![]() |
|
|
Vol. 19, Issue 10, 4224-4237, October 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

*Laboratory of Cellular and Molecular Biology, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892; and
Department of Cellular and Developmental Biology, School of Medicine, University of Colorado Health Sciences Center, Denver, CO 80262
Submitted March 18, 2008;
Revised July 18, 2008;
Accepted July 25, 2008
Monitoring Editor: Jean E. Gruenberg
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
ASAP1 is one of the best-characterized Arf GAPs. In addition to PH and Arf GAP domains, ASAP1 contains an N-terminal Bin, Amphiphysin, and Rvs167/Rvs161 (BAR) domain and, in the C-terminal half of the protein, a proline (Pro)-rich domain and Src homology 3 (SH3) domain. Other ASAP isoforms, ASAP2 and ASAP3, have similar domain structures and high homology, especially in the Arf GAP domains, although ASAP3 lacks C-terminal SH3 domain (Ha et al., 2008
). Through its Pro-rich and SH3 domains, ASAP1 interacts with a number of proteins, which are mainly adhesion- and actin cytoskeleton–related proteins including Src, focal adhesion kinase (FAK), Crk/CrkL, and cortactin (Brown et al., 1998
; Liu et al., 2002
; Oda et al., 2003
; Onodera et al., 2005
; Bharti et al., 2007
). ASAP1 is a component of three integrated membrane/actin cytoskeleton structures: focal adhesions, circular dorsal ruffles (CDRs) and invadopodia/podosomes. ASAP1 associates with focal adhesions in fibroblasts (Randazzo et al., 2000
). The focal adhesion localization depends on the interaction of ASAP1 with FAK and CrkL (Liu et al., 2002
; Oda et al., 2003
). Altered ASAP1 expression reduces the paxillin content of focal adhesions. ASAP1 also associates with CDRs (Randazzo et al., 2000
). These structures, which are induced by growth factors such as platelet-derived growth factor (PDGF), are rings of dynamically remodeling polymerized actin at the dorsal surface of cells associated with plasma membranes undergoing extensive endocytosis. Recently, ASAP1 has been reported to localize with another class of membrane/actin structures called invadopodia and podosomes (Onodera et al., 2005
; Bharti et al., 2007
; Randazzo et al., 2007
). They are adhesive structures on the ventral surface of cells found in metastatic breast cancer cells and active Src-transformed fibroblasts and are thought to mediate cancer cell invasion into normal tissue (Buccione et al., 2004
). Depletion of ASAP1 in cells prevented formation of invadopodia and podosome structure, and, in some studies, reduced invasion. These findings support the idea that ASAP1 functions as a regulator of the actin cytoskeleton, which is involved in cell adhesion, migration and invasion.
BAR domains form crescent-shaped homodimers and are a membrane-binding module that induces or senses membrane curvature (Takei et al., 1999
; Lee et al., 2002
; Peter et al., 2004
). They are found in many proteins that are involved in membrane traffic. The Arf GAPs belonging to ASAP and ACAP subfamily have BAR domains. Homology modeling of the BAR domain of ASAP1 predicts positive electrostatic clusters on the concave surface. We found that, like other BAR domains, the BAR domain of ASAP1 mediates homodimerization and contributes to the formation of tubules from synthetic large unilamellar vesicles in vitro (Nie et al., 2006
). Arf contributed to the tubulation induced by ASAP1, supporting the idea that the membrane curvature-inducing function is coupled with Arf signaling.
There are two instances of BAR domains as protein-binding sites. First, arfaptin 2 interacts with Rac small G protein through its BAR domain (Tarricone et al., 2001
). The interaction is thought to regulate membrane association of arfaptin. Second, APPL1 is a membrane-trafficking protein that like ASAP1, has a tandem of a BAR and PH domains (Zhu et al., 2007
). The two domains fold together to form a binding site for Rab5, which is critical for APPL1 function in endocytosis. These results support the idea that BAR domains function not only as a membrane curvature sensing/inducing domain, but also as a protein-interacting site (Habermann, 2004
).
Rab11-family interacting protein 3 (FIP3) is a member of the FIP family of Rab11 binding proteins that may function as Rab11 effectors. FIP3 binds to two different classes of small GTP-binding proteins simultaneously, Rab11 and Arfs (Arf5 and Arf6; Shin et al., 1999
; Prekeris, 2003
; Fielding et al., 2005
). Rab11 is known as a critical regulator for endocytic recycling pathway from recycling endosome to the plasma membrane and for trafficking at the trans-Golgi network (TGN) and functions in many cellular events including epithelial polarity, cell adhesion, and cytokinesis that depend on regulated membrane traffic (Zerial and McBride, 2001
; van IJzendoorn, 2006
). FIP3, like other members of the FIP family, has a Rab11-binding site at its C-terminus (Prekeris, 2003
). FIP3 and its closest homolog FIP4 function to maintain the integrity of recycling endosomes and to regulate cytokinesis during interphase and mitotic phase, respectively (Hickson et al., 2003
; Wilson et al., 2005
; Horgan et al., 2007
). Overexpression of FIP3 or FIP4 causes accumulation of recycling endosome at the perinuclear region. This effect is dependent on the ability to bind to Rab11 (Hickson et al., 2003
; Horgan et al., 2004
). In contrast, depletion of FIP3 induces loss of the perinuclear recycling endosomal compartment (Horgan et al., 2007
). Based on these results, FIP3 has been proposed to be a critical regulator of the recycling endosome together with Rab11.
In the experiments reported here, we set out to address two questions about the molecular function of ASAP1. The first question was whether the BAR domain of ASAP1 also serves as a protein-interacting site like the BAR domain of arfaptin. The other question was whether ASAP1 functions in the endocytic pathway. Although ASAP1 is well established as a GAP for Arf proteins, the function of ASAP1 in membrane traffic has remained elusive. Here, we report that ASAP1, through its BAR domain, directly interacts with FIP3. A fraction of ASAP1 colocalizes with FIP3 in the pericentrosomal recycling endosome in HeLa cells and ASAP1 depletion by small interfering RNA (siRNA) disperses TfR-positive endosome from the perinuclear region and perturbs the intracellular trafficking of endocytosed Tfn. Based on these results, we propose that the BAR domain of ASAP1 functions as a protein-interacting site for FIP3 and that ASAP1 participates in Tfn trafficking through the Rab11-dependent pathway.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-tubulin (clone B-5–1-2),
-tubulin (clone GTU-88), and GST (clone GST-2) were from Sigma (St. Louis, MO). Anti-green fluorescent protein (GFP) polyclonal and monoclonal (clone MMS-118P) antibodies were from Invitrogen (Carlsbad, CA) and Covance (Berkley, CA), respectively. Monoclonal antibodies against Xpress and hemagglutinin (HA; clone MMS-101P) tags were from Invitrogen and Covance, respectively. Anti-His polyclonal antibody was from Santa Cruz Biotechnology (Santa Cruz, CA). Monoclonal antibodies against Arf (Clone 1D9) and GAPDH (clone 6C5) were from Affinity BioReagents (Golden, CO) and BioDesign (Saco, ME), respectively. Anti-Rab11 polyclonal and anti-TfR monoclonal (clone H68.4) antibodies were obtained from Zymed/Invitrogen. Monoclonal antibodies against calnexin (clone 37), GM130 (clone 35), EEA1 (clone 14), and lamp1 (clone H4A3) were from BD Bioscience. Polyclonal antibodies against TGN46 and HA tag were purchased from Abcam (Cambridge, MA).
