![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 19, Issue 11, 4602-4610, November 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Center for Cell Biology and Cancer Research, Albany Medical College, Albany, NY 12208
Submitted November 12, 2007;
Revised June 17, 2008;
Accepted August 11, 2008
Monitoring Editor: William P. Tansey
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
; Nakayama and Nakayama, 2006). It is critical to understand how E3 ubiquitin ligases contribute to malignant cell proliferation, because they represent a potential new class of therapeutic targets (Nalepa et al., 2006).
One major class of E3 ubiquitin ligases that regulates cell cycle progression contains Skp1/Cullin/F-box protein (SCF) complexes (Krek, 1998; Patton et al., 1998). Within these complexes, the cullin protein serves as a scaffold for the E2 ubiquitin-conjugating enzyme and Skp1/F-box protein complex. The F-box protein determines the substrate specificity of the SCF complex; 
70 exist in the human genome. The F-box protein S phase kinase-associated protein 2 (Skp2) has received attention as a putative oncogene. Its expression correlates with tumor malignancy in several tumor types, and the SKP2 gene is amplified in small cell lung and biliary tract cancers (reviewed in Guardavaccaro and Pagano, 2004). High expression of Skp2 is sufficient to promote anchorage-independent growth (Carrano et al., 1999), and Skp2 cooperates with mutant Ras to transform rat fibroblasts (Gstaiger et al., 2001). Evidence from transgenic mice models shows that expression of Skp2 in the T-lymphoid lineage cooperates with activated N-Ras to induce T cell lymphomas in mice (Latres et al., 2001), whereas expression of Skp2 in the prostate glands initiates hyperplasia and low-grade carcinoma (Shim et al., 2003). Skp2 recognizes multiple targets including p27Kip1, cyclin E1, p21Cip1, p57Kip2 and origin recognition complex-1 (Orc1) (Carrano et al., 1999; Tsvetkov et al., 1999; Nakayama et al., 2000; Mendez et al., 2002; Bornstein et al., 2003; Kamura et al., 2003). Of these targets, the cyclin-dependent kinase inhibitor p27Kip1 has received most attention, because the phenotypes of the Skp2 knockout mouse are largely reversed by co-knockout of p27Kip1 (Nakayama et al., 2000; Nakayama et al., 2004).
Melanoma is the deadliest form of skin cancer. It originates from melanocytes, the pigment producing cells in the skin, and/or their progenitors. The mechanism underlying aberrant cell cycle progression in melanoma cells is poorly defined, although recent evidence indicates an important role for the mitogen-activated protein kinase kinase (MEK)-extracellular signal-regulated kinase (ERK)1/2 pathway, because approximately two thirds of melanomas have activating mutations in the serine-threonine kinase B-RAF (Davies et al., 2002). Skp2 is highly expressed in human melanoma (Li et al., 2004; Woenckhaus et al., 2005), is regulated by B-RAF (Bhatt et al., 2007), and is required for melanoma cell growth in vitro and in vivo (Katagiri et al., 2006; Sumimoto et al., 2006; Bhatt et al., 2007). By contrast, Skp2 expression is low in benign nevi (Li et al., 2004), which exhibit senescence-like characteristics (Michaloglou et al., 2005). Here, we demonstrate that Skp2 regulates cell cycle progression by causing a tetraploid arrest, decreased expression of mitotic regulators such as cyclin B1, and an increase in 8N cells likely due to endoreplication. These effects were independent of accumulated p27Kip1 the main studied Skp2 substrate, and only partially dependent on accumulated cyclin E1. Rather, the effects of Skp2 depletion on the cell cycle were prevented by expression of nuclear localized cyclin B1. Additionally, the tetraploid arrest and repression of mitotic regulators was dependent on expression of wild-type, but not mutant, p53. These findings show that Skp2 regulates cell cycle progression in melanoma cells in a manner independent of p27Kip1 accumulation and likely acts to override p53 surveillance mechanisms in melanomas.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
RNA Interference
For short-interfering RNA (siRNA) transfections, 2 x 105 cells were transfected with final concentration of 25 nM siRNA (Dharmacon RNA Technologies, Lafayette, CO) by using Oligofectamine (Invitrogen, Carlsbad, CA). The sequences of the individual siRNAs are as follows: Skp2 #7, CUAAAGGUCUCUGGUGUUUUU; Skp2 #8, GAUGGUACCCUUCAACUGUUU; Skp2 #13, GGUAUCGCCUAGCGUCUGAUU; p27Kip1, GGAGCAAUGCGCAGGAAUAUU; Cyclin E1, GGAAAUCUAUCCUCCAAAGUU; and p53 #5, GAGGUUGGCUCUGACUGUAUU. A nontargeting siRNA from Dharmacon RNA Technologies was used as a control. For experiments involving simultaneous knockdowns, melanoma cells were transfected with 25 nM of each individual siRNA to give a final concentration of 50 nM. Cells were transfected for 4 h in serum-free medium after which culture medium was added. Cells were harvested after 72 h, unless otherwise indicated.
