![]() |
|
|
Vol. 19, Issue 10, 4454-4468, October 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

*Department of Biology, University of Virginia, Charlottesville, VA 22904; and
Department of Cell Biology, University of Virginia School of Medicine, Charlottesville, VA 22904
Submitted March 10, 2008;
Revised July 11, 2008;
Accepted August 6, 2008
Monitoring Editor: David G. Drubin
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
SWF1/PSL10/YDR126W (hereafter SWF1) was one of 30 CDC42-interacting genes identified in S. cerevisiae in a synthetic genetic interaction screen for genes involved in cell polarization (Kozminski et al., 2003
). This gene was also identified previously in three independent genetic screens, each of which implicated Swf1p in a specific cellular process. A screen for genes required for meiotic division and recombination identified SWF1 as important for spore wall formation (Enyenihi and Saunders, 2003
). In mitotic cells, in a screen based on the missorting of carboxypeptidase Y, SWF1 was found involved in vesicle trafficking and sorting to the vacuole (Bonangelino et al., 2002
). Although seeming dissimilar, all of these cellular processes depend in common upon a functioning actin cytoskeleton (Hill et al., 1996
; Bonangelino et al., 2002
; Taxis et al., 2006
; Isgandarova et al., 2007
). The idea of a physiological link between SWF1 function and the actin cytoskeleton is further supported by the identification of SWF1 as PSL10 (profilin synthetic lethal). Haarer found that deletion of SWF1 is synthetic lethal with a hypomorphic allele of PFY1 (Bartels et al., 1999
), which encodes a potent regulator of the actin cytoskeletal dynamics and organization (Jockusch et al., 2007
). However, whether SWF1 regulates the dynamics and organization of the actin cytoskeleton has not been examined.
SWF1 encodes a polypeptide (Swf1p) with five predicted transmembrane domains; it is one of seven proteins in S. cerevisiae that contain a DHHC-CRD motif (Putilina et al., 1999
; Linder and Deschenes, 2003
; Politis et al., 2005
; Mitchell et al., 2006
). As with many of the >20 DHHC-CRD–containing proteins in mammals (Fukata et al., 2004
), including Huntingtin interacting protein 14 (Ducker et al., 2004
), three of the DHHC-CRD proteins in yeast (Erf2p, Pfa3p, and Akr1p) have palmitoyltransferase (PT) activity. Swf1p seems to have PT activity as well (Valdez-Taubas and Pelham, 2005
), although in vitro reconstitution of this activity has yet to be demonstrated. Palmitoylation, the result of PT activity, is a posttranslational lipid modification that is essential for the trafficking of signaling molecules such as Ras, and, in the case of mutant huntingtin protein, for the prevention of protein aggregation (see references in Linder and Deschenes, 2007
). In budding yeast, Swf1p was shown to palmitoylate the soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) proteins Snc1p, Syn8, and Tlg1p (Valdez-Taubas and Pelham, 2005
). Palmitoylation protects the Qc-SNARE Tlg1p from ubiquitin-mediated degradation, suggesting that palmitoylation is one mechanism by which a cell spatially and temporally regulates exocytosis (Valdez-Taubas and Pelham, 2005
). One prediction of this model that has not been tested is whether loss of the DHHC motif (i.e., the predicted PT activity) results in a secretory defect, and, if so, whether this secretory defect occurs independently of effects on the actin cytoskeleton. This prediction is tested in this study.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
|
The method of Longtine et al. (1998)
was used to delete SWF1 in DDY1102, forming KKY1074. Polymerase chain reaction (PCR) was used to amplify a kanMX4 disruption cassette with Accuzyme (Bioline, Randolph, MA) from template pML1 with the primers oSD2 (CTCTTTAGGAAATTCGTAGCTATCAACAAAGGTAGTGTCATTGTATATATACTTCCGCCCGGATCCCCGGGTTAATTAA) and oKK144 (AATAAACCGCTTGTATAATGAATTTGTTCGACATTTGCGGTTAGAATCTATGGCGGTGAGGAATTCGAGCTCGTTTAAAC; SWF1 flanking sequence underlined). The same method was used to introduce a green fluorescent protein (GFP) tag at the C terminus of Swf1p in DDY1102, forming KKY1104. PCR was used to amplify GFP-kanMX from template pML4, by using Accuzyme (Bioline) and primers oKK143 (CGAAATTCCCAATATATATGACAAAGGTACCTTCCTGGCCAATCTCACAGATTTAATACGGATCCCCGGGTTAATTAA; SWF1 flanking sequence underlined) and oKK144.
Plasmids
To construct a 2µ plasmid containing SWF1 (pKK1585), the region of chromosome IV between base pairs 702754 and 704475 was amplified from KKY283 genomic DNA with BioXact DNA polymerase (Bioline) by using the primers oKK172 (GACTAAGCTTCATTCGCTCATCCTTAAAC; HindIII site underlined) and oKK173 (CTGATCTAGAGTAATATACAATTATCTTACGTAG; XbaI site underlined), and subcloned into the HindIII and XbaI sites of YEplac195. To verify the fidelity of amplification, the subcloned PCR fragment was sequenced. To construct a CEN plasmid containing SWF1 (pKK1586), a HindIII-XbaI fragment from pKK1585 was subcloned into the HindIII and XbaI sites of YCplac33.
To construct pKK1872 (GST-SWF1-C), the coding sequence for the nonconserved C terminus (amino acids 235–336) of Swf1p was amplified by PCR from pKK1586 by using the primers oKK170 (GACCAAGCTTCTATATTAAATCTGTGAGATTGGC; HindIII site underlined) and oKK182 (CTGAGGATCCGCCATTGTAAAGGAGGGAATG; BamHI site underlined) and subcloned into the BamHI and HindIII sites of pKK1871. To verify the fidelity of amplification, the subcloned PCR fragment was sequenced. To construct pKK1871 (GST-SWF1), the coding sequence of SWF1 was amplified by PCR from DDY1102 genomic DNA using primers oKK169 (ACGCGGATCCATGTCATGGAATCTACTATTTGTG; BamHI site underlined) and oKK170 and subcloned into the BamH1 and HindIII sites of pKK1516. To construct pKK1516, the coding sequence of cdc42-118 was amplified by PCR from pAC129 by using primers oKK18 (GCGCGGGATCCATGCAAACGCTAAAGTGTGTTGTTG; BamHI site underlined) and oKK24 (GCGCGCAAGCTTCTACAAAATTGTACATTTTTTACTTTTC; HindIII site underlined) and subcloned into the BamHI and HindIII sites of pKK661.
The QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) was used to construct pKK1873 (swf1-DHHA), in which the codon for cysteine 164 was mutagenized to that of alanine. This PCR-based approach used pKK1586 as a template and primers oKK179 (GTCGCCGACCATCATGCCATCTGGATAAATAAC) and oKK180 (GTTATTTATCCAGATGGCATGATGGTCGGCGAC).
Removing a NotI-NotI LEU2-containing fragment from pAC183 and pAC329 and replacing it with a NotI-Not1 natMX-containing fragment constructed pKK1469 and pKK1473, respectively. The natMX fragment was generated by PCR as described in Kozminski et al. (2003)
.
Factor Release Assay
Factor (synthesized at the University of Virginia, Charlottesville, VA) was added to log-phase cells (OD600 = 0.25), grown in rich medium at 25°C, to a final concentration of 5 µg/ml. After culturing for an additional 90 min, the cells were harvested by centrifugation for 5 min at 1.5 krpm in an IEC clinical centrifuge at room temperature. Each cell pellet was then washed twice with 12.5 ml of rich medium and cultured as described above. After the second wash (t = 0), 0.5 ml of each culture was collected every 10 min and fixed with 4% formaldehyde. Before scoring bud size by phase microscopy, each sample was sonicated briefly.
Exocytosis Assays
Bgl2p secretion was assayed as described in Kozminski et al. (2006)
, following the method of Harsay and Schekman (2007)
.