Cell Culture and Transfections
HeLa, HEK293T, and human glioblastoma U118 cells were maintained in DMEM supplemented with 10% fetal calf serum (FCS), 100 U/ml penicillin, and 100 µg/ml streptomycin at 37°C with 5% CO2. Cells were plated 1 d before transfection with plasmids using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Cells were used for assays 24 h after transfection.
Yeast Two-Hybrid Screening
Yeast two-hybrid screening was carried out at Myriad Genetics (Salt Lake City, UT) using the BAR domain of mouse ASAP1 (aa 20–270 and 45–285) as bait with a mating-based method. The corresponding cDNA for ASAP1 BAR domain was cloned into pGBT.superB creating an open reading frame for ASAP1 fragments fused to the GAL4 DNA-binding domain. The bait plasmid was introduced into Myriad's ProNet yeast strain PNY200 (MAT
ura3-52 ade2-101 trp1-901 his3-
200 leu2-3112 gal4
gal80
). The bait yeast cells were allowed to mate with Myriad's ProNet MATa yeast cells, BK100 (MATa ura3-52 trp1-901 his3-
200 leu2-3112 gal4
gal80
GAL2-ADE2 LYS2::GAL1-HIS3 met2::GAL7-lacZ) containing three independent cDNA libraries from human brain, breast/prostate cancer, and mouse embryo. After mating, at least 5 million diploid yeast cells were obtained from each library and selected on His- and Ade-lacking medium. The auxotrophy is suppressed if the bait and prey proteins interact. The prey plasmids were isolated from the positive colonies, and the interaction was confirmed by expression of third reporter gene (lacZ). cDNAs in the positive prey plasmids were sequenced.
RNA Interference
siRNA complexes for human FIP3 were purchased from Dharmacon Research (Boulder, CO) as a pool of four siRNAs (SMARTpool, Cat no. M-021079-00) or from Invitrogen as three individual siRNAs (Stealth select RNAi, Cat no. HSS114589, HSS114590, and HSS114591). The sequences of siRNAs from Invitrogen are 5'-GGACUUCAUCCAGUUUGCUACGGUC-3', 5'-GCAACUGGACGAGGAGAACAGUGAA-3', and 5'-GAGAUGAGCUCAUGGAGGCGAUUCA-3', respectively, based on the human FIP3 sequence. The siRNA pool was used in most experiments. The pool and all of the three individual siRNAs suppressed the protein expression of endogenous FIP3 efficiently (
80% knockdown) and had similar effects on TfR localization (see Figure 7A and Supplemental Figure 2). siRNAs for human ASAP1 were purchased from Invitrogen as three individual siRNAs (Stealth select RNAi, Cat HSS147203, HSS147202 and HSS147204). The sequences of siRNAs are 5'- GACCAGAUCUCUGUCUCGGAGUUCA-3', 5'- CCCAAAUUGGAGAUUUGCCGCCU AA-3' and 5'- GGGCAAUAAGGAAUAUGGCAGUGAA-3', respectively, based on human ASAP1 sequence. In most experiments, they were used as pool of the three. The two individual siRNAs (HSS147202 and HSS147204) suppressed expression of endogenous ASAP1 protein extensively (
80% knockdown) and had the same effect on TfR localization (Figure 7A and Supplemental Figure S2). As a control siRNA, negative control siRNA pool (Dharmacon, Cat no. D-001206-13) was used. All individual or pool siRNAs were transfected at 30 nM as final concentration in culture medium with Lipofectamine 2000 (Invitrogen). Cells were examined 72 h after transfection.
Coimmunoprecipitation and In Vitro Binding Assay
For immunoprecipitation (IP), HEK293T cells were transfected with the indicated expression vectors in 60-mm dishes. Twenty-four hours after transfection, cells were lysed in IP lysis buffer containing 1% Triton X-100, 150 mM NaCl, 5 mM MgCl2, 100 µM ATP, and 50 mM Tris-HCl, pH 7.4, with protease inhibitor cocktail (Roche Applied Science, Indianapolis, IN). Lysates were cleared by centrifugation. Indicated antibodies and
-bind beads (GE Healthcare, Little Chalfont, United Kingdom) were added and incubated with the lysates for 2 h at 4°C. After washing five times with IP lysis buffer, precipitated proteins were eluted from the beads by boiling in SDS sample buffer and resolved by SDS-PAGE. The proteins were transferred to PVDF membrane (Bio-Rad, Hercules, CA), and probed with indicated primary antibodies and horseradish peroxidase–labeled secondary antibodies (Jackson ImmunoResearch, West Grove, PA). Proteins were visualized with ECL reagents (GE Healthcare) and Kodak Biomax x-ray films (Carestream Health, Rochester, NY).
For in vitro binding assays, purified recombinant proteins were immobilized on glutathione-, Ni- or
-bind beads as indicated in each figure. Then counterproteins were incubated with the beads for 3 h at room temperature or overnight at 4°C. After washing three times with binding buffer, bound protein was eluted with SDS sample buffer and detected by immunoblotting using proper antibodies as coimmunoprecipitation or by Coomassie brilliant blue staining.
