24 h in six-well plates and allowed to reach to 50% confluence in 2 ml DMEM with 10% (vol/vol) fetal bovine serum, 100 U/ml penicillin, and 100 µg/ml streptomycin. Cells were transfected with vectors encoding indicated genes using FuGENE 6 obtained from Roche (Basel, Switzerland). At 48 h after transfection, cells were washed twice with HBSS containing 1 mM calcium and 1 mM magnesium ions and then harvested by centrifuging at 500 x g for 5 min. Cells (2 x 105) were resuspended in HBSS, and the cells in suspension were mixed with 200 µM luminol with 0.32 U of horseradish peroxidase (HRP) in a 200-µl total volume in each well of a 96-well plate as described previously (Kawahara et al., 2005
). Luminescence was quantified using a FluoStar luminometer (BMG Labtech, Durham, NC). Cells were treated with vehicle alone (0.1% DMSO) or with 1 µM ionomycin in DMSO to stimulate calcium-dependent ROS generation. The maximal value was achieved immediately and is the value reported.
Extracellular superoxide was measured using Diogenes (National Diagnostics, Atlanta, GA), a superoxide-enhanced chemiluminescence reagent (Shiose et al., 2001
). Resuspended cells (1 x 105) in 50 µl HBSS were mixed with an equal volume of Diogenes in each well of a 96-well plate according to the manufacture's instructions, and luminescence was quantified using a FluoStar luminometer. Superoxide is reported as SOD-inhibitable Diogenes-based luminescence. Cells were treated with vehicle (0.1% DMSO) or 1 µM ionomycin, and the maximum value was reported. Extracellular superoxide was also measured using the SOD-inhibitable increase in absorbance at 550 nm of reduced cytochrome c as previously described (Kawahara et al., 2004
). Cells cultured on six-well plates were incubated in 1 ml HBSS containing ferricytochrome c (100 µM) for 20 min at 37°C after treatment with vehicle (0.1% DMSO) or 1 µM ionomycin, and then absorbance of reduced cytochrome c with a Ultraspec spectrophotometer (GE Healthcare, Piscataway, NJ) was measured. SOD-inhibitable reduction of cytochrome c was expressed as an absorbance at 550 nm per 106 cells minus that obtained in the presence of SOD.
Preparation of Permeabilized Cells
Cultured cells were harvested and washed three times with HBSS lacking calcium and magnesium ions. Cells were treated with 5 µM thapsigargin and incubated for 20 min at 37°C to release calcium ion from intracellular stores. Cells were then washed with calcium- and magnesium-free HBSS, and resuspended in phosphate buffer (pH 7.2) containing 135 mM NaCl, 100 µg/ml BSA, and protease inhibitor mixture (Complete EDTA-free, Roche). Reduced Streptolysin-O (final concentration, 5 U/ml) was added to the 107 cells in 10 ml and incubated for 10 min at 37°C as described (Brown et al., 2003
). Cells were then chilled to 4°C, centrifuged for 5 min at 1250 x g, and washed three times with phosphate buffer (pH 7.2). Permeabilized cells were stored at 4°C until the experiment was performed.
Measurement of Superoxide Generation in Permeabilized Cells
Permeabilized cells were suspended in 30 mM MOPS buffer (pH 7.2) containing 100 mM KCl and protease inhibitor mixture (Complete EDTA-free, Roche). Buffered calcium with calculated free calcium concentrations ranging from 17 nM to 1 mM, prepared by calcium calibration buffer kits no. 2 (for 17 nM-1.35 µM) and no. 3 (for 5 µM–1 mM; Molecular Probes, Eugene, OR). Permeabilized cells (
5 x 105 cell equivalents) were aliquoted into 200 µl of buffered calcium in 30 mM MOPS buffer (pH 7.2) containing 100 µM FAD and 100 µM ferricytochrome c. After 5 min at room temperature, 1 µl NADPH solution was added to a final concentration of 200 µM with or without SOD (100 U/ml), and the kinetics of absorbance at 550-nm wavelength was measured for 10 min using a Synergy HT spectrophotometer (Bio-Tek Instruments, Winooski, VT). The permeabilized cells were then lysed with 20 mM HEPES buffer containing 1% Triton X, and the protein was quantified using the BCA protein assay reagent kit (Pierce, Rockford, IL). The rate of superoxide production was expressed as SOD-inhibitable cytochrome c reduction that was normalized to 1 min and 1 mg protein.
Biotinylation
HEK293 cells were cultured to 50–60% confluency on 10-cm-diameter dishes. Media was removed and cells were rapidly washed twice with ice-cold HBSS. Cells were biotinylated with sulfo-NHS-SS-Biotin (Pierce) in isotonic labeling buffer (100 mM NaCl, 4 mM KCl, 1 mM MgCl2, 1 mM CaCl2, 30 mM NaHCO3, and 0.1 M sodium phosphate, pH 7.2) at 4°C for 20 min according to the manufacture's instructions (Pierce). The reactions were quenched with quenching buffer containing 50 mM Tris in HBSS buffer, and the cells (4 x 107 cells) were incubated with lysis/washing buffer (50 mM Tris/HCl, pH 8.0, containing 150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate, and protease inhibitor mixture; Complete; Roche) for 1 h at 4°C with gentle shacking. Lysates were centrifuged at 12,000 x g for 5 min at 4°C. After removing an aliquot of the supernatant, streptavidin-conjugated Sepharose beads (GE Healthcare, Pittsburgh, PA) were added to the remainder of supernatant and mixed by gentle rotation for 60 min, followed by washing three times. Laemmli sample buffer (2x, Bio-Rad Laboratories, Hercules, CA) containing protease inhibitor mixture (Complete) and 25 mM Tris(2-carboxyethyl)phosphine (TCEP, Pierce) was added to the beads and incubated at 60°C for 30 min. After centrifuging the beads for 1 min at 1000 x g, the eluted supernatant was carefully taken as the surface fraction. This eluted fraction and an aliquot of the whole cell lysate were immunoblotted with an anti-Nox5 antibody.