To assay for the secretion of invertase (Suc2p), the assay of Bankaitis et al. (1989)
was used with modification. For each strain assayed, 5 ml of mid-log phase culture (
0.25–0.3 OD600) was pelleted at 600 x g for 5 min. The pellet was resuspended in 5 ml of rich medium (5% glucose) and then grown at 25°C for 60 min. To assay NY17 cells at permissive and restrictive temperatures, 10 ml of mid-log phase culture was split equally and processed in parallel, except one culture was preshifted to 37°C for 15 min after 60-min growth at 25°C. Both NY17 cultures were then pelleted as described above and washed with 10 ml of sterile water prewarmed to either 25 or 37°C. After the wash, cells were resuspended in 3 ml of rich medium (0.1% glucose) and incubated at either 25°C or 37°C for 90 min. After this incubation, all cultures, including the NY17 cultures, were harvested as described above. Cells were gently resuspended in 5 ml of ice-cold 10 mM NaN3/10 mM KF, incubated on ice for 10 min, and then diluted with 5 ml of ice-cold water. The cell suspension was further diluted with ice-cold water if the OD600 was >0.7. The cell suspension was centrifuged again as before. Pellets were washed twice with 10 ml of water and then resuspended gently in 1 ml of 0.2 M sodium acetate, pH 4.9. Then, 0.5 ml of each cell suspension was transferred to each of two new microfuge tubes. One tube was maintained on ice, and to the other tube 12 µl of 20% Triton X-100 was added, with gentle mixing followed by one freeze-thaw cycle in a dry ice-ethanol bath. The equivalent of 0.02 OD600 units from each sample was assayed for invertase activity following the method of Goldstein and Lampen (1975)
.
Electron Microscopy
For the analysis of vesicles within yeast, thin sections for transmission electron microscopy were prepared according to the methods of Salminen and Novick (1987)
and Wright (2000)
, with modifications. In brief, 12.5 ml of mid-log phase yeast culture (
6 OD600 units), grown in rich medium at 25 or 37°C were rapidly pipetted into an equal volume of 2x fixative (0.2 M sodium cacodylate buffer, pH 6.8, 0.4 M D-sorbitol, 4 mM MgCl2, 4 mM CaCl2, 8% paraformaldehyde, and 6% glutaraldehyde; fixatives from Ted Pella, Redding, CA) and incubated 10 min at room temperature. Cells were then pelleted at 1500g for 5 min, resuspended in 25 ml of fixative, and incubated overnight at 4°C. Fixed cells were pelleted at 1500 x g for 5 min at room temperature, washed twice with 20 ml of 0.1 M cacodylate buffer, pH 6.8, and then washed twice with 25 ml of 50 mM potassium phosphate buffer, pH 7.5. Cells were then pelleted as described above, resuspended in 1 ml of 50 mM potassium phosphate buffer containing 0.25 mg/ml Zymolyase 100T (Seikagaku, Tokyo, Japan), and incubated at 30°C for 45 min. Fixed spheroplasts were then pelleted at 1000 x g for 1 min at room temperature and washed thrice with ice-cold 0.1 M cacodylate buffer. After the wash, pelleted spheroplasts were resuspended in 1 ml of ice-cold 1% (vol/vol) osmium tetroxide and 0.8% (wt/vol) potassium ferricyanide in 0.1 M cacodylate buffer, pH 6.8, for 1 h on ice. The spheroplasts were then washed thrice with deionized water, resuspended in aqueous 0.5% uranyl acetate for 30 min at room temperature in the dark, and then washed twice with deionized water. Graded dehydration with ethanol and then acetone preceded embedment with Spurr's resin. Silver/gold thin sections were cut with a diamond knife and stained with lead citrate (Venable and Coggeshall, 1965
) for 5 min, 3% uranyl acetate in 50% acetone for 15 min, and lead citrate again for 5 min. Stained sections were examined on a JEOL 100CXII electron microscope (JEOL, Tokyo, Japan) equipped with a SIA L-3C digital camera (Scientific Instruments and Applications, Atlanta, GA).
Glutathione Transferase (GST)-Swf1-C Expression and Purification
GST-Swf1-C was purified from BL21(DE3) E. coli transformed with pKK1872 after an overnight induction at 25°C with 0.1 mM isopropyl β-D-thiogalactoside. All subsequent procedures were completed at 4°C. Bacteria were harvested from a 1-l culture at 4000 rpm (20 min; Beckman J6 rotor). The pellet was resuspended in 40 ml of ice-cold lysis buffer (50 mM Tris-Cl, pH 8.0, 1 mM EDTA, 1 mM dithiothreitol [DTT], 250 mM NaCl, 1 mM phenylmethylsulfonyl fluoride [PMSF], and 0.5 µg/ml each of leupeptin, aprotinin, pepstatin A, chymostatin, and antipain). Bacteria were then lysed on ice with sonication. Lysate was centrifuged at 35,000 rpm for 45 min in a Beckman Ti45 rotor. The supernatant was recovered and nutated with 2 ml of glutathione-Sepharose beads (GE Healthcare, Little Chalfont, Buckinghamshire, United Kingdom), prewashed in lysis buffer, for 20 min. After this incubation, the bead suspension was poured into a column and successively washed with 25 ml of wash buffer [50 mM Tris-Cl, pH 8.0, 1 mM EDTA, 0.5 mM EGTA, 1 mM DTT, 200 mM NaCl, 5% (vol/vol) glycerol, and 1 mM PMSF], 250 ml of wash buffer with 1% Triton X-100, 250 ml of wash buffer with 400 mM NaCl, 250 ml of wash buffer with 1% betaine and 0.1% Tween 20, and 250 ml of wash buffer. GST-Swf1-C was eluted as 1-ml fractions with elution buffer [50 mM Tris-Cl, pH 8.0, 150 mM NaCl, 1 mM DTT, 0.5 mM EDTA, 0.1 mM EGTA, 5% (vol/vol) glycerol, and 25 mM glutathione] until the absorbance of the eluate at 280 nm reached 0.02. Peak GST-Swf1-C fractions, as determined by absorbance spectroscopy at 280 nm and SDS-polyacrylamide gel electrophoresis (PAGE), were pooled (
4 ml total volume) and twice dialyzed against 1.5 l of phosphate-buffered saline (PBS) containing 0.1 mM DTT and 10% (vol/vol) glycerol. Final protein concentration was determined by UV absorbance at 280 nm or by Bradford assay (Bio-Rad, Hercules, CA), by using bovine serum albumin (BSA) as a standard.
Swf1p Antibody Production and Purification
Because thrombin cleavage of the GST-Swf1-C fusion protein resulted in complete degradation of the Swf1 fragment, uncleaved GST-Swf1-C was used as an immunogen. Covance Research Products (Denver, PA) performed all inoculations and bleeds. We brought 250 µg of GST-Swf1-C to 0.5 ml with PBS and mixed with 0.5 ml of Freund's complete adjuvant before subcutaneous injection into New Zealand White rabbits. Booster injections containing 125 µg of GST-Swf1-C and Freund's incomplete adjuvant were administered 3 wk after the initial injection. Bleeds were collected 10 d after each injection and screened for immunoreactivity against Swf1p in whole cell lysates of wild-type yeast (DDY1102). A strain lacking Swf1p (KKY1060) was used as a control. Immunoreactivity was first detected in lysates at week 10. Exsanguination occurred at week 16.
The purification of antibodies against Swf1p proceeded in two steps. First, antibodies against GST were depleted from serum by affinity chromatography, by using a GST column prepared as described in Kozminski et al. (2000)
. Depletion was confirmed by probing dot blots of recombinant GST with crude serum or with the eluate of the GST column. Second, serum depleted of antibodies against GST and diluted 1:50 in Tris-buffered saline containing 1 mg/ml BSA was preabsorbed three times, at room temperature for 2 h each, against nitrocellulose filters containing whole cell lysates of a swf1
/swf1
strain KKY1060.
Fluorescence Microscopy
Cells prepared for direct or indirect fluorescence microscopy were observed with epifluorescence on a Nikon E800 microscope equipped with a 100x/1.3 Plan Neofluar objective. Images were captured with an Orca 100ER digital camera (Hamamatsu Photonics, Hamamatsu City, Japan) and Openlab software (Improvision, Lexington, MA). Unless otherwise noted, exposure and contrast enhancement were constant and linear for each image series.
Cells were prepared for indirect immunofluorescence microscopy as described in Kozminski et al. (2000
, 2006)
, except when cells were probed with antibody against Tpm1p or Cdc11p. In those cases, methanol and acetone replaced SDS at the permeabilization step per the method of Pringle et al. (1989)
. Polyclonal rabbit antibodies against Swf1p (this study), Cdc42p (Kozminski et al., 2000
), GFP (Abcam, Cambridge, MA), Tpm1p (Pruyne et al., 1998
), and Cdc11p (Santa Cruz Biotechnology, Santa Cruz, CA) were used at 1:100, 1:625, 1:1000, 1:50, and 1:300, respectively. Guinea pig polyclonal antibody against yeast actin (Palmgren et al., 2001
) was used at 1:250. Secondary antibodies goat anti-rabbit Alexa 568-conjugated (Invitrogen, Carlsbad, CA), goat anti-rabbit fluorescein isothiocyanate (FITC)-conjugated (Jackson ImmunoResearch Laboratories, West Grove, PA), and donkey anti-guinea pig rhodamine-conjugated (Jackson ImmunoResearch Laboratories) were used at 1:50 per the manufacturers' instructions.