Arf GAP Assay
Arf GAP assay using ASAP1 was carried out as described previously (Che et al., 2005b
; Nie et al., 2006
). Briefly, purified myristoylated Arf1 or Arf6 were loaded with [
-32P]GTP in GTP loading buffer (25 mM HEPES, pH 7.4, 100 mM NaCl, 0.5 mM MgCl2, 1 mM EDTA, 1 mM ATP, and 1 mM DTT) with large unilamellar vesicles (LUVs) comprised of 500 µM total phospholipids at 30°C. Purified recombinant ASAP1 BARPZA (aa 1–724) or PZA (aa 325–724) was combined with LUVs (final phospholipids concentration of 500 µM) and purified GST or GST-FIP3C at the indicated concentration in GAP assay cocktail containing 25 mM HEPES, pH 7.4, 100 mM NaCl, 2 mM MgCl2, 1 mM GTP, and 1 mM DTT. ASAP1 BARPZA and PZA were used at final concentrations of 0.3 and 0.7 nM when using Arf1, and of 3.1 and 36 nM when using Arf6 as a substrate that resulted in hydrolysis of
30% of the GTP bound to Arf. LUVs containing 40% phosphatidylcholine (PC), 25% phosphatidylethanolamine (PE), 15% phosphatidylserine (PS), 10% cholesterol, 9.5% phosphatidylinositol (PI) and 0.5% phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) were produced by extrusion through a 1-µm pore filter. GAP reactions were initiated by the addition of [
-32P]GTP·Arf to a reaction mixture containing ASAP1 at 30°C. After 3 min the reaction was stopped by dilution with ice-cold stop-buffer (20 mM Tris-HCl, pH 8.0, 100 mM NaCl, 10 mM MgCl2, and 1 mM DTT). Arf protein was trapped on nitrocellulose membrane, and the nucleotides were released from Arf by acid extraction. The nucleotides were separated by polyethylenimino-cellulose thin-layer chromatography and quantified using a Storm PhosphorImager (GE Healthcare). In experiments in which PI(4,5)P2 was titrated, the concentration of PI was adjusted to maintain a total mole fraction of 10% phosphoinositides.
Immunofluorescence and Microscopy
Immunostaining was carried out as previously described (Bharti et al., 2007
). For staining of ASAP1, FIP3, TGN46, or
-tubulin, cells were fixed with methanol at –20°C and phosphate-buffered saline (PBS) containing 0.2% bovine serum albumin (BSA), 1% FCS, and 0.04% NaN3 was used for blocking and antibodies dilution. Confocal microscopy was performed using a Zeiss 510 Meta laser-scanning confocal microscope with a 63x, 1.4 NA Plan-Neofluar oil immersion lens (Carl Zeiss, Thornwood, NY). The Pearson's correlation coefficients were calculated using Imaris software (Bitplane, Zurich, Switzerland). Images for the calculation were captured from three independent experiments with the Zeiss 510 confocal microscope as described above.
Time-Lapse Imaging
Cells were spread on fibronectin-coated chambered cover glass (Nunc, Rochester, NY) overnight and then incubated in serum free DMEM for more than 2 h. Alexa488-Tfn (Invitrogen) was applied to the cells at 150 µg/ml in ice-cold serum-free DMEM and allowed to bind to the cell surface for 1 h on ice. After washing with serum-free medium, the cells were warmed to 37°C on a microscope with prewarmed medium and an environmental chamber (Carl Zeiss) maintained with 5% CO2 at the time image acquisition was initiated using an inverted Zeiss Axiovert 200 microscope equipped with a Perkin Elmer-Cetus Ultraview spinning disk confocal system (Perkin Elmer, Boston, MA), using a 63x objective oil immersion lens (Carl Zeiss). The images were captured at 2-s intervals for 30 min.
Quantification of the Rate of Tfn Uptake and Recycling
Cells were split into fibronectin-coated 96-well plates and starved with serum-free medium for 2 h. For uptake assays, cells were incubated with biotin-labeled Tfn (Invitrogen; 50 µg/ml as a final concentration) for the indicated time. Uptake was stopped by chilling the cells on ice and washing Tfn from the cell surface with ice-cold acid wash buffer containing 50 mM MES and 150 mM NaCl, pH 5.5. For recycling assays, cells were first saturated with biotin-labeled Tfn for 1 h and washed with the acid wash buffer to remove cell surface Tfn, before incubating the cells for the indicated time. To stop the recycling, cells were chilled on ice and washed with ice-cold acid wash buffer. The cells were fixed with 3.7% formaldehyde in PBS, permeabilized with 0.1% Triton X-100, and blocked with 0.25% BSA, and cell-associated biotin-labeled Tfn was detected with horseradish peroxidase–labeled streptavidin (Pierce, Rockford, IL) and ABTS substrate (Roche). The color development (405 nm) was quantified with Versa Max microplate reader and Soft Max Prosoftware (Molecular Devices, Sunnyvale, CA).
Other Procedures and Reagents
ASAP1 BARPZA, PZA, and BARPH (aa 1–431) protein fragments were purified as described previously (Nie et al., 2006
). A fragment comprised of residues 720-1090 of ASAP1 (named YPSH3) was expressed in Escherichia coli BL21(DE3) from pET21 as N-terminal T7 tag and C-terminal His tag protein. The protein was purified with Ni-agarose column (Qiagen, Valencia, CA) according to the manufacturer's instruction. Protein concentration was determined using the Bradford assay (Bio-Rad). Other reagents including fibronectin solution were purchased from Sigma-Aldrich if not otherwise specified.
| RESULTS |
|---|
|
|
|---|
|
|
To determine the binding site on each protein, in vitro pulldown assays were carried out using bacterially expressed recombinant proteins derived from ASAP1 and FIP3. Four His-tagged recombinant proteins from ASAP1 were immobilized on
-bind beads with anti-His polyclonal antibody, and the interaction with GST-FIP3C was analyzed by immunoblotting with anti-GST mAb (Figure 2A). FIP3 interacted with two recombinant proteins containing the BAR domain (BARPZA and BARPH), but not with proteins lacking the BAR domain (PZA and YPSH3). This result supports the idea that the primary binding site of FIP3 on ASAP1 is the BAR domain and that the interaction is direct given that only purified ASAP1 and FIP3 were present.
|
S-loaded Rab11 or Arf5. Rab11 interacted with four C-terminus–containing constructs of FIP3. This indicated that the binding site for Rab11 was at the extreme C-terminus of FIP3 as previously reported (Prekeris et al., 2001
FIP3 binds to Rab11 and Arf6 simultaneously to form a ternary complex (Fielding et al., 2005
). We determined whether FIP3 could also form a ternary complex with ASAP1 and Rab11, or Arf (Figure 3). His-tagged ASAP1 BARPZA was immobilized on Ni-agarose beads. After the beads were incubated with or without GST-FIP3C to make ASAP1-FIP3 binary complex, GTP
S-loaded Rab11, Arf1·GTP
S, Arf5·GTP
S or Arf6·GTP
S was overlaid on the beads for 3 h at room temperature. The beads were washed and Rab11 and Arf that associated with the beads were analyzed by immunoblotting. Rab11 was efficiently precipitated when FIP3C was added to the beads. In contrast, adding FIP3C did not result in the precipitation of either Arf5 or Arf6 (Figure 3). The signals observed were the same as that seen with Ni-beads alone. In this experiment, Arf1 was included under one condition was used as a negative control. These results support the conclusion that ASAP1 can bind to Rab11 through FIP3 to form a ternary complex.