Immunoblot
Whole cell extract was obtained from cultured cells lysed in Laemmli sample buffer containing protease inhibitor mixture (Complete), 100 µM diisopropyl fluorophosphate, and 25 mM TCEP. We find that the latter strong reducing agent is preferable to the other common weaker reducing agents dithiothreitol and β-mercaptoethanol (Han and Han, 1994
) because it allows visualization of Nox5 protein at 75 kDa, matching the estimated size (82 kDa) better than a previously reported size on gels of 70 kDa (Serrander et al., 2007
). Protein extracted from 8 x 104 cell equivalents were resolved by 10% SDS-PAGE and transferred to polyvinylidene difluoride (PVDF) filters as previously described (Kawahara et al., 2005
). After blocking with bovine serum albumin (3%), proteins were probed using their respective primary antibodies and HRP-conjugated secondary antibodies against rabbit and mouse IgG (Bio-Rad Laboratories). Primary antibodies were used at dilutions of 1:1000 (anti-Nox5 antibody), and 1:20,000 (anti-β-actin antibody). Visualization was carried out using an enhanced chemiluminescent substrate kit (Pierce).
Intracellular Calcium Ion Measurement
HEK293 cells (2 x 104 cells) were cultured in 96-cell plates and transfected with the indicated vectors 48 h before experiments. After removing culture medium, cells were incubated with a Fluo-4-NW (Invitrogen) loading buffer consisting of HBSS containing 20 mM HEPES, 2.5 mM probenecid, and 1.5 mM CaCl2 for 30 min at 37°C and then at room temperature for an additional 30 min, following the manufacturer's instructions. Plates were placed in a Synergy HT fluorometric system (Bio-Tek Instruments), and florescence was measured using filters for excitation at 485 nm and emission at 520 nm. Changes in intracellular Ca2+ concentration were expressed as increase in the florescence intensity (F) over resting levels (F/F0). F0 was the mean of F value of mock vector-transfected cells in absence of ionomycin treatment.
Confocal Fluorescence Imaging
HEK293 cells were seeded on glass coverslips and transfected with the indicated vectors using FuGENE 6. At 24 h after transfection, cells were fixed using 4% methanol-free formaldehyde (Polysciences, Warrington, PA) and mounted with Vectashield medium (Vector Laboratories, Burlingame, CA). Confocal imaging was performed using a LSM510 META confocal laser scanning fluorescence microscope (Carl Zeiss, Oberkochen, Germany). The intensity of each channel of images was analyzed by LSM Image Browser (Carl Zeiss).
Lipid–protein-binding Assay
Hexahistidine-tagged peptides corresponding to residues 186–200 of human Nox5
were synthesized by the Emory University's Microchemical Facility, and sequences of mutations PBR-N-mut-A and R197E are shown in Figure 1B and 2A, respectively. PtdIns or PtdIns(4,5)P2-conjugated agarose beads were obtained from Echelon Bioscience Beads (50 µl; Salt Lake City, UT) and contained 1 nmol PtdIns or PtdIns(4,5)P2. Beads were suspended in an equal volume of binding/wash buffer (10 mM HEPES buffer, pH 7.4, containing 0.5% NP-40, 150 mM NaCl). Two nanomoles of peptide diluted in 20 µl binding/wash buffer were added to the beads. After incubation for 4 h at 4°C, the sample was centrifuged at 100 x g, and the beads were washed five times with 1 ml binding/wash buffer, pelleting the beads between washes by centrifugation at 100 x g. Peptides bound to beads were eluted with an equal volume of 2x Laemmli sample buffer and heated to 95°C for 5 min. Peptides were separated by 17% SDS-PAGE and transferred to the PVDF filters to detect peptides by immunoblot with an anti-hexahistidine-tag antibody.
Liposomes (PolyPIPosomes) containing PtdIns or PtdIns(4,5)P2 were obtained from Echelon Bioscience. Liposomes were composed of 65% phosphatidylcholine, 30% phosphatidylethanolamine, and 5% PtdIns or PtdIns(4,5)P2. Liposome-binding assay was carried out as described (Huang et al., 2004
) with minor modifications. Five nanomoles of hexahistidine-tagged peptide, 20 µl of 1 mM liposomes and 200 µl of binding buffer (50 mM Tris/HCl buffer, pH 7.5, 150 mM NaCl) were rotated for 15 min at room temperature and centrifuged at 20,000 x g for 1 h. Collected liposomes were resuspended in 1 ml of binding buffer and then centrifuged, repeating three times. The peptides that bound to liposomes were resolved by 10–20% gradient SDS-PAGE and were transferred to PVDF filters, and peptides were detected by immunoblot with an anti-hexahistidine antibody (Cell Signaling Technology, Danvers, MA).
Statistical Analysis
Data are presented as the maximum oxidase activity, read as relative luminescence units (for luminol and Diogenes chemiluminescence assays) or as absorbance at 550 nm (for cytochrome c reduced) and are expressed as means ± SD. Means were calculated from at least three independent transfection experiments, and each assay was performed in triplicate for each transfection. Statistical significance was determined by t test by the GraphPad Prism software (GraphPad Software, San Diego, CA).
| RESULTS |
|---|
|
|
|---|
(Figure 1A), a region that contains five basic amino acids and five proline residues (Figure 1B). PBR-C consists of another short polybasic sequence located in the region between the first and second NADPH-binding subregions and corresponds to residues 578-588 of human Nox5
(Figure 1A). PBR-C of human Nox5 contains four basic residues (Figure 1C). Human Nox5
was mutated to examine whether amino acid residues in these regions were involved in Nox5 function. The five arginine residues were replaced with alanine (PBR-N-mut-A), glutamine (PBR-N-mut-Q), or glutamic acid (PBR-N-mut-E; Figure 1B). All mutations significantly suppressed both basal and ionomycin-stimulated Nox5 activity using the luminol assay, which detects ROS production (Figure 1D). The PBR-N also contains two prolines (Pro193 and 196) conforming to a canonical PXXP proline-rich motif region (Li, 2005
|
Contribution of Individual Arginine Residues in the N-terminal Polybasic Region
Individual point mutations in each arginine residue of PBR-N (Figure 2A) were constructed to determine the relative contributions of each of these basic residues. All mutations except for R190A and R194A produced a statistically significant decrease Nox5 activity (Figure 2B), and the point mutation at residue 197 substituted to alanine residue (R197A) inhibited activity most strongly (Figure 2B). None of the mutations affected Nox5 protein expression levels (Figure 2C). The effect of glutamic acid substitution at residue 197 (R197E) was greater than alanine substitution. Thus, the arginine residue at position 197 of human Nox5 contributes the most to activity among the basic residues in the PBR-N, though all residues except for R190 and R194 are necessary for optimal activity.