Actin localization in fixed cells by using rhodamine-conjugated phalloidin (Invitrogen) followed a modified method of Adams and Pringle (1991)
. One milliliter of mid-log phase yeast culture was fixed for 20 min at room temperature with 5% (vol/vol) formaldehyde. Cells were pelleted in a microfuge for 1 min at 8000 x g, washed twice with 1 ml of PBS, and then resuspended in PBS containing 0.1% (vol/vol) Triton X-100 for 4 min at room temperature. Detergent was removed with two additional PBS washes. Pelleted cells were resuspended in 2.2 µM rhodamine-conjugated phalloidin in PBS and incubated 2 h in the dark at room temperature. To remove excess rhodamine-conjugated phalloidin, stained cells were washed three times with 1 ml of PBS containing 0.1% (vol/vol) Triton X-100. After the last wash, cells were resuspended in 10–20 µl of mounting medium. Then, 3–4 µl of stained cell suspension was applied to a slide, after which a coverslip was affixed with nail polish.
The staining of bud scars with Calcofluor White (Fluorescent Brightner 28; Sigma-Aldrich, St. Louis, MO) followed the method of Pringle (1991)
.
Immunoblotting
Immunoblotting was performed as described in Kozminski et al. (2000
, 2006)
. Swf1p was detected with purified anti-Swf1p antibodies diluted 1:1000. Tubulin served as a loading control and was detected with AA2, a mouse monoclonal antibody raised against amino acids 412–430 of bovine brain β-tubulin (gift of A. Frankfurter, University of Virginia), diluted to 130 ng/ml.
Assays of Actin Dynamics
To compare the sensitivity of yeast to latrunculin A (LatA), halo assays were performed. For each strain tested, an overnight culture grown in rich medium was diluted to 0.1 OD600 and plated on rich medium. After aspiration of excess culture, plates were dried for 1 h. Each of three different concentrations of LatA (BIOMOL Research Laboratories, Plymouth Meeting, PA), serially diluted with dimethyl sulfoxide, was spotted (10 µl) onto 6-mm concentration disks (B231039; Fisher Scientific, Sparks, MD), which were then placed on the lawn of cells. Plates were incubated at 25° for 2 d. The diameter of the zone of no growth around each disk was measured and used to calculate the relative apparent sensitivity of each strain to LatA following the method of Reneke et al. (1988)
.
To compare the turnover of actin filaments in vivo among different yeast strains, the method of Lappalainen and Drubin (1997)
was used. Briefly, log-phase cultures grown in rich medium at 25°C were diluted to 0.4 OD600. LatA was then added to each 0.4-ml culture to 0.4 mM final. At 0, 2, and 6 min post-LatA addition, a 125-µl aliquot of each culture was fixed with 4.4% (vol/vol) paraformaldehyde for 20 min at room temperature. Fixed cells were then stained with 6.6 µM rhodamine-phalloidin (Invitrogen) in methanol and imaged as described above.
Actin Binding Assays
To determine whether the C-terminal domain of Swf1p binds filamentous actin (F-actin), a supernatant depletion assay (Mullins et al., 1997
) was performed. For 200-µl reactions, rabbit muscle F-actin (kind gift of Dr. D. Schafer, University of Virginia) in MKEI-50 (20 mM imidazole-KOH, pH 7.0, 50 mM KCl, 2 mM MgCl2, and 1 mM EGTA) was diluted to a final concentration between 15 and 0.15 µM in MKEI-50 containing 0.5x G buffer (2 mM Tris-Cl, pH 8.0, 0.2 mM ATP, 0.2 mM CaCl2, 0.1 mM DTT, and 0.005% NaN3). Then, 2 µl of GST-Swf1-Cp in PBS containing 10% glycerol and 0.1 mM DTT was mixed into each reaction to give a final fusion protein concentration of 1.5 µM. Reactions were incubated 1 h at room temperature and then ultracentrifuged at 70,000 rpm in a TLA120.1 rotor for 60 min at 4°C. The top 120 µl of supernatant was collected from each reaction and mixed with 40 µl of 4x protein sample buffer (4% SDS, 20% glycerol, 0.2M Tris-Cl, pH 7.0, 4 mM EDTA, 0.16 M DTT, and 0.2 mg/ml bromphenol blue). Equivalent volumes were then analyzed on a 13% SDS-PAGE gel stained with Coomassie Blue.
To determine whether the C-terminal domain of Swf1p binds G-actin, a pyrene–actin assembly assay was performed. For a 200-µl reaction, 16 µM rabbit muscle G-actin (5% pyrene-labeled; kind gift of Dr. D. Schafer) in G buffer was diluted to 4 µM in MKEI-50 containing 0.6x G buffer. Then, 10 µl of GST-Swf1-Cp in PBS containing 10% glycerol and 0.1 mM DTT (or buffer alone) was mixed into the reaction. Fluorescence intensity over time at 25°C was measured immediately using a QuantaMaster fluorometer (Photon Technology International, Birmingham, NJ).
| RESULTS |
|---|
|
|
|---|
To begin to understand how SWF1 functions in the process of polarized cell growth, we first examined haploid and diploid strains lacking SWF1. We found that haploid cells with a SWF1 deletion doubled in log phase culture at 25°C at one third to one half the rate measured for congenic wild-type cells. A difference in doubling rate was also observed on solid media, in which haploid swf1
and homozygous diploid swf1
/swf1
cells formed smaller colonies than wild-type cells (Figure 1A). This slower rate of growth was not due a partial block at a specific cell cycle phase, but rather it seemed to be due to a slower rate of bud growth in the mutant cells relative to wild-type cells. Asynchronous cultures of the haploid wild-type and swf1
strains contained a very similar morphological distribution of cells throughout the cell cycle, as assayed by a visual scoring of bud size (Supplemental Table 1). The only notable difference between these cultures was that the swf1
culture contained fewer unbudded cells than the wild-type culture, 30 versus 43%, respectively. A similar, but smaller difference, was also observed in asynchronous cultures of the wild-type and homozygous swf1
/swf1
diploid cells (Supplemental Table 1). Consistent with a bud growth defect rather than a bud emergence defect, swf1
and SWF1 haploid cells initiated bud emergence at approximately the same time after release from
-factor arrest (Supplemental Figure 1). The swf1
growth phenotype was recessive; a heterozygous (swf1
/SWF1) diploid strain grew at the same rate as a congenic wild-type (SWF1/SWF1) strain (Figure 1A). Calcofluor staining did not reveal any defects in bud site selection in the mutant cells (data not shown).
|
was absent, in haploid cells, in combination with cdc42-118 (Figure 1B). Mutations that have a synthetic interaction with cdc42-118 often show the same interaction with cdc42-101, an allele that also confers a temperature-conditional polarized growth defect in G1 of the cell cycle. Surprisingly, deletion of SWF1 suppressed the growth defect of cdc42-101 at restrictive temperature (Figure 1B). In addition, swf1
was found synthetic lethal with cdc42-129, an allele that inhibits the G2/M switch from apical-to-isotropic bud growth. These synthetic genetic interactions did not seem to be an additive effect. That is, synthetic sickness between swf1
and temperature-conditional alleles of CDC42 did not correlate with the restrictive temperature range of the cdc42 alleles (Figure 1B). Although the molecular basis for the specificity of these genetic interactions is unknown, these results indicated that SWF1 functions in or in parallel with one or more CDC42-dependent pathways that regulate polarized cell growth.
SWF1 Is Required for Proper Polarized Cell Growth and Regulates Actin
The genetic interaction found between SWF1 and CDC42 and the dependency of SNARE palmitoylation upon Swf1p in vivo (Valdez-Taubas and Pelham, 2005
) suggested that SWF1 is necessary for proper polarized cell growth. Consistent with this prediction, we found that both haploid and diploid cells lacking SWF1 displayed an aberrant morphology. In comparison with wild-type cells, swf1
haploid cells seemed rounder (see cell with asterisk in Figure 1C). Diploids homozygous for swf1
(Figure 1C) but not heterozygous (data not shown) displayed a similar mutant morphology. The aberrant thickening of the neck was especially noticeable in mutant diploid cells, along with fragmentation of the vacuole, which was less apparent in swf1
haploid cells (Figure 1C).