|
-32P]GTP-loaded Arf. LUVs, 500 µM, containing 0.5% PI(4,5)P2 was included in the reactions. GST-FIP3C stimulated GAP activity of ASAP1 BARPZA against Arf1 by 2.5-fold (Figure 4A, left). The concentration of FIP3 that gave 50% of the maximal effect was about 0.3 µM. This effect was not observed when ASAP1 PZA, which lacks the BAR domain, was used instead of BARPZA. GST had no effect on the GAP activities of either ASAP1 BARPZA or PZA. In contrast to Arf1, when Arf6 was used as substrate, FIP3C did not stimulate GAP activity (Figure 4A, right).
|
To further define the interaction of PI(4,5)P2 and FIP3 with ASAP1, we examined the effect of PI(4,5)P2 on FIP3 binding to ASAP1 (Figure 5). We determined the effect of PI(4,5)P2 on the amount of ASAP1 BARPZA that coprecipitated with GST-FIP3C. For this experiment, we used 45 µM PI(4,5)P2 in mixed Triton X-100 micelles. This concentration of PI(4,5)P2 corresponds to
10% in 500 µM LUVs. In the absence of PI(4,5)P2, the amount of ASAP1 in the precipitate was dependent on the concentration of GST-FIP3C, with more than 100 ng of ASAP1 bound to 1.5 µM FIP3C (Figure 5B). Precipitation of ASAP1 was reduced by 80% by the addition of PI(4,5)P2. These results suggest that although FIP3 stimulates ASAP1 GAP activity against Arf1 synergistically with PI(4,5)P2, high concentration of PI(4,5)P2 prevent ASAP1-FIP3 interaction.
|
|
|
Pulse-chase experiments with fluorescence-labeled Tfn were carried out to determine whether ASAP1 or FIP3 depletion affected trafficking of endocytosed Tfn (Figure 8A). Ten minutes after chase, in either cells transfected with control, ASAP1, or FIP3 siRNA, endocytosed Tfn was observed as small dot structures over most of the cell body with some accumulation at the cell edge in ASAP1-depleted cells. Thirty minutes after chase was initiated, Tfn accumulated in the perinuclear region in cells treated with control siRNA. In contrast, in ASAP1-depleted cells, Tfn remained in the cell periphery. In FIP3-depleted cells, Tfn remained in puncta diffusely dispersed through the cell. After 60 min, most of Tfn was recycled out of the cells transfected with either siRNA. Despite the differences in cellular localization, the rate of Tfn uptake (Figure 8B) and recycling (Figure 8C) were similar in the control, ASAP1-, or FIP3-depleted cells.
|
We further characterized the peripheral TfR-positive endosomes induced by ASAP1 depletion. There was a possibility that the peripheral TfR-positive vesicles were an early endosome or endosomal intermediate. To address this question, GFP-tagged Rab5, an early endosome marker, or Rab11 were expressed in ASAP1-depleted HeLa cells. To minimize the effect of overexpressing these GTP-binding proteins, the cells having the lowest level of the expression were examined (Figure 9A). We found the peripheral TfR-positive vesicles were relatively close to GFP-Rab5-positive puncta, but their colocalization was very limited. In contrast, GFP-Rab11 colocalized with the ASAP1-induced peripheral vesicles.
|
Finally, we examined the effect of ASAP1 or FIP3 depletion on the localization of the other. In ASAP1-depleted cells, a large fraction of FIP3 relocated from the perinuclear region to cell edge as associating with TfR (Figure 10A, compare to Figure 6B). In FIP3-depleted cells, ASAP1 was still at the perinuclear region. Rab11 was dispersed throughout the cell as previously reported (Horgan et al., 2007
), but some Rab11 was present with ASAP1(Figure 10B, inset 1). Rab11 on the vesicles throughout the cell rarely colocalized with ASAP1 (Figure 10B, inset 2). These data support the idea that ASAP1 and FIP3 are independent each other for the organelle association of them.
|
| DISCUSSION |
|---|
|
|
|---|
The BAR domain superfamily is comprised of BAR/N-BAR, F-BAR, and I-BAR. The members of the family are distinguished from each other in their secondary and tertiary structures and the extent of curvature of membrane that they are associated with (Fütterer and Machesky, 2007
). Canonical BAR domains including ASAP1 BAR consist of three long, kinked
-helices that are bundled to form crescent-shaped homodimers (Peter et al., 2004
). Several BAR domains found in amphipysin, endophilin, sorting nexins and Arf GAPs such as ACAP1 and ASAP1 sense or induce membrane curvature (Takei et al., 1999
; Carlton et al., 2004
; Peter et al., 2004
; Masuda et al., 2006
; Nie et al., 2006
). Other BAR proteins, arfaptin 2 and APPL1, interact with small G proteins (Tarricone et al., 2001
; Miaczynska et al., 2004
). In our study, we found that the BAR domain of ASAP1 directly interacts with the coiled-coil domain of FIP3. This is a first report, to our knowledge, of a BAR domain interacting with a protein other than small G proteins. The interaction is through the coiled-coil region of both proteins and, therefore, represents another mode of interaction with BAR domains. A Pfam functional domain search identified similarities of both the ASAP1 BAR and FIP3 coiled-coil domains with IMP dehydrogenase (IMPDH)/GMP reductase domain. IMPDH forms a homotetramer through its core domain (Sintchak et al., 1996
). Because both ASAP1 and FIP3 form homodimers (Eathiraj et al., 2006
; Nie et al., 2006
; Shiba et al., 2006
), they might function as heterotetramer.
FIP3 is comprised of an N-terminal Pro-rich domain, two EF-hand motifs and, in the C-terminal half of the molecule, a coiled-coil domain. Rab11 and Arf5/6 bind to C-terminal end and C-terminal half of the coiled-coil domain, respectively (Prekeris et al., 2001
; Shiba et al., 2006
; Schonteich et al., 2007
). The domain also mediates homodimerization and heterodimer formation with other FIPs, which also contain coiled-coil domain in their C-terminal region (Wallace et al., 2002
; Eathiraj et al., 2006
; Shiba et al., 2006
; Horgan et al., 2007
). We found the ASAP1 BAR domain binds to the middle of the FIP3 coiled-coil domain. The interaction may regulate FIP3-Arfs interaction or FIP3 homo- or heterodimer formation with other FIPs, because the interacting sites at least partly overlap.
The GAP activity of ASAP1 is stimulated specifically by the signaling lipid PI(4,5)P2 (Brown et al., 1998
). PI(4,5)P2 binds to the PH domain of ASAP1, which can serve to both recruit ASAP1 to a membrane surface and to induce an activating conformational change in the protein (Kam et al., 2000
; Che et al., 2005a
). In this study, we found FIP3 stimulates ASAP1 GAP activity toward Arf1. This effect of FIP3 on ASAP1 was dependent on the BAR domain of ASAP1. The activation by FIP3 was observed only when myristoylated Arf1 was used as a substrate with LUVs as a lipid source. We did not observe the effect if nonmyristoylated Arf was used as a substrate or if Triton micelles were used in place of LUVs (data not shown). These observations suggest the activation is dependent on association with a phospholipids bilayer and might be coupled with a change in a physical property of the membrane, such as tubulation. The activation of GAP activity by FIP3 supports the idea that FIP3 directly interacts with ASAP1.