|
|
20% in the permeabilized cells (Figure 3C), compared with
85% in intact cells (Figure 3A). PBR-N-mut-A and R197E also showed only a modest inhibition in the permeabilized cell system, compared with the intact cell system. On the other hand, a mutation in the PBR-C decreased cytochrome c reduction by
40% in both permeabilized (Figure 3C) and intact (Figure 3A) cells. Thus, these data suggested that the PBR-N regulates primarily the extracellular generation of ROS. One explanation could be that mutations in PBR-N might affect the localization of Nox5 at the plasma membrane (see below). In contrast, mutations in PBR-C seem to affect primarily the activity of the enzyme itself. The present study focuses on the role of the PBR-C, whereas a future study will explore the detailed role of the PBR-C.
Effect of In Vivo Manipulation of PtdIns(4,5)P2 Levels on Nox5 Activity and Localization
To test the hypothesis that PtdIns(4,5)P2 regulates Nox5 function, Nox5, or mock vector was cotransfected into HEK293 cells with PtdIns(4)P-5-kinase
(PtdIns(4)P-5K
) or the catalytic domain of type IV PtdIns(4,5)P2-5-phosphatase [PtdIns(4,5)P2-5Ptase]. PtdIns(4)P-5K
phosphorylates endogenous PtdIns(4)P to increase cellular levels of PtdIns(4,5)P2 (Balla, 2007
; Kanaho et al., 2007
). As shown in Figure 4A, coexpression of PtdIns(4)P-5K
along with Nox5 significantly increased ionomycin-stimulated ROS production. PtdIns(4,5)P2-5Ptase, which is localized to the plasma membrane via a membrane-binding C-terminal CAAX motif, hydrolyzes the phosphate groups from PtdIns(4,5)P2 lowering levels of PtdIns(4,5)P2 (Varnai et al., 2006
; Balla, 2007
). Expression of this enzyme significantly decreased the ROS production by Nox5 (Figure 4A). Nox5 produced a small amount of ROS (10–15% of ionomycin-stimulated activity) before addition of the calcium ionophore (Figure 4A). This activity also required intracellular calcium (Jagnandan et al., 2007
; Serrander et al., 2007
), which was confirmed by pretreatment with the intracellular calcium chelator BAPTA-AM (Supplemental Data S5). This basal activity of Nox5 was also significantly increased by coexpression of PtdIns(4)P-5K
and was decreased with PtdIns(4,5)P2-5Ptase. Moreover, using the SOD-inhibitable Diogenes assay, which detects superoxide (Shiose et al., 2001
), PtdIns(4)P-5K
increased and PtdIns(4,5)P2-5Ptase decreased both basal and ionomycin-stimulated extracellular superoxide production by Nox5 (Figure 4B). A similar trend was seen using the SOD-inhibitable cytochrome c reduction assay, except that statistical significance for ionomycin-stimulated activity by PtdIns(4)P-5K
was not demonstrated (Figure 4C), possibly because the cytochrome c assay is significantly less sensitive than the chemiluminescence assay.
|
To rule out the possibility that PtdIns(4,5)P2-enhanced Nox5 activity is an effect of altered calcium availability, intracellular calcium concentrations were measured in HEK293 cells expressing either PtdIns(4)P-5K or PtdIns(4,5)P2-5Ptase. Intracellular calcium concentrations remained and unchanged by the expression of PtdIns metabolizing enzymes in both resting cells and ionomycin-treated cells (Figure 4E). Thus, effects of PtdIns(4,5)P2 levels on activity are not due to altered calcium levels.
Nox5 is predominantly expressed at the plasma membrane in Nox5-transfected HEK293 cells (Serrander et al., 2007
) and prostate cancer cells (Brar et al., 2003
) and also at the cytoskeleton-rich region in Nox5-transfected Cos7 cells (Jagnandan et al., 2007
). A major pool of PtdIns(4,5)P2 is present in the plasma membrane that are rich in F-actin (Tall et al., 2000
; Suh and Hille, 2005
). Therefore, we tested the hypothesis that PtdIns(4,5)P2 regulates the localization of Nox5 at the plasma membrane. Cell surface proteins were labeled with a thiol-cleavable amine-reactive biotinylating reagent and isolated using avidin-conjugated resin. The relative amount of Nox5 in the surface protein fraction was then analyzed by immunoblot with an anti-Nox5 antibody. Consistent with our hypothesis, coexpression of the PtdIns(4) P-5K
along with Nox5 increased amount of Nox5 protein at the cell surface (top panel of Figure 4F), but did not increase the total Nox5 protein level (middle panel of Figure 4F). In contrast, coexpression of PtdIns(4,5)P2-5Ptase decreased Nox5 expressed at the cell surface (top panel of Figure 4F). Thus, these data indicate that differences in extracellular ROS production by Nox5 due to manipulation of PtdIns(4,5)P2 levels are due, in large part, to differences in localization of Nox5 at the plasma membrane.