To determine whether cells lacking SWF1 are defective in cell polarization, as implied by the genetic interactions between swf1
and cdc42-118ts, we used the cell cycle-dependent organization of the cortical actin cytoskeleton as a readout for cell polarization. In unbudded wild-type cells in late G1, cortical actin patches are concentrated at the incipient bud site. In S and G2 phases of the cell cycle, cortical actin patches are found at the apical tip of small- and medium-sized buds, with actin cables running parallel to the mother-bud axis (Figure 2A, left). This pattern of cytoskeletal organization was significantly different in swf1
haploid cells (Figure 8A, top right) and swf1
/swf1
diploid cells (Figure 2A, right). Actin patches were no longer found polarized at the apical bud tip in mutant cells to the extent found in wild-type cells (Figure 2A). Rather, in swf1
/swf1
cells, actin patches were found distributed throughout mother cells and buds, often in greatest concentration at the bud neck. Only 58% of small- and medium-budded mutant cells had properly polarized actin patches, in comparison with 100% of the budded wild-type cells (Figure 2B). In mutant cells, loss of cell polarization was not restricted to one phase of the cell cycle. Only 18% of unbudded swf1
/swf1
cells, grown in rich medium, displayed polarization of the cortical actin cytoskeleton, in comparison with 62% of wild-type cells grown under the same conditions (Figure 2B). Consistent with a previous report (Bonangelino et al., 2002
), actin cables were difficult to observe, if observed at all, in both swf1
haploid and homozygous diploid mutants (Figures 8A and 2, A and C, respectively). When actin cables were observed in mutant cells, they seemed short and very thin compared with those observed in wild-type cells (Figure 2, A and C). Cables rarely ran the complete length of the mother cell in cells lacking SWF1, although they were frequently found to extend from bud site to opposite pole in wild-type cells. These differences were accentuated when cables were visualized independently of actin patches (Figure 2C), by using an antibody against tropomyosin (Tpm1p), an F-actin binding protein that associates exclusively with actin cables (Pruyne et al., 1998
). These results indicate that SWF1 is necessary for proper cell polarization and actin organization.
|
strain for sensitivity to the drug LatA. Cells that rapidly turnover F-actin structures are known to be hypersensitive to LatA (Ayscough et al., 1997
cells are hypersensitive to LatA. The zone of no colony growth around LatA-impregnated filter disks was of greater diameter on a lawn of swf1
cells than on a lawn of wild-type cells (Figure 3A). We calculated the relative apparent LatA sensitivity of the swf1
to be two- to threefold greater than that of wild-type cells. To determine whether actin is indeed rapidly turning over in vivo in the absence of Swf1p, we performed a microscopic LatA sensitivity assay. swf1
and wild-type cultures were incubated briefly with 400 µM LatA. Aliquots of these cultures were fixed post-LatA addition at 0 min (the time to draw an aliquot and add fixative), 2 min, and 6 min, and then they were processed with rhodamine-phalloidin to visualize F-actin patches by fluorescence microscopy (Figure 3B). Figure 8A shows that in the absence of LatA wild-type and swf1
cells have a similar number of cortical F-actin patches. By 2 min post-LatA addition, actin patches were no longer observed in LatA-treated swf1
cells, although actin patches were observed readily in LatA-treated wild-type cells at this time point (Figure 3B). Thus, it seems that Swf1p slows actin turnover in vivo and that the organizational defects of the actin cytoskeleton in cells lacking SWF1 may be due to altered actin dynamics.
|
40 kDa, which is the predicted molecular weight of Swf1p and consistent with the migration of myc-tagged Swf1p in SDS-PAGE gels (Ohno et al., 2006
40 kDa was detectable in whole cell lysates of wild-type cells but not of mutant cells lacking SWF1 (Figure 4B). Even with purification, the antibody we raised against Swf1p exhibited cross-reactivity with other polypeptides on immunoblots. Such cross-reactivity, however, was not apparent in cells prepared for indirect immunofluorescence microscopy. On probing wild-type haploid (data not shown) and diploid (data shown) cells with purified Swf1-C antibody, we found that Swf1p localizes primarily to small cortical puncta (Figure 4C, left). A faint filamentous fluorescent signal was also observed in some cells (arrowheads in Figure 4C). Neither localization pattern was observed in cells lacking Swf1p (Figure 4C, right). The Swf1p localization pattern was consistent among our laboratory strains as well as in a BY4742-derived diploid (KKY1120; data not shown). As with our localization of GFP-Swf1p, antibody against Swf1p did not detect an accumulation of Swf1p in the cell body suggestive of an accumulation at the endoplasmic reticulum.
|
To determine whether Swf1p binds actin directly, we tested whether the C-terminal region (residues 235–336) of Swf1p, which is predicted to be cytoplasmic (Politis et al., 2005
), bound F- or G-actin. Due to protein instability, we were unable to assay recombinant full-length Swf1p. In a supernatant depletion assay, we found that the Swf1p C-terminal domain when fused to GST (GST-Swf1-Cp) did not cosediment with F-actin in a concentration-dependent manner (Supplemental Figure 3A). In a pyrene–actin assembly assay, we found that GST-Swf1-Cp in molar excess to G-actin did not affect actin assembly (Supplemental Figure 3B). Both of these results indicate that the C-terminal domain of Swf1p, when bound to GST, is unable to bind either F- or G-actin, suggesting that Swf1p does not bind actin directly.
Cdc42p Mislocalizes in the Absence of Swf1p
Next, we examined whether the localization of Cdc42p depends upon Swf1p. Cdc42p sits atop a hierarchy of signal transduction events that lead to polarized cell growth (Park and Bi, 2007
). Localization of Cdc42p at the incipient bud site in unbudded cells or at the apical bud cortex in small- and medium-budded cells is necessary for proper cell polarization (Ziman et al., 1991
). Both the genetic interactions observed between SWF1 and CDC42 and the loss of cytoskeletal polarity in swf1
and swf1
/swf1
mutants suggested that Cdc42p depends upon Swf1p for proper localization. We found little difference in Cdc42p localization in unbudded and small-budded wild-type and swf1
cells (Figure 5). Among small-budded cells, 100 and 92% of wild-type and swf1
cells, respectively, showed proper Cdc42p localization on the bud cortex. However, a significant difference was observed with medium-budded cells (Figure 5B). We found that 97% of medium-budded wild-type cells had proper Cdc42p localization on the bud cortex, whereas only 13% of the medium-budded swf1
cells had properly localized Cdc42p (Figure 5B). In mutant cells, Cdc42p localized normally to the apical bud tip but also abnormally to large patches within the mother cell, proximal to the mother-bud neck (Figure 5A). Similar localization patterns were found in homozygous swf1
diploid cells as well (Figure 5A). These data indicate that the polarized localization of Cdc42p is dependent upon Swf1p during a specific phase (S/G2) of the cell cycle.
|
Cells Are Defective in Secretion and Accumulate Vesicles
cells are defective in polarized secretion. First, thin section electron microscopic analysis revealed an accumulation of 80- to 100-nm vesicles in the buds of two independently derived swf1
strains, KKY1063 (Figure 6, bottom) and 1-7-11 (data not shown; BY4742 background). Accumulation of 80- to 100-nm vesicles is a signature phenotype of impaired exocytosis. For example, sec6-4ts cells, which served as our positive control for detecting secretory vesicles in thin section, have a tight exocytotic block at 37°C (Novick et al., 1980
strain, in which vesicles accumulated in the buds, few if any vesicles were observable in the buds of wild-type cells (Figure 6, top left). As with the wild-type strain, the mother cells of the swf1
strain did not contain an accumulation of vesicles. These results indicate that SWF1 is not required for vesicle transport to the bud and strongly suggest that SWF1 is necessary for efficient exocytosis from the bud.
|
cells are defective in polarized secretion, we found an internal accumulation of β-1,3-glucanase (Bgl2p) in swf1
cells (Figure 7). Bgl2p is a cell wall remodeling enzyme that is secreted to the plasma membrane (Harsay and Bretscher, 1995
cells, Bgl2p accumulated to the level observed in sec6-4ts grown at 37°C. This accumulation was not temperature dependent. The results of this Bgl2p assay and our electron microscopy data indicate that swf1
cells have a defect in polarized secretion, occurring late in the secretory pathway.