The role of FIP3 in stimulating GAP activity is complex. In the presence of FIP3, the effect of PI(4,5)P2 on GAP activity was biphasic. The molecular basis for the biphasic response can be explained, in part, by inhibition of ASAP1-FIP3 interaction by a higher concentration of PI(4,5)P2. Although further investigation is required to fully understand the interplay between FIP3 and PI(4,5)P2 on the physiological regulation of ASAP1, a plausible hypothesis is that FIP3 and PI(4,5)P2 function at different cellular sites. For example, PI(4,5)P2 is enriched at the plasma membrane where it may stimulate ASAP1 (Haucke, 2005
). FIP3 might stimulate GAP activity on the recycling endosome membrane. PI(4,5)P2 might inhibit the interaction of ASAP1 and FIP3 on the plasma membrane to block other functions of FIP3 at this site. Another possibility is that the relationship of FIP3 and PI(4,5)P2 binding gives temporal direction to biochemical events regulated by ASAP1. For instance, Arf1·GTP, produced by a regulated exchange factor, could bind to PI 4-P 5-kinase, activating the enzyme, which results in the production of PI(4,5)P2. PI(4,5)P2 would help target ASAP1 to the membrane where it would also interact with other membrane components, such as proteins. On the membrane, ASAP1 would convert Arf1·GTP to Arf1·GDP, with a consequent decrease of PI(4,5)P2 production. Subsequently, ASAP1 could bind FIP3.
The physiological substrate for ASAP1 GAP activity remains an open question. FIP3 preferentially binds to Arf6 and Arf5 (Shin et al., 2001
; Hickson et al., 2003
; Fielding et al., 2005
). We found FIP3 interaction stimulates ASAP1 GAP activity against Arf1, but not against Arf6. In addition to its function at the Golgi apparatus, Arf1 is thought to have similar functions at other cellular locations such as TGN, endosome, and the plasma membrane (Shin et al., 2004
; Pagano et al., 2004
; D'Souza-Schorey and Chavrier, 2006
; Cohen et al., 2007
; Kumari and Mayor, 2008
). A recent report has suggested a model in which Arf6 indirectly recruits activated Arf1 to the plasma membrane (Cohen et al., 2007
). ARNO, a guanine nucleotide exchange factor for Arf1, binds to the plasma membrane by directly interacting with Arf6 through its PH domain and activates Arf1 at the membrane. This mechanism involves cooperation between Arf isoforms. Because FIP3 interacts with Arf6 and ASAP1 uses Arf1 as a substrate, the FIP3-ASAP1 complex may functionally couple Arf6 with Arf1 at the membrane of a recycling endosome. Although FIP3 enhances ASAP1 GAP activity against Arf1, our data do not exclude other Arf isoforms as substrates. Indeed, Arf3 has high homology to Arf1 (
95% identity on the primary amino acid sequences), and our previous in vitro analysis has shown that Arf5 is as efficiently used by ASAP1 as Arf1 (Brown et al., 1998
). Furthermore, we cannot exclude the possibility that ASAP1 regulates Arf6 catalysis within the FIP3 complex, because it has been proposed that ASAP2/AMAP2, the closest isoform of ASAP1, sustains the active state of Arf6 through a direct interaction and slow catalysis (Hashimoto et al., 2004
). Our results also raise the possibility that ASAP1 indirectly binds to Arf6 through FIP3.
In this report, we found that ASAP1 functions in the pericentrosomal recycling endosomal compartment in HeLa cells. ASAP1 has previously been reported to function in peripheral cellular sites including focal adhesions, invadopodia/podosome and circular dorsal ruffles where the actin cytoskeleton is remodeled (Randazzo et al., 2000
; Onodera et al., 2005
; Bharti et al., 2007
). Function of ASAP1 at recycling endosomes may be related to that in the cell periphery. In cell migration, invasion, and scattering of epithelial cells, both Arf6 and Rab11 are involved in the trafficking of adhesion molecules including integrins and cadherin between recycling endosome and the plasma membrane (Brown et al., 2001
; Santy and Casanova, 2001
; Powelka et al., 2004
; Caswell and Norman, 2006
). In addition, Arf1 also mediates paxillin recruitment to focal adhesions (Norman et al., 1998
). We have found that CIN85, a multidomain adaptor protein involved in Cbl-mediated down-regulation of EGFR, interacts with ASAP1, and overexpression of ASAP1 increases the recycling of EGFR in CHO cells (Kowanetz et al., 2004
). More recently, CIN85 has been reported to colocalize with ASAP1 in invadopodia, and the complex of ASAP1 and CIN85 has been proposed to positively regulate the invasive phenotype of breast cancer cells (Nam et al., 2007
). A plausible model explaining these results is that ASAP1 regulates the recycling of transmembrane protein, such as integrins.
The staining for FIP3 was variable. FIP3 associated with recycling endosomes, which are distributed as groups of small vesicles in the perinuclear region. In addition, FIP3 also associated with single puncta in the pericentrosomal region in some cells. ASAP1 and FIP3 colocalize at the structure. The reason for the variable localization of FIP3 is not known, but may be related to the cell cycle as shown in Drosophila Nuf, orthologue of mammalian FIP3 and FIP4 (Rothwell et al., 1998
; Riggs et al., 2003
). Nuf is diffusely distributed in cells during interphase in Drosophila embryo, but accumulates in the pericentrosomal area during prophase before nuclear membrane breakdown. During metaphase to telophase, Nuf disappears from the region, and accumulates again during cellularization, which corresponds to cytokinesis in mammalian cells.
Part of the variability in FIP3 localization could be related to having more than one binding partner responsible for localization. FIP3 localizes at recycling endosomes in a Rab11-dependent manner (Horgan et al., 2007
). We found that association of FIP3 with the perinuclear puncta depends on ASAP1 expression, whereas association of ASAP1 with the puncta does not depend on FIP3. On the basis of this result and the finding that FIP3 binds to ASAP1, we propose that FIP3 is recruited to the perinuclear puncta by ASAP1. The mechanism by which ASAP1 associates with this structure remains to be defined.