Effect of Mutations in PBR-N and -C on PtdIns(4)P-5K Enhancement of Nox5 Activity
As shown in Figure 4, PtdIns(4)P-5K enhances extracellular ROS generation by recruiting Nox5 to the plasma membrane. To determine the role of the polybasic regions in PtdIns(4)P-5K-augmented Nox5 activity, the ability of mutations to abrogate stimulation by PtdIns(4)P-5K was investigated. The PtdIns(4)P-5K augmentation of Nox5 activity was completely abolished by PBR-N-mut-A and PBR-N-mut-E mutations (Figure 5A). The activity of Nox5 R197E was only slightly (
10%) increased by PtdIns(4)P-5K, compared with a
35% stimulation of wild-type Nox5. In contrast, PtdIns(4)P-5K was still able to increase ROS generation by Nox5 mutated in the PBR-C (PBR-C-mut-Q) by
40% (Figure 5A), similar to the stimulation seen with wild-type Nox5. The cell surface expression of Nox5 was also markedly decreased (Figure 5B) by mutations in the PBR-N (PBR-N-mut-A, mut-E, and R197E), but surface expression the PBR-C-mut-Q mutation was abundant, similar to that of wild type (Figure 5B). Furthermore, PtdIns(4)P-5K was able to increase cell surface expression of both wild-type Nox5 and Nox5-PBR-C-mut-Q, but an increase was not detected in forms of Nox5 mutated in the PBR-N (Figure 5B). Thus, these results indicate that the effect of PtdIns(4)P-5K on Nox5 activity and localization is mediated by the N-terminal (but not the C-terminal) polybasic region.
|
|
1 has a specific affinity for PtdIns(4,5)P2, but not the other PtdIns phosphates (Varnai and Balla, 1998
1 protein (PH-PLC
1-DsRed) was coexpressed with N-terminally GFP-tagged Nox5 (GFP-Nox5) to test whether Nox5 was colocalized with PtdIns(4,5)P2 in intact cells. Images taken with confocal laser microscopy demonstrated that GFP-Nox5 protein was colocalized with PH-PLC
1-DsRed ("merge" panel in Figure 7A) and peak intensities of GFP-Nox5 and PH-PLC
1-DsRed showed almost complete overlap (Figure 7A, right), indicating that PtdIns(4,5)P2 coincides with Nox5 at PtdIns(4,5)P2-rich plasma membrane patches (Huang et al., 2004
1-DsRed (Figures 7, B and C, respectively) because these GFP signals were mainly observed in cytoplasmic organelles. Consistent with the visual appearance, peak intensities of GFP-Nox5 and PH-PLC
1-DsRed did not significantly overlap (Figures 7, B and C, right panels). Alternatively, mutation in the PBR-C (PBR-C-mut-Q) did not affect colocalization of Nox5 with PH-PLC
1-DsRed (Figure 7D), and the GFP and DsRed signals showed nearly complete overlap (right graph in Figure 7D). Thus, several lines of evidence indicate that the PBR-N participates in interaction with PtdIns(4,5)P2, and this region is responsible for PtdIns(4,5)P2-mediated localization of Nox5 to plasma membrane.
|
| DISCUSSION |
|---|
|
|
|---|
In the present study, we demonstrated a relationship between PtdIns(4,5)P2 levels and extracellular ROS production by Nox5. The PBR-N, conserved among Nox5 orthologues, was shown to mediate this regulatory effect by binding to PtdIns(4,5)P2, resulting in the localization of Nox5 to plasma membrane regions rich in this lipid. PtdIns(4,5)P2 is the most common isomer of PtdInsP2 (Suh and Hille, 2005
), and a major pool of PtdIns(4,5)P2 is present in the plasma membrane. Within the plasma membrane, PtdIns(4,5)P2 is also colocalized with F-actin (Tall et al., 2000
) and is enriched in cholesterol- and caveolin-rich subregions such as lipid rafts, and focal adhesions (Downes et al., 2005
; Ling et al., 2006
). Smaller pools are also present in intracellular membranes including those of the Golgi apparatus and endoplasmic reticulum, and in the nuclear matrix, where it is associated, not with membranes, but with dense regions of heterochromatin (Downes et al., 2005
).
After the discovery of enzymes that metabolize PtdIns(4,5)P2 (e.g., phospholipase C and PtdIns-3 kinases), PtdIns(4,5)P2 has been studied in three regards: 1) as a precursor of second messengers [e.g., Ins(1,4,5)P3 and PtdIns(3,4,5)P3], 2) as a membrane targeting signal for proteins (e.g., the small GTPases), and 3) as a direct regulator of various protein functions (e.g., voltage-gated K+ channels; Huang et al., 2004
; Li et al., 2005
; Rohacs et al., 2005
; Suh and Hille, 2005
; Heo et al., 2006
; Kanaho et al., 2007
). The present study demonstrates that the second of these functions is relevant to Nox5. PtdIns(4,5)P2, by binding to PBR-N, functions to localize Nox5 to the plasma membrane, thereby directing superoxide generation to the extracellular space. Once there, dismutation of superoxide can occur, catalyzed by extracellular superoxide dismutase and the product, hydrogen peroxide, can act locally or diffuse back across the membrane.
Nox enzymes including Nox5 have been implicated in specific regulatory oxidations that modulate the activity of downstream target enzymes such as protein tyrosine phosphatases (Mahadev et al., 2004
; Kamiguti et al., 2005
; Ushio-Fukai, 2006
; Lee et al., 2007
; Shinohara et al., 2007
). However, because ROS can be rather indiscriminant in the protein targets that they oxidize (Bedard and Krause, 2007
; Fomenko et al., 2007
; Lambeth, 2007
), it has not been clear how (or whether) specificity for selective oxidation of certain target proteins might be achieved. One such mechanism would be to colocalize the target protein in close proximity to the Nox enzyme, resulting in exposure of the target to high local concentrations of ROS. Because PtdIns(4,5)P2 also recruits other proteins to the plasma membrane, this lipid may participate in colocalization of Nox5 with protein targets of Nox5-derived ROS. For example, PtdIns(4,5)P2 localizes to the same plasma membrane subdomains of several ion channels (e.g., transient receptor potential [TRP] C3, TRPM7, TRPV1, voltage-gated K+ channel Kv, Cl– channel cystic fibrosis transmembrane conductance regulator; Aarts et al., 2003
; Suh and Hille, 2005
; van Rossum et al., 2005
). Interestingly, these channels have been previously described as being redox-sensitive (Schultz and Ustinova, 1998
; Cowley and Linsdell, 2002
; Cogolludo et al., 2006
; Massullo et al., 2006
; Poteser et al., 2006
; Ruan et al., 2006
), suggesting that Nox5-derived ROS might participate in their regulation. Indeed, D. melanogaster Nox5-derived ROS markedly up-regulates the proctolin-stimulated cytosolic calcium flux in ovarian smooth muscle, resulting in muscle contraction (Ritsick et al., 2007
). In addition, PtdIns(4,5)P2 functions in the localization of membrane receptors (e.g., G-protein–coupled receptors) and signal transducers. Among these include, redox-sensitive enzymes such as protein tyrosine phosphatases (Tonks, 2006
) in lipid rafts in the plasma membrane (Gamper and Shapiro, 2007
), and colocalization with Nox5 might facilitate oxidative regulation of these target proteins.