|
phenotypes such as the inability of swf1
cells to grow on lactate. This observation suggested that Swf1p has multiple distinct functions. Because of this observation, we asked whether the ability of Swf1p to promote the polarization of the actin cytoskeleton was dependent on the DHHC motif. Earlier studies demonstrated that substitution of cysteine in the DHHC motif with alanine abolished the palmitoyltransferase (PT) activity of DHHC-CRD family palmitoyltransferases (Lobo et al., 2002
cells. We found that cells expressing Swf1-DHHAp had a wild-type morphology and that the actin cytoskeleton remained polarized, similar to cells expressing Swf1-DHHCp (Figure 8, A and B). Likewise little variation in actin polarization was observed among populations of unbudded cells. In the same experiment, we tried to compare actin polarization in cells expressing Swf1-DHHAp to that found in a swf1
strain containing only vector. We found, however, that liquid minimal medium did not support the growth of swf1
cells containing an empty vector. Therefore, cells expressing Swf1-DHHAp were compared with a swf1
strain and a SWF1 strain grown in rich medium. The number of Swf1-DHHCp and Swf1-DHHAp transformants with a polarized actin cytoskeleton closely resembled that of SWF1 cells, indicating that expression of SWF1 from a plasmid did not affect its function. Together, these results showed that the DHHC motif of Swf1p is not necessary for promoting the polarized organization of the actin cytoskeleton.
|
Wild-type actin organization in cells expressing only Swf1-DHHAp implied that the DHHC motif is not necessary for the proper localization of Cdc42p at sites of polarized growth. To test whether Cdc42p, a key regulator of actin organization at polarized growth sites, localized properly in cells with a DHHA motif, we probed cells expressing either Swf1-DHHCp or Swf1-DHHAp with an antibody against Cdc42p. We found a wild-type pattern of Cdc42p localization in cells expressing Swf1-DHHAp (Figure 8D). Therefore, the Swf1p DHHC motif is not necessary for the proper localization of Cdc42p.
Loss of the Swf1p DHHC Motif Differentially Affects Secretion
Because abnormalities were not observed in the organization or dynamics of the actin cytoskeleton in cells expressing Swf1p with a mutated DHHC motif (DHHA), we asked whether the secretion of Bgl2p was blocked in these mutant cells. That is, we sought to determine whether the secretion defect in swf1
cells was due to a change in the actin cytoskeleton or due to a change in the palmitoylation state of SNAREs. To address this question, we first assayed Bgl2p secretion in cells expressing no Swf1p (swf1
), wild-type Swf1p (DHHC), or Swf1p with a mutated DHHC motif (DHHA). As a control for Bgl2p secretion, we included a sec6-4ts strain in our analysis. This strain is temperature-conditional for secretion and accumulates Bgl2p internally after shift from 25 or 37°C (Harsay and Bretscher, 1995
). We found that at both 25 or 37°C, the amount of Bgl2p that accumulated internally in swf1-DHHA cells, which display no actin defects, was very similar to the amount of Bgl2p that accumulated in wild-type cells (Figure 8E). Furthermore, the amount of Bgl2p that accumulated internally in cells expressing either wild-type (DHHC) or mutant (DHHA) Swf1p was much lower than the amount of Bgl2p in swf1
cells, which lack Swf1p entirely. These results indicate that Swf1p DHHC motif is not necessary for Bgl2p secretion and suggest that the defect in Bgl2p secretion in swf1
cells may result from a defect in actin organization.
Wild-type Bgl2p secretion in cells with a mutated Swf1p DHHC motif contradicted the idea that the DHHC motif, and by inference Swf1p PT activity, is physiologically relevant to secretion. To determine whether the Swf1p DHHC motif is relevant to any type of secretion as predicted from the ability of Swf1p to palmitoylate specific SNAREs, we performed an additional secretion assay. With the same strains used for the Bgl2p assay described above, we assayed the secretion of invertase (Table 3). We found that deletion of SWF1 impaired secretion at 25°C, in comparison with wild-type (Student's t test, p = 0.06). Transformation of swf1
cells with a plasmid containing wild-type SWF1 rescued the mutant phenotype. Therefore, no significant difference in invertase secretion was observed whether Swf1p was expressed from a low copy plasmid (+ DHHC) in a swf1
strain or from a chromosomal copy of the gene (SWF1). In contrast, the swf1
phenotype with respect to invertase secretion was not rescued by plasmid-borne swf1-DHHA. The average ratio of secreted invertase to total invertase in cells expressing Swf1p without a DHHC motif (swf1
+ DHHA) was significantly less (Student's t test, p = 0.01) than that measured for cells expressing wild-type Swf1p (swf1
+ DHHC), 0.64 versus 0.77, respectively. None of the swf1 mutants showed a secretory block as severe as that of sec6-4 cells shifted from 25to 37°C, in which the average ratio of secreted to total invertase fell from 0.82 to 0.13. Together, these data demonstrate that cells expressing Swf1p without a DHHC motif are defective in secretion in the invertase-marked secretory pathway, but not the Bgl2p-marked pathway.
|
double mutants that contained an empty plasmid vector with those that contained plasmid-borne swf1-DHHA (Figure 9). Double mutant strains that contained plasmid-borne wild-type SWF1 defined the temperature range of individual cdc42ts alleles under the growth conditions used.
|
synthetic genetic interactions (Figure 9). A cdc42-118 swf1
strain that contained plasmid-borne swf1-DHHA exhibited the same permissive temperature range for growth as one with an empty vector. A similar result was observed with cdc42-129. Because cdc42-129 and swf1
are lethal in combination (Figure 1B), we asked whether we could recover viable double mutants with plasmid-borne swf1-DHHA, upon sporulation of a double heterozygote transformed with a plasmid containing swf1-DHHA. We found that we were unable to recover, after meiosis at 25°C, cdc42-129 swf1
progeny with either empty vector or plasmid-borne swf1-DHHA. In contrast, cdc42-129 swf1
progeny with plasmid-borne SWF1 were easily recoverable. These data indicate that the DHHC motif is functionally relevant to at least one growth-related function of Cdc42p.
In the converse case, where swf1
suppresses rather than exacerbates a cdc42 temperature-sensitive growth defect, we observed that a cdc42-101 swf1
strain that contained plasmid-borne swf1-DHHA exhibited the same permissive temperature range for growth as a strain with plasmid-borne wild-type SWF1. Although equivalent growth of a cdc42 swf1
mutant containing either swf1-DHHA or wild-type SWF1 would normally indicate that a functional DHHC motif is not required for the rescue of the double mutant growth phenotype, it is important to note that the double mutant in this case has an expanded growth range. This result suggests that a part of Swf1p, other than the DHHC motif, counterbalances a Cdc42p function related to growth.
| DISCUSSION |
|---|
|
|
|---|
GTPase localization, cytoskeletal polarization, and vesicle trafficking are intimately related processes that are necessary for proper polarized cell growth in yeast (Park and Bi, 2007
). In unbudded G1 cells, the localization and activation of Cdc42p at the incipient bud site is essential for the polarized organization of the actin cytoskeleton (Sloat et al., 1981
; Adams et al., 1990
; Ziman et al., 1991
, 1993
; Gulli et al., 2000
; Richman and Johnson, 2000
) and the establishment of polarized secretion (Adamo et al., 2001
; Zhang et al., 2001
; Roumanie et al., 2005
; Zajac et al., 2005
). In small- and medium-budded cells, in S and G2/M, respectively, the maintenance of Cdc42p localization at the bud tip depends upon a properly polarized actin cytoskeleton and polarized secretion. Mutations or drugs that disrupt either process disrupt the polarized distribution of Cdc42p (Wedlich-Soldner et al., 2003
; Irazoqui et al., 2005
; Zajac et al., 2005
). With few unbudded and small-budded swf1
and swf1
/swf1
cells displaying a loss of cytoskeletal organization or Cdc42p polarization, relative to medium-budded cells, we conclude that Swf1p does not affect the process of establishing an axis of polarized growth early in the cell cycle. Rather our data suggest that Swf1p functions, with respect to polarized cell growth, after bud emergence as part of the cellular mechanism that maintains a polarized distribution of Cdc42p during bud growth.