We found that depletion of ASAP1 using siRNA in HeLa cells perturbs perinuclear localization of Tfn and TfR and induces their accumulation at the cell edge in a compartment that contains Rab11 and FIP3. Despite the significant change of the localization of Tfn and TfR, the kinetics of Tfn internalization and recycling were not affected. There are other examples of changes in the distribution of perinuclear recycling endosome that do not affect the kinetics of Tfn recycling; overexpression of FIP3 or FIP4 induces accumulation of perinuclear recycling endosomes, but there is no effect on Tfn recycling rate (Hickson et al., 2003
; Horgan et al., 2004
). Similarly, siRNA-mediated depletion of annexin 2, a Ca2+-dependent endosome membrane-associated protein, causes accumulation of recycling endosomes in the perinuclear region, but has no significant effect on the rate of recycling (Zobiack et al., 2003
). Taken together, we conclude that the kinetics of Tfn recycling do not depend on proper positioning of the perinuclear recycling endosomes, although we cannot exclude that alternative pathways for internalization and recycling may compensate for a defect derived from single protein. Because TfR recycling can occur through either the sorting endosome or the recycling endosome and the depletion of ASAP1 does not appear to affect the sorting endosome, as marked by Rab5, Tfn recycling is likely intact because transport through the sorting endosome still occurs. This idea is also supported by the live-cell tracking of Tfn.
The peripheral vesicles observed when ASAP1 was depleted contained TfR, Tfn, Rab11, and FIP3, typical recycling endosome marker. We concluded that the vesicles were recycling endosomes that were displaced from the usual perinuclear localization. We also analyzed the localization of Arf1 and Arf6 in the cells. In control siRNA-transfected cells, we detected that a small amount of Arf1 and Arf6 on TfR-positive vesicles at perinuclear region, which becomes reduced upon the depletion of ASAP1. Because AP-1 and Arf guanine nucleotide exchange factor BIG2 act at the recycling endosome in addition to the TGN (Deneka et al., 2003
; Shin et al., 2004
), Arf1 as well as Arf6 may be involved in the function of the recycling endosome. In this context, ASAP1 may regulate Arf1 association to the recycling endosome and, as a consequence, the translocation of the endosomes from the pericentrosomal region to the cell periphery.
In summary, our data support the conclusion that the BAR domain of ASAP1 interacts with the coiled-coil region of FIP3, and the binding stimulates ASAP1 Arf GAP activity. Both FIP3 and ASAP1 are required for proper localization of the perinuclear endocytic recycling compartment containing Tfn and TfR. These findings provided new insights into the nature of BAR domains as protein-interacting module and the function of ASAP1 on membrane trafficking. We also propose that FIP3 functions as a novel coat protein because it associates with Arfs and Arf GAP and regulates the GAP activity, which are properties of other coat proteins including COPs, APs, and GGAs.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Address correspondence to: Paul A. Randazzo (Randazzo{at}helix.nih.gov)
| REFERENCES |
|---|
|
|
|---|
Brown, F. D., Rozelle, A. L., Yin, H. L., Balla, T., and Donaldson, J. G. (2001). Phosphatidylinositol 4,5-bisphosphate and Arf6-regulated membrane traffic. J. Cell Biol 154, 1007–1017.
Brown, M. T., Andrade, J., Radhakrishna, H., Donaldson, J. G., Cooper, J. A., and Randazzo, P. A. (1998). ASAP1, a phospholipid-dependent arf GTPase-activating protein that associates with and is phosphorylated by Src. Mol. Cell. Biol 18, 7038–7051.
Buccione, R., Orth, J. D., and McNiven, M. A. (2004). Foot and mouth: podosomes, invadopodia and circular dorsal ruffles. Nat. Rev. Mol. Cell Biol 5, 647–657.[CrossRef][Medline]
Carlton, J., Bujny, M., Peter, B. J., Oorschot, V. M., Rutherford, A., Mellor, H., Klumperman, J., McMahon, H. T., and Cullen, P. J. (2004). Sorting nexin-1 mediates tubular endosome-to-TGN transport through coincidence sensing of high-curvature membranes and 3-phosphoinositides. Curr. Biol 14, 1791–1800.[CrossRef][Medline]
Caswell, P. T., and Norman, J. C. (2006). Integrin trafficking and the control of cell migration. Traffic 7, 14–21.[CrossRef][Medline]
Che, M. M., Boja, E. S., Yoon, H. Y., Gruschus, J., Jaffe, H., Stauffer, S., Schuck, P., Fales, H. M., and Randazzo, P. A. (2005a). Regulation of ASAP1 by phospholipids is dependent on the interface between the PH and Arf GAP domains. Cell Signal 17, 1276–1288.[CrossRef][Medline]
Che, M. M., Nie, Z., and Randazzo, P. A. (2005b). Assays and properties of the Arf GAPs AGAP1, ASAP1, and Arf GAP1. Methods Enzymol 404, 147–163.[CrossRef][Medline]
Cohen, L. A., Honda, A., Varnai, P., Brown, F. D., Balla, T., and Donaldson, J. G. (2007). Active Arf6 recruits ARNO/cytohesin GEFs to the PM by binding their PH domains. Mol. Biol. Cell 18, 2244–2253.
Deneka, M., Neeft, M., Popa, I., van Oort, M., Sprong, H., Oorschot, V., Klumperman, J., Schu, P., and van der Sluijs, P. (2003). Rabaptin-5alpha/rabaptin-4 serves as a linker between rab4 and gamma(1)-adaptin in membrane recycling from endosomes. EMBO J 22, 2645–2657.[CrossRef][Medline]
D'Souza-Schorey, C., and Chavrier, P. (2006). ARF proteins: roles in membrane traffic and beyond. Nat. Rev. Mol. Cell Biol 7, 347–358.[CrossRef][Medline]
Eathiraj, S., Mishra, A., Prekeris, R., and Lambright, D. G. (2006). Structural basis for Rab11-mediated recruitment of FIP3 to recycling endosomes. J. Mol. Biol 364, 121–135.[CrossRef][Medline]
Fielding, A. B., Schonteich, E., Matheson, J., Wilson, G., Yu, X., Hickson, G. R., Srivastava, S., Baldwin, S. A., Prekeris, R., and Gould, G. W. (2005). Rab11-FIP3 and FIP4 interact with Arf6 and the exocyst to control membrane traffic in cytokinesis. EMBO J 24, 3389–3399.[CrossRef][Medline]
Furman, C., Short, S. M., Subramanian, R. R., Zetter, B. R., and Roberts, T. M. (2002). DEF-1/ASAP1 is a GTPase-activating protein (GAP) for ARF1 that enhances cell motility through a GAP-dependent mechanism. J. Biol. Chem 277, 7962–7969.
Fütterer, K., and Machesky, L. M. (2007). "Wunder" F-BAR domains: going from pits to vesicles. Cell 129, 655–657.[Medline]
Gillingham, A. K., and Munro, S. (2007). The small G proteins of the Arf family and their regulators. Annu. Rev. Cell Dev. Biol 23, 579–611.[CrossRef][Medline]
Ha, V. L., Bharti, S., Inoue, H., Vass, W. C., Campa, F., Nie, Z., de Gramont, A., Ward, Y., and Randazzo, P. A. (2008). ASAP3 is a focal adhesion-associated Arf GAP that functions in cell migration and invasion. J. Biol. Chem 283, 14915–14926.