Phosphorylated PtdIns including PtdIns(4,5)P2 is present only in eukaryotes (Michell, 2007
), whereas PtdIns occurs in eukaryotes and rarely in a few bacteria such as actinomycetes (Michell, 2007
). Nox genes are also seen in eukaryotes, but not in prokaryotes. The PBR-N is broadly conserved in most Nox5 orthologues in vertebrates and other metazoans (Supplemental Data S1). Human Duox1 and Duox2, as well as most other animal Duox sequences, also contain multiple basic residues at or near regions corresponding to the PBR-N of Nox5 (alignment shown in Supplemental Data S7). In preliminary data, we observed that PtdIns(4,5)P2-5Ptase significantly inhibited ionomycin-induced ROS generation by Duox1 in HEK293 cells coexpressing its chaperon protein DuoxA1 (T. Kawahara, unpublished observation). Furthermore, Nox proteins of a higher green plant (Arabidopsis thaliana), moss (Physcomitrella patens), oomycete (Phytophthora sojae), and fungal NoxC, which all possess EF-hand motifs, show conserved polybasic regions between the EF-hand motif and the first transmembrane region (Supplemental Data S8). Fungal NoxB proteins contain a short extension (
70–120 amino acids long) in their N-termini but lack the EF-hand domain (Kawahara et al., 2007
). Most of these NoxB proteins also possess multiple basic residues in this N-terminal extension (Supplemental Data S9), although the relationship between NoxB and PtdIns phosphates has not yet been investigated. The similarity among polybasic sequences at a region corresponding to PBR-N of Nox5 suggests a similar role for PtdIns(4,5)P2 or other PtdIns phosphates among other calcium-regulated Noxes/Duoxes and fungal NoxB.
Because subunit-regulated Nox orthologues do not possess an extension containing an PBR-N (Lambeth, 2004
), other mechanisms appear to be responsible for localization of these enzymes to PtdInsP2-rich membranes. Previous immunohistochemical analysis demonstrated that Nox1 is predominantly localized at the plasma membrane of the apical side of human colon epithelial cells (Kawahara et al., 2005
). In vascular smooth muscle, Nox1 colocalizes with caveolin, a marker of lipid rafts (Hilenski et al., 2004
). Nox4 protein is localized to the plasma membrane of kidney tubules (Kawahara et al., 2005
) and to focal adhesion of vascular smooth muscle cells (Hilenski et al., 2004
). Consistent with these observations, GFP-tagged Nox1 and Nox4 proteins were able to colocalize with the PH-domain of PLC-
1 in HEK293 cells without coexpression of the PX-domain–containing cytoplasmic regulators (T. Kawahara, unpublished observation). These data indicate that these Nox enzymes or, alternatively, their membrane-associated binding partner, p22phox, have a different mechanism that directs their subcellular localization, perhaps involving a different PtdIns(4,5)P2- binding region.
The PBR-N has a major effect on cellular localization of Nox5, but the possibility that it also might have a minor effect on Nox5 enzymatic activity should not be dismissed. Using the permeabilized cell assay, mutations in the PBR-N decreased the Nox5 activity by 15–20% (Figure 3B). The mechanism for this decrease in activity is not known, but is significantly smaller than effects on the PBR-C. In contrast to the PBR-N, the PBR-C was not implicated in localization of Nox5, but was implicated in the intrinsic activity of the enzyme itself. A future study will explore the detailed role of the PBR-C in Nox5 activation.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Address correspondence to: Tsukasa Kawahara (tkawaha{at}emory.edu)
Abbreviations used: Nox, NADPH oxidase; Duox, dual oxidase; ROS, reactive oxygen species; SOD, superoxide dismutase; PBR-N, N-terminal polybasic region; PBR-C, C-terminal polybasic region; WT, wild type; PLC, phospholipase C; PtdIns(4,5)P2, Phosphatidylinositol (4,5)-bisphosphate; PtdIns-3K, Phosphatidylinositol 3-kinase; PtdIns(4,5)P2-5Ptase, Phosphatidylinositol (4,5)-bisphosphate 5-phoshatase; PtdIns(4)P-5K, Phosphatidylinositol 4-phosphate 5-kinase.
| REFERENCES |
|---|
|
|
|---|
Balla, T. (2007). Imaging and manipulating phosphoinositides in living cells. J. Physiol 582, 927–937.
Banfi, B., Molnar, G., Maturana, A., Steger, K., Hegedus, B., Demaurex, N., and Krause, K. H. (2001). A Ca(2+)-activated NADPH oxidase in testis, spleen, and lymph nodes. J. Biol. Chem 276, 37594–37601.
Banfi, B., Tirone, F., Durussel, I., Knisz, J., Moskwa, P., Molnar, G. Z., Krause, K. H., and Cox, J. A. (2004). Mechanism of Ca2+ activation of the NADPH oxidase 5 (NOX5). J. Biol. Chem 279, 18583–18591.
Bedard, K., and Krause, K. H. (2007). The NOX family of ROS-generating NADPH oxidases: physiology and pathophysiology. Physiol. Rev 87, 245–313.