Thus far, our data are unable to reveal unequivocally in which process Swf1p acts primarily to promote polarized growth. For example, a loss of polarized secretion in swf1
mutants may result from an aberrant organization of the actin cytoskeleton, as is known to occur in tpm1-2 tpm2 mutants (Pruyne et al., 1998
). It is also possible that Swf1p functions in more than one process required for polarized cell growth, as suggested by the inability of cdc42-DHHA to rescue all cdc42ts swf1
synthetic growth phenotypes. The identification of SWF1 in multiple independent screens (Bartels et al., 1999
; Bonangelino et al., 2002
; Enyenihi and Saunders, 2003
) shows that Swf1p can function in multiple processes (e.g., trafficking to the vacuole, spore wall formation). Taking these data and our own into consideration, the actin cytoskeleton stands out as a common denominator. Therefore, what may seem to be independent processes during polarized cell growth may be due to a single Swf1p activity affecting the actin cytoskeleton. In addition to our data that show Swf1p regulates the actin cytoskeleton, it should not be forgotten that SWF1 was first reported as a gene that is synthetic lethal with a hypomorphic, although undesignated, allele of PFY1 (Bartels et al., 1999
). PFY1 encodes profilin, a protein that regulates actin dynamics (Jockusch et al., 2007
). We infer from the literature that the allele used in this screen was pfy1-111 (Haarer et al., 1996
). We have independently confirmed (our unpublished observations) this genetic interaction by using pfy1-4, an allele that encodes a mutant profilin defective in actin monomer binding (Wolven et al., 2000
), whereas finding, within additional although small data sets, no synthetic lethality between swf1
and PFY1 alleles specifically defective in functions other than actin monomer binding (e.g., binding to formin homology domain-containing proteins). Because synthetic genetic interactions often reveal a common function between proteins, we must consider whether Swf1p like Pfy1p binds actin monomers. Such biochemical activity is unlikely because Swf1p does not contain any known actin binding motifs. The region of Swf1p most likely to bind actin is the long C-terminal tail, which based on a membrane-spanning topology model of the DHHC-CRD protein Akr1p (Politis et al., 2005
) is predicted to be cytoplasmic. We did not find that this C-terminal region binds actin directly. Therefore, it is more probable that the ability of Swf1p to regulate the actin cytoskeleton is by way of protein intermediates. Analogy may be drawn from membrane-anchored cytoskeletons in metazoans, in which Band 4.1 protein and Ezrin/radixin/moesin proteins link ion channels and CD44, respectively, to cortical actin filaments (Denker and Barber, 2002
) or in yeast, where during receptor mediated-endocytosis receptors are linked to the actin cytoskeleton by way of Sla1p or the epsin-related proteins Ent1/2p (Engqvist-Goldstein and Drubin, 2003
).
Because profilin is a potent regulator of actin dynamics, it is tempting to speculate that the actin organization defects in swf1
cells is due to a perturbation of actin dynamics as has been observed in cells expressing mutant profilin (Wolven et al., 2000
). Consistent with this idea, we noted, as in a previous study (Bonangelino et al., 2002
), the paucity of actin cables in swf1
cells. We also observed a more rapid turnover of F-actin structures in swf1
cells in vivo in the presence of LatA. However, caution needs to be applied to the interpretation that Swf1p regulates actin dynamics. It is possible that the secretory defect observed in swf1
cells has altered the permeability of the cell wall to LatA, relative to wild-type cells. We have, in fact, observed (our unpublished observation) a slight sensitivity of swf1
cells to Calcofluor White, indicative of a defect in cell wall formation (Roncero et al., 1988
). Unknown is whether this cell wall defect increases cell permeability to LatA to a physiologically significant level. Conversely, it is possible that a defect in the actin cytoskeleton leads to defective wall formation and in turn increased sensitivity to LatA (Gabriel and Kopecka, 1995
). What is certain is that the organization, if not the dynamics, of the actin cytoskeleton depends upon Swf1p.
The localization of Swf1p to actin cables and patches is consistent with a role in the organization of the actin cytoskeleton. Why a predicted transmembrane protein is found on actin cables is not known. Cable-associated Swf1p may be derived from a pool of Swf1p associated with transport vesicles that move along actin cables or from a proteolytically processed domain of Swf1p (i.e., the C-terminal tail). Localization, however, is not proof of function at a particular locale. Localization at sites of endocytosis, for example, may solely reflect that Swf1p is concentrated at sites of endocytosis and is above the threshold of detection at these sites. It may be that Swf1p functions elsewhere. For example, Swf1p may function in endosomes or the late Golgi, where its substrate Tlg1p is known to reside (Lewis et al., 2000
; Prescianotto-Baschong and Riezman, 2002
). The appearance of Swf1p on the plasma membrane and subsequent endocytosis may be due to trafficking between endosomal compartments and the plasma membrane. In contrast, Valdez-Taubas and Pelham (2005)
reported a different localization for Swf1p, showing that a GFP-Swf1p fusion protein localizes to the endoplasmic reticulum (ER). We did not find a similar pattern of localization with our indirect immunofluorescence technique, even using the same strain background as Valdez-Taubas and Pelham (2005)
. We speculate that the observed differences in Swf1p localization may be reflective of protein expression levels. Valdez-Taubas and Pelham (2005)
drove expression of their tagged Swf1p with the strong constitutive TPI1 promoter, whereas expression of Swf1p and Swf1-GFP in our study relied upon the endogenous SWF1 promoter.
Our experiments directly showed that Swf1p has a role in secretion. During the course of our study, two independent investigations implicated Swf1p in secretion. In the first investigation, almost 40% (n = 26) of the genes identified in a synthetic lethal screen with swf1
by Tong et al. (2004)
encode proteins known to function in the Golgi or in post-Golgi trafficking pathways. In the second investigation, Valdez-Taubas and Pelham (2005)
showed that the palmitoylation of specific SNARE proteins depends upon Swf1p. In our study, we show that Swf1p is necessary for secretion along two different secretory pathways, one marked by invertase and the other marked by Bgl2p. In the absence of Swf1p, vesicles with a diameter signature of secretory vesicles accumulate in the bud, indicative of a block in late secretory pathway(s). These results are consistent with the study of Valdez-Taubas and Pelham (2005)
, which showed that Swf1p regulates the stability of the SNARE Tlg1p. When we expressed Swf1p with a mutated DHHC motif, invertase secretion was inhibited. Secretion along the Bgl2p-marked pathway, which is a secretory pathway that supports polarized cell growth, was not inhibited by mutation of the DHHC motif. These results provided several insights into Swf1p and polarized cell growth. First, secretion along the Bgl2p transport pathway, but not the invertase pathway, is independent of the Swf1p DHHC motif, indicating Swf1p has two distinct functions in regard to secretion. The data further suggest that the SNARE Tlg1p functions specifically within the invertase-marked secretory pathway. If, however, Tlg1p also functions within the Bgl2p-marked secretory pathway, it does so in a manner independent of the Swf1p DHHC motif. Second, in swf1 mutant cells, defects in the actin cytoskeleton correlate more closely with defects in Bgl2p-marked secretion than invertase secretion. As stated above, it has not yet been possible to distinguish in swf1 mutants whether a defect in Bgl2p secretion leads to an aberrant actin cytoskeleton or vice versa. What is clear is that Bgl2p-marked secretion and regulation of the actin cytoskeleton functions independently of the DHHC motif and, by inference, PT activity.
Palmitoylation is a posttranslational modification that contributes to the stability and trafficking of specific proteins (Linder and Deschenes, 2007
). When in the course of our study it became known that Swf1p contributes to PT activity (Valdez-Taubas and Pelham, 2005
), it became apparent to consider whether palmitoylation affected the intracellular distribution of Cdc42p. It is known the distribution of Ras between ER and plasma membrane depends upon the compartment specific palmitoylation of the G protein (Rocks et al., 2005
). Furthermore, sequence analysis predicts the palmitoylation of two S. cerevisiae proteins necessary for proper polarized cell growth, Rho1p and Rho3p (Roth et al., 2006
). These GTPases are in the same family as Cdc42p. Unlike Rho1 and Rho3, Cdc42p does not have an identifiable palmitoylation site. More importantly, we found that the distribution of Cdc42p in cells with a mutated DHHC motif was indistinguishable from that of cells expressing wild-type Swf1p. Therefore, it does not seem that the polarized localization of Cdc42p at the plasma membrane is dependent on palmitoylation.
Swf1p is among the family of seven transmembrane proteins in S. cerevisiae that contain a DHHC-CRD domain (Linder and Deschenes, 2007
). It remains to be seen whether other DHHC-CRD proteins have a role in polarized cell growth, especially the regulation of the actin cytoskeleton. It is intriguing that no other genes that encode DHHC-CRD proteins were found in the synthetic genetic array screen that identified SWF1 as CDC42-interacting, suggesting that the promotion of polarized cell growth may be a specific function of SWF1. In this regard, we have not tested directly the other DHHC-family members. Identifying the complete range of Swf1p functions and that of other DHHC-CRD family members, although outside the scope of the current study, remains an important goal, considering the conservation of the DHHC-CRD protein family among plants, animals, and fungi (Putilina et al., 1999
; Linder and Deschenes, 2003
; Mitchell et al., 2006
).