Habermann, B. (2004). The BAR-domain family of proteins: a case of bending and binding? EMBO Rep 5, 250–255.[CrossRef][Medline]
Hashimoto, S., Hashimoto, A., Yamada, A., Kojima, C., Yamamoto, H., Tsutsumi, T., Higashi, M., Mizoguchi, A., Yagi, R., and Sabe, H. (2004). A novel mode of action of an ArfGAP, AMAP2/PAG3/Pap alpha, in Arf6 function. J. Biol. Chem 279, 37677–37684.
Haucke, V. (2005). Phosphoinositide regulation of clathrin-mediated endocytosis. Biochem. Soc. Trans 33, 1285–1289.[CrossRef][Medline]
Hickson, G. R., Matheson, J., Riggs, B., Maier, V. H., Fielding, A. B., Prekeris, R., Sullivan, W., Barr, F. A., and Gould, G. W. (2003). Arfophilins are dual Arf/Rab 11 binding proteins that regulate recycling endosome distribution and are related to Drosophila nuclear fallout. Mol. Biol. Cell 14, 2908–2920.
Horgan, C. P., Oleksy, A., Zhdanov, A. V., Lall, P. Y., White, I. J., Khan, A. R., Futter, C. E., McCaffrey, J. G., and McCaffrey, M. W. (2007). Rab11-FIP3 is critical for the structural integrity of the endosomal recycling compartment. Traffic 8, 414–430.[CrossRef][Medline]
Horgan, C. P., Walsh, M., Zurawski, T. H., and McCaffrey, M. W. (2004). Rab11-FIP3 localises to a Rab11-positive pericentrosomal compartment during interphase and to the cleavage furrow during cytokinesis. Biochem. Biophys. Res. Commun 319, 83–94.[CrossRef][Medline]
Inoue, H., and Randazzo, P. A. (2007). Arf GAPs and their interacting proteins. Traffic 8, 1465–1475.[CrossRef][Medline]
Jackson, T. R., Brown, F. D., Nie, Z., Miura, K., Foroni, L., Sun, J., Hsu, V. W., Donaldson, J. G., and Randazzo, P. A. (2000). ACAPs are arf6 GTPase-activating proteins that function in the cell periphery. J. Cell Biol 151, 627–638.
Kam, J. L., Miura, K., Jackson, T. R., Gruschus, J., Roller, P., Stauffer, S., Clark, J., Aneja, R., and Randazzo, P. A. (2000). Phosphoinositide-dependent activation of the ADP-ribosylation factor GTPase-activating protein ASAP1. Evidence for the pleckstrin homology domain functioning as an allosteric site. J. Biol. Chem 275, 9653–9663.
Kowanetz, K. et al. (2004). CIN85 associates with multiple effectors controlling intracellular trafficking of epidermal growth factor receptors. Mol. Biol. Cell 15, 3155–3166.
Kumari, S., and Mayor, S. (2008). ARF1 is directly involved in dynamin-independent endocytosis. Nat. Cell Biol 10, 30–41.[CrossRef][Medline]
Lee, E., Marcucci, M., Daniell, L., Pypaert, M., Weisz, O. A., Ochoa, G. C., Farsad, K., Wenk, M. R., and De Camilli, P. (2002). Amphiphysin 2 (Bin1) and T-tubule biogenesis in muscle. Science 297, 1193–1196.
Liu, Y., Loijens, J. C., Martin, K. H., Karginov, A. V., and Parsons, J. T. (2002). The association of ASAP1, an ADP ribosylation factor-GTPase activating protein, with focal adhesion kinase contributes to the process of focal adhesion assembly. Mol. Biol. Cell 13, 2147–2156.
Liu, Y., Yerushalmi, G. M., Grigera, P. R., and Parsons, J. T. (2005). Mislocalization or reduced expression of Arf GTPase-activating protein ASAP1 inhibits cell spreading and migration by influencing Arf1 GTPase cycling. J. Biol. Chem 280, 8884–8892.
Masuda, M., Takeda, S., Sone, M., Ohki, T., Mori, H., Kamioka, Y., and Mochizuki, N. (2006). Endophilin BAR domain drives membrane curvature by two newly identified structure-based mechanisms. EMBO J 25, 2889–2897.[CrossRef][Medline]
Miaczynska, M., Christoforidis, S., Giner, A., Shevchenko, A., Uttenweiler-Joseph, S., Habermann, B., Wilm, M., Parton, R. G., and Zerial, M. (2004). APPL proteins link Rab5 to nuclear signal transduction via an endosomal compartment. Cell 116, 445–456.[CrossRef][Medline]
Nam, J. M., Onodera, Y., Mazaki, Y., Miyoshi, H., Hashimoto, S., and Sabe, H. (2007). CIN85, a Cbl-interacting protein, is a component of AMAP1-mediated breast cancer invasion machinery. EMBO J 26, 647–656.[CrossRef][Medline]
Nie, Z. et al. (2006). A BAR domain in the N terminus of the Arf GAP ASAP1 affects membrane structure and trafficking of epidermal growth factor receptor. Curr. Biol 16, 130–139.[CrossRef][Medline]
Norman, J. C., Jones, D., Barry, S. T., Holt, M. R., Cockcroft, S., and Critchley, D. R. (1998). ARF1 mediates paxillin recruitment to focal adhesions and potentiates Rho-stimulated stress fiber formation in intact and permeabilized Swiss 3T3 fibroblasts. J. Cell Biol 143, 1981–1995.
Oda, A. et al. (2003). CrkL directs ASAP1 to peripheral focal adhesions. J. Biol. Chem 278, 6456–6460.
Onodera, Y. et al. (2005). Expression of AMAP1, an ArfGAP, provides novel targets to inhibit breast cancer invasive activities. EMBO J 24, 963–973.[CrossRef][Medline]
Pagano, A., Crottet, P., Prescianotto-Baschong, C., and Spiess, M. (2004). In vitro formation of recycling vesicles from endosomes requires adaptor protein-1/clathrin and is regulated by rab4 and the connector rabaptin-5. Mol. Biol. Cell 15, 4990–5000.
Peter, B. J., Kent, H. M., Mills, I. G., Vallis, Y., Butler, P. J., Evans, P. R., and McMahon, H. T. (2004). BAR domains as sensors of membrane curvature: the amphiphysin BAR structure. Science 303, 495–499.