Bedard, K., Lardy, B., and Krause, K. H. (2007). NOX family NADPH oxidase: not just in mammals. Biochimie 89, 1107–1112.[CrossRef][Medline]
BelAiba, R. S., Djordjevic, T., Petry, A., Diemer, K., Bonello, S., Banfi, B., Hess, J., Pogrebniak, A., Bickel, C., and Gorlach, A. (2007). NOX5 variants are functionally active in endothelial cells. Free Radic. Biol. Med 42, 446–459.[CrossRef][Medline]
Bokoch, G. M., and Knaus, U. G. (2003). NADPH oxidases: not just for leukocytes anymore! Trends Biochem. Sci 28, 502–508.[CrossRef][Medline]
Brar, S. S. et al. (2003). NOX5 NAD(P)H oxidase regulates growth and apoptosis in DU 145 prostate cancer cells. Am. J. Physiol. Cell Physiol 285, C353–C369.
Brown, G. E., Stewart, M. Q., Liu, H., Ha, V. L., and Yaffe, M. B. (2003). A novel assay system implicates PtdIns(3,4)P(2), PtdIns(3)P, and PKC delta in intracellular production of reactive oxygen species by the NADPH oxidase. Mol. Cell 11, 35–47.[CrossRef][Medline]
Cheng, G., Cao, Z., Xu, X., van Meir, E. G., and Lambeth, J. D. (2001). Homologs of gp91phox: cloning and tissue expression of Nox3, Nox4, and Nox5. Gene 269, 131–140.[CrossRef][Medline]
Cheng, G., and Lambeth, J. D. (2005). Alternative mRNA splice forms of NOXO1, Differential tissue expression and regulation of Nox1 and Nox3. Gene 356, 118–126.[CrossRef][Medline]
Cogolludo, A., Frazziano, G., Cobeno, L., Moreno, L., Lodi, F., Villamor, E., Tamargo, J., and Perez-Vizcaino, F. (2006). Role of reactive oxygen species in Kv channel inhibition and vasoconstriction induced by TP receptor activation in rat pulmonary arteries. Ann. NY Acad. Sci 1091, 41–51.[CrossRef][Medline]
Cowley, E. A., and Linsdell, P. (2002). Oxidant stress stimulates anion secretion from the human airway epithelial cell line Calu-3, implications for cystic fibrosis lung disease. J. Physiol 543, 201–209.
Dahlgren, C., and Stendahl, O. (1983). Role of myeloperoxidase in luminol-dependent chemiluminescence of polymorphonuclear leukocytes. Infect. Immun 39, 736–741.
Das, S., and Cho, W. (2002). Roles of catalytic domain residues in interfacial binding and activation of group IV cytosolic phospholipase A2. J. Biol. Chem 277, 23838–23846.
Downes, C. P., Gray, A., and Lucocq, J. M. (2005). Probing phosphoinositide functions in signaling and membrane trafficking. Trends Cell Biol 15, 259–268.[CrossRef][Medline]
El Jamali, A., Valente, A. J., Lechleiter, J. D., Gamez, M. J., Pearson, D. W., Nauseef, W. M., and Clark, R. A. (2008). Novel redox-dependent regulation of NOX5 by the tyrosine kinase c-Abl. Free Radic. Biol. Med 44, 868–881.[CrossRef][Medline]
Ellson, C., Davidson, K., Anderson, K., Stephens, L. R., and Hawkins, P. T. (2006). PtdIns3P binding to the PX domain of p40phox is a physiological signal in NADPH oxidase activation. EMBO J 25, 4468–4478.[CrossRef][Medline]
Falasca, M., Logan, S. K., Lehto, V. P., Baccante, G., Lemmon, M. A., and Schlessinger, J. (1998). Activation of phospholipase C gamma by PI 3-kinase-induced PH domain-mediated membrane targeting. EMBO J 17, 414–422.[CrossRef][Medline]
Fomenko, D. E., Xing, W., Adair, B. M., Thomas, D. J., and Gladyshev, V. N. (2007). High-throughput identification of catalytic redox-active cysteine residues. Science 315, 387–389.
Gamper, N., and Shapiro, M. S. (2007). Target-specific PIP2 signaling: how might it work? J. Physiol 582, 967–975.
Geiszt, M. (2006). NADPH oxidases: new kids on the block. Cardiovasc. Res 71, 289–299.
Han, J. C., and Han, G. Y. (1994). A procedure for quantitative determination of tris(2-carboxyethyl)phosphine, an odorless reducing agent more stable and effective than dithiothreitol. Anal. Biochem 220, 5–10.[CrossRef][Medline]
Heo, W. D., Inoue, T., Park, W. S., Kim, M. L., Park, B. O., Wandless, T. J., and Meyer, T. (2006). PI(3,4,5)P3 and PI(4,5)P2 lipids target proteins with polybasic clusters to the plasma membrane. Science 314, 1458–1461.
Hilenski, L. L., Clempus, R. E., Quinn, M. T., Lambeth, J. D., and Griendling, K. K. (2004). Distinct subcellular localizations of Nox1 and Nox4 in vascular smooth muscle cells. Arterioscler. Thromb. Vasc. Biol 24, 677–683.
Huang, S., Lifshitz, L., Patki-Kamath, V., Tuft, R., Fogarty, K., and Czech, M. (2004). Phosphatidylinositol-4,5-bisphosphate-rich plasma membrane patches organize active zones of endocytosis and ruffling in cultured adipocytes. Mol. Cell. Biol 24, 9102–9123.
Jagnandan, D., Church, J. E., Banfi, B., Stuehr, D. J., Marrero, M. B., and Fulton, D. J. (2007). Novel mechanism of activation of NADPH oxidase 5. Calcium sensitization via phosphorylation. J. Biol. Chem 282, 6494–6507.
Jay, D. B., Papaharalambus, C. A., Seidel-Rogol, B., Dikalova, A. E., Lassègue, B., and Griendling, K. K. (2008). Nox5 mediates PDGF-induced proliferation in human aortic smooth muscle cells. Free Radic. Biol. Med 45, 329–335.[CrossRef][Medline]
Kagan, J. C., and Medzhitov, R. (2006). Phosphoinositide-mediated adaptor recruitment controls Toll-like receptor signaling. Cell 125, 943–955.[CrossRef][Medline]
Kamiguti, A. S., Serrander, L., Lin, K., Harris, R. J., Cawley, J. C., Allsup, D. J., Slupsky, J. R., Krause, K. H., and Zuzel, M. (2005). Expression and activity of NOX5 in the circulating malignant B cells of hairy cell leukemia. J. Immunol 175, 8424–8430.