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Address correspondence to: Keith G. Kozminski (kkoz{at}virginia.edu)
Abbreviations used: LatA, latrunculin A; PT, palmitoyltransferase.
| REFERENCES |
|---|
|
|
|---|
Adams, A. E., and Pringle, J. R. (1991). Staining of actin with fluorochrome-conjugated phalloidin. Methods Enzymol 194, 729–731.[Medline]
Adams, A. E. M., Johnson, D. I., Longnecker, R. M., Sloat, B. F., and Pringle, J. R. (1990). CDC42 and CDC43, two additional genes involved in budding and the establishment of cell polarity in the yeast Saccharomyces cerevisiae. J. Cell Biol 111, 131–142.
Alberts, P., Rudge, R., Irinopoulou, T., Danglot, L., Gauthier-Rouviere, C., and Galli, T. (2006). Cdc42 and actin control polarized expression of TI-VAMP vesicles to neuronal growth cones and their fusion with the plasma membrane. Mol. Biol. Cell 17, 1194–1203.
Ayscough, K. R., Stryker, J., Pokala, N., Sanders, M., Crews, P., and Drubin, D. G. (1997). High rates of actin filament turnover in budding yeast and roles for actin in establishment and maintenance of cell polarity revealed using the actin inhibitor latrunculin-A. J. Cell Biol 137, 399–416.
Bankaitis, V. A., Malehorn, D. E., Emr, S. D., and Greene, R. (1989). The Saccharomyces cerevisiae SEC14 gene encodes a cytosolic factor that is required for transport of secretory proteins from the yeast Golgi complex. J. Cell Biol 108, 1271–1281.
Bartels, D. J., Mitchell, D. A., Dong, X., and Deschenes, R. J. (1999). Erf2, a novel gene product that affects the localization and palmitoylation of Ras2 in Saccharomyces cerevisiae. Mol. Cell Biol 19, 6775–6787.
Belmont, L. D., and Drubin, D. G. (1998). The yeast V159N actin mutant reveals roles for actin dynamics in vivo. J. Cell Biol 142, 1289–1299.
Belmont, L. D., Patterson, G. M., and Drubin, D. G. (1999). New actin mutants allow further characterization of the nucleotide binding cleft and drug binding sites. J. Cell Sci 112, 1325–1336.[Abstract]
Bonangelino, C. J., Chavez, E. M., and Bonifacino, J. S. (2002). Genomic screen for vacuolar protein sorting genes in Saccharomyces cerevisiae. Mol. Biol. Cell 13, 2486–2501.
Brachmann, C. B., Davies, A., Cost, G. J., Caputo, E., Li, J., and Boeke, J. D. (1998). Designer deletion strains derived from Saccharomyces cerevisiae 288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 14, 115–132.[CrossRef][Medline]
Denker, S. P., and Barber, D. L. (2002). Ion transport proteins anchor and regulate the cytoskeleton. Curr. Opin. Cell Biol 14, 214–220.[CrossRef][Medline]
Ducker, C. E., Stettler, E. M., French, K. J., Upson, J. J., and Smith, C. D. (2004). Huntingtin interacting protein 14 is an oncogenic human protein: palmitoyl acyltransferase. Oncogene 23, 9230–9237.[Medline]
Engqvist-Goldstein, A. E., and Drubin, D. G. (2003). Actin assembly and endocytosis: from yeast to mammals. Annu. Rev. Cell Dev. Biol 19, 287–332.[CrossRef][Medline]
Enyenihi, A. H., and Saunders, W. S. (2003). Large-scale functional genomic analysis of sporulation and meiosis in Saccharomyces cerevisiae. Genetics 163, 47–54.[Medline]
Etienne-Manneville, S. (2004). Cdc42—the centre of polarity. J. Cell Sci 117, 1291–1300.
Fukata, M., Fukata, Y., Adesnik, H., Nicoll, R. A., and Bredt, D. S. (2004). Identification of PSD-95 palmitoylating enzymes. Neuron 44, 987–996.[CrossRef][Medline]
Gabriel, M., and Kopecka, M. (1995). Disruption of the actin cytoskeleton in budding yeast results in formation of an aberrant cell wall. Microbiology 141, 891–899.
Garvalov, B. K., Flynn, K. C., Neukirchen, D., Meyn, L., Teusch, N., Wu, X., Brakebusch, C., Bamburg, J. R., and Bradke, F. (2007). Cdc42 regulates cofilin during the establishment of neuronal polarity. J. Neurosci 27, 13117–13129.
Gietz, R. D., and Sugino, A. (1988). New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74, 527–534.[CrossRef][Medline]
Goldstein, A., and Lampen, J. O. (1975). Beta-D-fructofuranoside fructohydrolase from yeast. Methods Enzymol 42, 504–511.[Medline]
Gulli, M. P., Jaquenoud, M., Shimada, Y., Niederhauser, G., Wiget, P., and Peter, M. (2000). Phosphorylation of the Cdc42 exchange factor Cdc24 by the PAK-like kinase Cla4 may regulate polarized growth in yeast. Mol. Cell 6, 1155–1167.[CrossRef][Medline]
Haarer, B. K., Corbett, A., Kweon, Y., Petzold, A. S., Silver, P., and Brown, S. S. (1996). SEC3 mutations are synthetically lethal with profilin mutations and cause defects in diploid-specific bud-site selection. Genetics 144, 495–510.[Abstract]
Harsay, E., and Bretscher, A. (1995). Parallel secretory pathways to the cell surface in yeast. J. Cell Biol 131, 297–310.
Harsay, E., and Schekman, R. (2007). Avl9p, a member of a novel protein superfamily, functions in the late secretory pathway. Mol. Biol. Cell 18, 1203–1219.
Hill, K. L., Catlett, N. L., and Weisman, L. S. (1996). Actin and myosin function in directed vacuole movement during cell division in Saccharomyces cerevisiae. J. Cell Biol 135, 1535–1549.
Holthuis, J. C., Nichols, B. J., Dhruvakumar, S., and Pelham, H. R. (1998). Two syntaxin homologues in the TGN/endosomal system of yeast. EMBO J 17, 113–126.[CrossRef][Medline]
Irazoqui, J. E., Howell, A. S., Theesfeld, C. L., and Lew, D. J. (2005). Opposing roles for actin in Cdc42p polarization. Mol. Biol. Cell 16, 1296–1304.
Isgandarova, S., Jones, L., Forsberg, D., Loncar, A., Dawson, J., Tedrick, K., and Eitzen, G. (2007). Stimulation of actin polymerization by vacuoles via Cdc42p-dependent signaling. J. Biol. Chem 282, 30466–30475.
Jockusch, B. M., Murk, K., and Rothkegel, M. (2007). The profile of profilins. Rev. Physiol. Biochem. Pharmacol 159, 131–149.[Medline]
Kozminski, K. G., Alfaro, G., Dighe, S., and Beh, C. T. (2006). Homologues of oxysterol-binding proteins affect Cdc42p- and Rho1p-mediated cell polarization in S. cerevisiae. Traffic 7, 1224–1242.[CrossRef][Medline]
Kozminski, K. G., Beven, L., Angerman, E., Tong, A. H., Boone, C., and Park, H. O. (2003). Interaction between a Ras and a Rho GTPase couples selection of a growth site to the development of cell polarity in yeast. Mol. Biol. Cell 14, 4958–4970.
Kozminski, K. G., Chen, A. J., Rodal, A. A., and Drubin, D. G. (2000). Functions and functional domains of the GTPase Cdc42p. Mol. Biol. Cell 11, 339–354.
Kroschewski, R., Hall, A., and Mellman, I. (1999). Cdc42 controls secretory and endocytic transport to the basolateral plasma membrane of MDCK cells. Nat. Cell Biol 1, 8–13.[CrossRef][Medline]
Lappalainen, P., and Drubin, D. G. (1997). Cofilin promotes rapid actin filament turnover in vivo. Nature 388, 78–82.[CrossRef][Medline]
Lewis, M. J., Nichols, B. J., Prescianotto-Baschong, C., Riezman, H., and Pelham, H. R. (2000). Specific retrieval of the exocytic SNARE Snc1p from early yeast endosomes. Mol. Biol. Cell 11, 23–38.
Linder, M. E., and Deschenes, R. J. (2003). New insights into the mechanisms of protein palmitoylation. Biochemistry 42, 4311–4320.[CrossRef][Medline]
Linder, M. E., and Deschenes, R. J. (2007). Palmitoylation: policing protein stability and traffic. Nat. Rev. Mol. Cell Biol 8, 74–84.[CrossRef][Medline]
Lobo, S., Greentree, W. K., Linder, M. E., and Deschenes, R. J. (2002). Identification of a Ras palmitoyltransferase in Saccharomyces cerevisiae. J. Biol. Chem 277, 41268–41273.