Powelka, A. M., Sun, J., Li, J., Gao, M., Shaw, L. M., Sonnenberg, A., and Hsu, V. W. (2004). Stimulation-dependent recycling of integrin beta1 regulated by ARF6 and Rab11. Traffic 5, 20–36.[CrossRef][Medline]
Prekeris, R. (2003). Rabs, Rips, FIPs, and endocytic membrane traffic. Sci. World J 3, 870–880.[Medline]
Prekeris, R, Davies, J. M., and Scheller, R. H. (2001). Identification of a novel Rab11/25 binding domain present in Eferin and Rip proteins. J. Biol. Chem 276, 38966–38970.
Randazzo, P. A., Andrade, J., Miura, K., Brown, M. T., Long, Y. Q., Stauffer, S., Roller, P., and Cooper, J. A. (2000). The Arf GTPase-activating protein ASAP1 regulates the actin cytoskeleton. Proc. Natl. Acad. Sci. USA 97, 4011–4016.
Randazzo, P. A., Inoue, H., and Bharti, S. (2007). Arf GAPs as regulators of the actin cytoskeleton. Biol. Cell 99, 583–600.[Medline]
Riggs, B., Rothwell, W., Mische, S., Hickson, G. R., Matheson, J., Hays, T. S., Gould, G. W., and Sullivan, W. (2003). Actin cytoskeleton remodeling during early Drosophila furrow formation requires recycling endosomal components Nuclear-fallout and Rab11. J. Cell Biol 163, 143–154.
Rothwell, W. F., Fogarty, P., Field, C. M., and Sullivan, W. (1998). Nuclear-fallout, a Drosophila protein that cycles from the cytoplasm to the centrosomes, regulates cortical microfilament organization. Development 125, 1295–1303.[Abstract]
Santy, L. C., and Casanova, J. E. (2001). Activation of ARF6 by ARNO stimulates epithelial cell migration through downstream activation of both Rac1 and phospholipase D. J. Cell Biol 154, 599–610.
Schonteich, E., Pilli, M., Simon, G. C., Matern, H. T., Junutula, J. R., Sentz, D., Holmes, R. K., and Prekeris, R. (2007). Molecular characterization of Rab11-FIP3 binding to ARF GTPases. Eur. J. Cell Biol 86, 417–431.[CrossRef][Medline]
Shiba, T., Koga, H., Shin, H. W., Kawasaki, M., Kato, R., Nakayama, K., and Wakatsuki, S. (2006). Structural basis for Rab11-dependent membrane recruitment of a family of Rab11-interacting protein 3 (FIP3)/Arfophilin-1. Proc. Natl. Acad. Sci. USA 103, 15416–15421.
Shin, H. W., Morinaga, N., Noda, M., and Nakayama, K. (2004). BIG2, a guanine nucleotide exchange factor for ADP-ribosylation factors: its localization to recycling endosomes and implication in the endosome integrity. Mol. Biol. Cell 15, 5283–5294.
Shin, O. H., Couvillon, A. D., and Exton, J. H. (2001). Arfophilin is a common target of both class II and class III ADP-ribosylation factors. Biochemistry 40, 10846–10852.[CrossRef][Medline]
Shin, O. H., Ross, A. H., Mihai, I., and Exton, J. H. (1999). Identification of arfophilin, a target protein for GTP-bound class II ADP-ribosylation factors. J. Biol. Chem 274, 36609–36615.
Sintchak, M. D., Fleming, M. A., Futer, O., Raybuck, S. A., Chambers, S. P., Caron, P. R., Murcko, M. A., and Wilson, K. P. (1996). Structure and mechanism of inosine monophosphate dehydrogenase in complex with the immunosuppressant mycophenolic acid. Cell 85, 921–930.[CrossRef][Medline]
Takei, K., Slepnev, V. I., Haucke, V., and De Camilli, P. (1999). Functional partnership between amphiphysin and dynamin in clathrin-mediated endocytosis. Nat. Cell Biol 1, 33–39.[CrossRef][Medline]
Tarricone, C., Xiao, B., Justin, N., Walker, P. A., Rittinger, K., Gamblin, S. J., and Smerdon, S. J. (2001). The structural basis of Arfaptin-mediated cross-talk between Rac and Arf signalling pathways. Nature 411, 215–219.[CrossRef][Medline]
van IJzendoorn, S. C. (2006). Recycling endosomes. J. Cell Sci 119, 1679–1681.
Wallace, D. M., Lindsay, A. J., Hendrick, A. G., and McCaffrey, M. W. (2002). The novel Rab11-FIP/Rip/RCP family of proteins displays extensive homo- and hetero-interacting abilities. Biochem. Biophys. Res. Commun 292, 909–915.[CrossRef][Medline]
Wilson, G. M., Fielding, A. B., Simon, G. C., Yu, X., Andrews, P. D., Hames, R. S., Frey, A. M., Peden, A. A., Gould, G. W., and Prekeris, R. (2005). The FIP3-Rab11 protein complex regulates recycling endosome targeting to the cleavage furrow during late cytokinesis. Mol. Biol. Cell 16, 849–860.
Zerial, M., and McBride, H. (2001). Rab proteins as membrane organizers. Nat. Rev. Mol. Cell Biol 2, 107–117.[CrossRef][Medline]
Zhu, G., Chen, J., Liu, J., Brunzelle, J. S., Huang, B., Wakeham, N., Terzyan, S., Li, X., Rao, Z., Li, G., and Zhang, X. C. (2007). Structure of the APPL1 BAR-PH domain and characterization of its interaction with Rab5. EMBO J 26, 3484–3493.[CrossRef][Medline]
Zobiack, N., Rescher, U., Ludwig, C., Zeuschner, D., and Gerke, V. (2003). The annexin 2/S100A10 complex controls the distribution of transferrin receptor-containing recycling endosomes. Mol. Biol. Cell 14, 4896–4908.
This article has been cited by other articles:
![]() |
B. T. Emmer, D. Maric, and D. M. Engman Molecular mechanisms of protein and lipid targeting to ciliary membranes J. Cell Sci., February 15, 2010; 123(4): 529 - 536. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Horgan, S. R. Hanscom, R. S. Jolly, C. E. Futter, and M. W. McCaffrey Rab11-FIP3 links the Rab11 GTPase and cytoplasmic dynein to mediate transport to the endosomal-recycling compartment J. Cell Sci., January 15, 2010; 123(2): 181 - 191. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Liljegren, M. E. Leslie, L. Darnielle, M. W. Lewis, S. M. Taylor, R. Luo, N. Geldner, J. Chory, P. A. Randazzo, M. F. Yanofsky, et al. Regulation of membrane trafficking and organ separation by the NEVERSHED ARF-GAP protein Development, June 1, 2009; 136(11): 1909 - 1918. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Jian, P. Brown, P. Schuck, J. M. Gruschus, A. Balbo, J. E. Hinshaw, and P. A. Randazzo Autoinhibition of Arf GTPase-activating Protein Activity by the BAR Domain in ASAP1 J. Biol. Chem., January 16, 2009; 284(3): 1652 - 1663. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||