Kanaho, Y., Kobayashi-Nakano, A., and Yokozeki, T. (2007). The phosphoinositide kinase PIP5K that produces the versatile signaling phospholipid PI4,5P(2). Biol. Pharmac. Bull 30, 1605–1609.[CrossRef]
Kanai, F., Liu, H., Field, S. J., Akbary, H., Matsuo, T., Brown, G. E., Cantley, L. C., and Yaffe, M. B. (2001). The PX domains of p47phox and p40phox bind to lipid products of PI(3)K. Nat. Cell Biol 3, 675–678.[CrossRef][Medline]
Karathanassis, D., Stahelin, R. V., Bravo, J., Perisic, O., Pacold, C. M., Cho, W., and Williams, R. L. (2002). Binding of the PX domain of p47(phox) to phosphatidylinositol 3,4-bisphosphate and phosphatidic acid is masked by an intramolecular interaction. EMBO J 21, 5057–5068.[CrossRef][Medline]
Kawahara, T., Kuwano, Y., Teshima-Kondo, S., Takeya, R., Sumimoto, H., Kishi, K., Tsunawaki, S., Hirayama, T., and Rokutan, K. (2004). Role of nicotinamide adenine dinucleotide phosphate oxidase 1 in oxidative burst response to Toll-like receptor 5 signaling in large intestinal epithelial cells. J. Immunol 172, 3051–3058.
Kawahara, T., and Lambeth, J. D. (2007). Molecular evolution of Phox-related regulatory subunits for NADPH oxidase enzymes. BMC Evol. Biol 7, 178.[CrossRef][Medline]
Kawahara, T., Quinn, M. T., and Lambeth, J. D. (2007). Molecular evolution of the reactive oxygen-generating NADPH oxidase (Nox/Duox) family of enzymes. BMC Evol. Biol 7, 109.[CrossRef][Medline]
Kawahara, T., Ritsick, D., Cheng, G., and Lambeth, J. D. (2005). Point mutations in the proline-rich region of p22phox are dominant inhibitors of Nox1- and Nox2-dependent reactive oxygen generation. J. Biol. Chem 280, 31859–31869.
Lambeth, J. D. (2004). NOX enzymes and the biology of reactive oxygen. Nat. Rev. Immunol 4, 181–189.[CrossRef][Medline]
Lambeth, J. D. (2007). Nox enzymes, ROS, and chronic disease: an example of antagonistic pleiotropy. Free Radic. Biol. Med 43, 332–347.[CrossRef][Medline]
Lambeth, J. D., Kawahara, T., and Diebold, B. (2007). Regulation of Nox and Duox enzymatic activity and expression. Free Radic. Biol. Med 43, 319–331.[CrossRef][Medline]
Lee, J. K., Edderkaoui, M., Truong, P., Ohno, I., Jang, K. T., Berti, A., Pandol, S. J., and Gukovskaya, A. S. (2007). NADPH oxidase promotes pancreatic cancer cell survival via inhibiting JAK2 dephosphorylation by tyrosine phosphatases. Gastroenterology 133, 1637–1648.[CrossRef][Medline]
Li, S. (2005). Specificity and versatility of SH3 and other proline-recognition domains: structural basis and implication for cellular signal transduction. Biochem. J 390, 641–653.[Medline]
Li, Y., Gamper, N., Hilgemann, D. W., and Shapiro, M. S. (2005). Regulation of Kv7 (KCNQ) K+ channel open probability by phosphatidylinositol 4,5-bisphosphate. J. Neurosci 25, 9825–9835.
Ling, K., Schill, N. J., Wagoner, M. P., Sun, Y., and Anderson, R. A. (2006). Movin' on up; the role of PtdIns(4,5)P2 in cell migration. Trends Cell Biol 16, 276–284.[CrossRef][Medline]
Mahadev, K., Motoshima, H., Wu, X., Ruddy, J. M., Arnold, R. S., Cheng, G., Lambeth, J. D., and Goldstein, B. J. (2004). The NAD(P)H oxidase homolog Nox4 modulates insulin-stimulated generation of H2O2 and plays an integral role in insulin signal transduction. Mol. Cell. Biol 24, 1844–1854.
Massullo, P., Sumoza-Toledo, A., Bhagat, H., and Partida-Sanchez, S. (2006). TRPM channels, calcium and redox sensors during innate immune responses. Semin. Cell Dev. Biol 17, 654–666.[CrossRef][Medline]
McLaughlin, S., Wang, J., Gambhir, A., and Murray, D. (2002). PIP(2) and proteins: interactions, organization, and information flow. Annu. Rev. Biophys. Biomol. Struct 31, 151–175.[CrossRef][Medline]
Michell, R. H. (2007). Evolution of the diverse biological roles of inositols. Biochem. Soc. Symp 74, 223–246.[CrossRef][Medline]
Mosior, M., Six, D. A., and Dennis, E. A. (1998). Group IV cytosolic phospholipase A2 binds with high affinity and specificity to phosphatidylinositol 4,5-bisphosphate resulting in dramatic increases in activity. J. Biol. Chem 273, 2184–2191.
Nakanishi, S., Catt, K. J., and Balla, T. (1995). A wortmannin-sensitive phosphatidylinositol 4-kinase that regulates hormone-sensitive pools of inositolphospholipids. Proc. Natl. Acad. Sci. USA 92, 5317–5321.
Nauseef, W. M. (2004). Assembly of the phagocyte NADPH oxidase. Histochem. Cell Biol 122, 277–291.[CrossRef][Medline]
Poteser, M., Graziani, A., Rosker, C., Eder, P., Derler, I., Kahr, H., Zhu, M. X., Romanin, C., and Groschner, K. (2006). TRPC3 and TRPC4 associate to form a redox-sensitive cation channel. Evidence for expression of native TRPC3-TRPC4 heteromeric channels in endothelial cells. J. Biol. Chem 281, 13588–13595.