Longtine, M. S., McKenzie, A., 3rd, Demarini, D. J., Shah, N. G., Wach, A., Brachat, A., Philippsen, P., and Pringle, J. R. (1998). Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14, 953–961.[CrossRef][Medline]
Mitchell, D. A., Vasudevan, A., Linder, M. E., and Deschenes, R. J. (2006). Protein palmitoylation by a family of DHHC protein S-acyltransferases. J. Lipid Res 47, 1118–1127.
Mullins, R. D., Stafford, W. F., and Pollard, T. D. (1997). Structure, subunit topology, and actin-binding activity of the Arp2/3 complex from Acanthamoeba. J. Cell Biol 136, 331–343.
Nelson, W. J. (2003). Adaptation of core mechanisms to generate cell polarity. Nature 422, 766–774.[CrossRef][Medline]
Novick, P., Field, C., and Schekman, R. (1980). Identification of 23 complementation groups required for post-translational events in the yeast secretory pathway. Cell 21, 205–215.[CrossRef][Medline]
Ohno, Y., Kihara, A., Sano, T., and Igarashi, Y. (2006). Intracellular localization and tissue-specific distribution of human and yeast DHHC cysteine-rich domain-containing proteins. Biochim. Biophys. Acta 1761, 474–483.[Medline]
Palmgren, S., Ojala, P. J., Wear, M. A., Cooper, J. A., and Lappalainen, P. (2001). Interactions with PIP2, ADP-actin monomers, and capping protein regulate the activity and localization of yeast twinfilin. J. Cell Biol 155, 251–260.
Park, H. O., and Bi, E. (2007). Central roles of small GTPases in the development of cell polarity in yeast and beyond. Microbiol. Mol. Biol. Rev 71, 48–96.
Peränen, J., Rikkonen, M., Hyvonen, M., and Kaariainen, L. (1996). T7 vectors with a modified T7lac promoter for expression of proteins in Escherichia coli. Anal. Biochem 236, 371–373.[CrossRef][Medline]
Politis, E. G., Roth, A. F., and Davis, N. G. (2005). Transmembrane topology of the protein palmitoyltransferase Akr1. J. Biol. Chem 280, 10156–10163.
Prescianotto-Baschong, C., and Riezman, H. (2002). Ordering of compartments in the yeast endocytic pathway. Traffic 3, 37–49.[CrossRef][Medline]
Pringle, J. R. (1991). Staining of bud scars and other cell wall chitin with calcofluor. Methods Enzymol 194, 732–735.[Medline]
Pringle, J., Preston, R., Adams, A., Stearns, T., Drubin, D., Haarer, B., and Jones, E. (1989). Fluorescence microscopy methods for yeast. Methods Cell Biol 31, 357–435.[Medline]
Pruyne, D. W., Schott, D. H., and Bretscher, A. (1998). Tropomyosin-containing actin cables direct the Myo2p-dependent polarized delivery of secretory vesicles in budding yeast. J. Cell Biol 143, 1931–1945.
Putilina, T., Wong, P., and Gentleman, S. (1999). The DHHC domain: a new highly conserved cysteine-rich motif. Mol. Cell Biochem 195, 219–226.[CrossRef][Medline]
Reneke, J. E., Blumer, K. J., Courchesne, W. E., and Thorner, J. (1988). The carboxy-terminal segment of the yeast
-factor receptor is a regulatory domain. Cell 55, 221–234.[CrossRef][Medline]
Richman, T. J., and Johnson, D. I. (2000). Saccharomyces cerevisiae Cdc42p GTPase is involved in preventing the recurrence of bud emergence during the cell cycle. Mol. Cell Biol 20, 8548–8559.
Rocks, O., Peyker, A., Kahms, M., Verveer, P. J., Koerner, C., Lumbierres, M., Kuhlmann, J., Waldmann, H., Wittinghofer, A., and Bastiaens, P. I. (2005). An acylation cycle regulates localization and activity of palmitoylated Ras isoforms. Science 307, 1746–1752.
Roncero, C., Valdivieso, M. H., Ribas, J. C., and Duran, A. (1988). Isolation and characterization of Saccharomyces cerevisiae mutants resistant to Calcofluor white. J. Bacteriol 170, 1950–1954.
Roth, A. F., Feng, Y., Chen, L., and Davis, N. G. (2002). The yeast DHHC cysteine-rich domain protein Akr1p is a palmitoyl transferase. J. Cell Biol 159, 23–28.
Roth, A. F., Wan, J., Bailey, A. O., Sun, B., Kuchar, J. A., Green, W. N., Phinney, B. S., Yates, J. R., 3rd, and Davis, N. G. (2006). Global analysis of protein palmitoylation in yeast. Cell 125, 1003–1013.[CrossRef][Medline]
Roumanie, O., Wu, H., Molk, J. N., Rossi, G., Bloom, K., and Brennwald, P. (2005). Rho GTPase regulation of exocytosis in yeast is independent of GTP hydrolysis and polarization of the exocyst complex. J. Cell Biol 170, 583–594.
Salminen, A., and Novick, P. J. (1987). A ras-like protein is required for a post-Golgi event in yeast secretion. Cell 49, 527–538.[CrossRef][Medline]
Sloat, B. F., Adams, A., and Pringle, J. R. (1981). Roles of the CDC24 gene product in cellular morphogenesis during the Saccharomyces cerevisiae cell cycle. J. Cell Biol 89, 395–405.
Taxis, C., Maeder, C., Reber, S., Rathfelder, N., Miura, K., Greger, K., Stelzer, E. H., and Knop, M. (2006). Dynamic organization of the actin cytoskeleton during meiosis and spore formation in budding yeast. Traffic 7, 1628–1642.[CrossRef][Medline]
Tong, A. H. et al. (2004). Global mapping of the yeast genetic interaction network. Science 303, 808–813.
Valdez-Taubas, J., and Pelham, H. (2005). Swf1-dependent palmitoylation of the SNARE Tlg1 prevents its ubiquitination and degradation. EMBO J 24, 2524–2532.[CrossRef][Medline]
Van Aelst, L., and Cline, H. T. (2004). Rho GTPases and activity-dependent dendrite development. Curr. Opin. Neurobiol 14, 297–304.[CrossRef][Medline]
Venable, J. H., and Coggeshall, R. (1965). A simplified lead citrate stain for use in electron microscopy. J. Cell Biol 25, 407–408.
Wedlich-Soldner, R., Altschuler, S., Wu, L., and Li, R. (2003). Spontaneous cell polarization through actomyosin-based delivery of the Cdc42 GTPase. Science 299, 1231–1235.
Winzeler, E. A. et al. (1999). Functional characterization of the S. cerevisiae genome by gene deletion and parallel analysis. Science 285, 901–906.
Wolven, A. K., Belmont, L. D., Mahoney, N. M., Almo, S. C., and Drubin, D. G. (2000). In vivo importance of actin nucleotide exchange catalyzed by profilin. J. Cell Biol 150, 895–904.
Wright, R. (2000). Transmission electron microscopy of yeast. Microsc. Res. Tech 51, 496–510.[CrossRef][Medline]
Zajac, A., Sun, X., Zhang, J., and Guo, W. (2005). Cyclical regulation of the exocyst and cell polarity determinants for polarized cell growth. Mol. Biol. Cell 16, 1500–1512.
Zhang, X., Bi, E., Novick, P., Du, L., Kozminski, K. G., Lipschutz, J. H., and Guo, W. (2001). Cdc42 interacts with the exocyst and regulates polarized secretion. J. Biol. Chem 276, 46745–46750.
Ziman, M., O'Brien, J. M., Ouellette, L. A., Church, W. R., and Johnson, D. I. (1991). Mutational analysis of CDC42Sc, a Saccharomyces cerevisiae gene that encodes a putative GTP-binding protein involved in the control of cell polarity. Mol. Cell Biol 11, 3537–3544.
Ziman, M., Preuss, D., Mulholland, J., O'Brien, J. M., Botstein, D., and Johnson, D. I. (1993). Subcellular localization of Cdc42p, a Saccharomyces cerevisiae GTP-binding protein involved in the control of cell polarity. Mol. Biol. Cell 4, 1307–1316.[Abstract]
This article has been cited by other articles:
![]() |
Y. He and M. E. Linder Differential palmitoylation of the endosomal SNAREs syntaxin 7 and syntaxin 8 J. Lipid Res., March 1, 2009; 50(3): 398 - 404. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||