Prehoda, K. E., Scott, J. A., Dyche Mullins, R., and Lim, W. A. (2000). Integration of multiple signals through cooperative regulation of the N-WASP-Arp2/3 complex. Science 290, 801–806.
Rameh, L. E., Rhee, S. G., Spokes, K., Kazlauskas, A., Cantley, L. C., and Cantley, L. G. (1998). Phosphoinositide 3-kinase regulates phospholipase Cgamma-mediated calcium signaling. J. Biol. Chem 273, 23750–23757.
Ritsick, D. R., Edens, W. A., Finnerty, V., and Lambeth, J. D. (2007). Nox regulation of smooth muscle contraction. Free Radic. Biol. Med 43, 31–38.[CrossRef][Medline]
Rohacs, T., Lopes, C.M.B., Michaelidis, I., and Logothetis, D. E. (2005). PI(4,5)P2 regulates the activation and desensitization of TPRM8 channels through the TRP domain. Nat. Neurosci 8, 626–634.[CrossRef][Medline]
Ruan, T., Lin, Y. S., Lin, K. S., and Kou, Y. R. (2006). Mediator mechanisms involved in TRPV1 and P2X receptor-mediated, ROS-evoked bradypneic reflex in anesthetized rats. J. Appl. Physiol 101, 644–654.
Schultz, H. D., and Ustinova, E. E. (1998). Capsaicin receptors mediate free radical-induced activation of cardiac afferent endings. Cardiovasc. Res 38, 348–355.
Sciorra, V. A., Rudge, S. A., Prestwich, G. D., Frohman, M. A., Engebrecht, J., and Morris, A. J. (1999). Identification of a phosphoinositide binding motif that mediates activation of mammalian and yeast phospholipase D isoenzymes. EMBO J 18, 5911–5921.[CrossRef][Medline]
Serrander, L., Jaquet, V., Bedard, K., Plastre, O., Hartley, O., Arnaudeau, S., Demaurex, N., Schlegel, W., and Krause, K. H. (2007). NOX5 is expressed at the plasma membrane and generates superoxide in response to protein kinase C activation. Biochimie 89, 1159–1167.[CrossRef][Medline]
Shinohara, M., Shang, W. H., Kubodera, M., Harada, S., Mitsushita, J., Kato, M., Miyazaki, H., Sumimoto, H., and Kamata, T. (2007). Nox1 redox signaling mediates oncogenic Ras-induced disruption of stress fibers and focal adhesions by down-regulating Rho. J. Biol. Chem 282, 17640–17648.
Shiose, A., Kuroda, J., Tsuruya, K., Hirai, M., Hirakata, H., Naito, S., Hattori, M., Sakaki, Y., and Sumimoto, H. (2001). A novel superoxide-producing NAD(P)H oxidase in kidney. J. Biol. Chem 276, 1417–1423.
Si, J., Behar, J., Wands, J., D. G., B., Lambeth, D., Y. E., C., and Cao, W. (2007). STAT5 mediates platelet-activating factor (PAF)-induced NADPH oxidase NOX5-S expression in Barrett's esophageal adenocarcinoma cells. Am. J. Physiol. Gastrointest. Liver Physiol Epub ahead of print.
Suh, B. C., and Hille, B. (2005). Regulation of ion channels by phosphatidylinositol 4,5-bisphosphate. Curr. Opin. Neurobiol 15, 370–378.[CrossRef][Medline]
Takeya, R., Taura, M., Yamasaki, T., Naito, S., and Sumimoto, H. (2006). Expression and function of Noxo1gamma, an alternative splicing form of the NADPH oxidase organizer 1. FEBS J 273, 3663–3677.[CrossRef][Medline]
Tall, E. G., Spector, I., Pentyala, S. N., Bitter, I., and Rebecchi, M. J. (2000). Dynamics of phosphatidylinositol 4,5-bisphosphate in actin-rich structures. Curr. Biol 10, 743–746.[CrossRef][Medline]
Tirone, F., and Cox, J. A. (2007). NADPH oxidase 5 (NOX5) interacts with and is regulated by calmodulin. FEBS Lett 581, 1202–1208.[CrossRef][Medline]
Tonks, N. K. (2006). Protein tyrosine phosphatases: from gene, to function, to disease. Nat. Rev. Mol. Cell. Biol 7, 833–846.[CrossRef][Medline]
Ueyama, T., Eto, M., Kami, K., Tatsuno, T., Kobayashi, T., Shirai, Y., Lennartz, M. R., Takeya, R., Sumimoto, H., and Saito, N. (2005). Isoform-specific membrane targeting mechanism of Rac during Fc gamma R-mediated phagocytosis: positive charge-dependent and independent targeting mechanism of Rac to the phagosome. J. Immunol 175, 2381–2390.
Ueyama, T., Lekstrom, K., Tsujibe, S., Saito, N., and Leto, T. L. (2007). Subcellular localization and function of alternatively spliced Noxo1 isoforms. Free Radic. Biol. Med 42, 180–190.[CrossRef][Medline]
Ushio-Fukai, M. (2006). Localizing NADPH oxidase-derived ROS. Science's STKE: Signal Transduction Knowledge Environment 2006, re8.
van Rossum, D. B., Patterson, R. L., Sharma, S., Barrow, R. K., Kornberg, M., Gill, D. L., and Snyder, S. H. (2005). Phospholipase Cgamma1 controls surface expression of TRPC3 through an intermolecular PH domain. Nature 434, 99–104.[CrossRef][Medline]
Varnai, P., and Balla, T. (1998). Visualization of phosphoinositides that bind pleckstrin homology domains: calcium- and agonist-induced dynamic changes and relationship to myo-[3H]inositol-labeled phosphoinositides pools. J. Cell Biol 143, 501–510.
Varnai, P., Thyagarajan, B., Rohacs, T., and Balla, T. (2006). Rapidly inducible changes in phosphatidylinositol 4,5-bisphosphate levels influence multiple regulatory functions of the lipid in intact living cells. J. Cell Biol 175, 377–382.
Vignais, P. V. (2002). The superoxide-generating NADPH oxidase; structural aspects and activation mechanism. Cell. Mol. Life Sci 59, 1428–1459.[CrossRef][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||