For short-hairpin RNA experiments, we used the BLOCK-iT lentiviral expression system (Invitrogen). SK-MEL-28 cells expressing the tetracycline repressor (SK-MEL-28-TR) were generated as described previously (Boisvert-Adamo and Aplin, 2008). The sequences for the Skp2 shRNA oligos were based on siRNA #13 by using the hairpin sequence 5'-TTCAAGAGA-3'. Annealed oligonucleotides (oligos) were ligated into the pENTR/H1/TO vector, and sequence-verified constructs were then recombined into the pLenti4/BLOCK-iT-DEST vector. The generated pLenti4/BLOCK-iT/Skp2 shRNA was transfected along with the packaging plasmids pLP1, pLP2, and pLP/VSVG into 293FT cells by using FuGENE HD (Roche Diagnostics, Indianapolis, IN). Harvested lentivirus-containing medium was used to infect SK-MEL-28-TR cells. Transduced cells were selected with zeocin over 2 wk. Expression of the shRNA was induced with doxycycline at a final concentration of 0.1 µg/ml.
Western Blotting
Melanoma cell lysates were analyzed for protein expression by Western blotting as described previously (Bhatt et al., 2007). The following primary antibodies were used: Skp2 (H-435), cyclin A (H-432), cyclin E1 (HE-12), p53 (DO-1), and ERK1/2 (K-23) were from Santa Cruz Biotechnology (Santa Cruz, CA); cyclin B (Ab-3), cyclin-dependent kinase 1 (CDK1; Ab-3), and p57Kip2 (Ab-5) were from Lab Vision-NeoMarkers (Fremont, CA); Skp2 (8D9) was from Zymed Laboratories (South San Francisco, CA); p21Cip1 (sx-118) and p27Kip1 (clone 57) were from BD Biosciences (San Jose CA); phospho T288 aurora-A (D13A11) and total aurora-A were from Cell Signaling Technology (Danvers, MA); and Orc1 (#209) was from Dr. C. Obuse (Nara Institute of Science and Technology, Nara, Japan; Tatsumi et al., 2003). Western blots were developed using SuperSignal chemiluminescent substrate (Pierce Chemical, Rockford) and quantitated with a Fluor-S MultiImager and Quantity-One software (Bio-Rad, Hercules, CA).
Flow Cytometry
Cells (1 x 106) were harvested, washed in phosphate-buffered saline (PBS), and fixed in ice-cold 70% ethanol. Cells were permeabilized with 0.1% Triton X-100 and 100 µg/ml RNaseA in PBS at 37°C for 2 h. DNA was stained with 50 µg/ml propidium iodide (Invitrogen, Carlsbad, CA) at 37°C for 15 min. Cells (1 x 105/sample) were analyzed in FACS Canto (BD Biosciences, San Jose, CA). For apoptosis studies, cells were analyzed by flow cytometry for cleaved caspase 3 staining, as described previously (Boisvert-Adamo and Aplin, 2006). As a positive control, cells were treated with 10 µM etoposide (Sigma-Aldrich, St. Louis, MO) for 48 h.
Immunofluorescence
Cells were fixed in 3.7% formaldehyde, permeabilized with 0.5% Triton X-100, and stained with antibodies to nucleoporin (N43620
[GenBank]
; BD Biosciences), and appropriate Alexa Fluor-conjugated secondary antibodies. Staining was viewed on Olympus BX61 upright microscope equipped for epifluorescence.
Real-Time Quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR)
Total RNA was extracted from melanoma cells by using Versagene RNA isolation kit (Gentra Systems, Minneapolis, MN). RNA (1 µg) was reverse transcribed, and 1/20 of the resulting cDNA (cDNA) was used to detect mRNA abundance with primers for actin (forward, TACCTCATGAAGATCCTCACC; reverse, TTTCGTGGATGCCACAGGAC), cyclin B1 (forward, AGAACCTGAGCCAGAACC; reverse, TTGCTCTTCCTCAAGTTGTC), CDK1 (forward, TACACATGAGGTAGTAACACTCTG; reverse, GATGCTAGGCTTCCTGGT), and cyclin A2 (forward, GAAGTACCAGACTACCATGAG; reverse, CTTCAAACTTTGAGGCTAACAG). All primers were designed to give <300-base pair products; primer specificity was indicated by melt curve analysis. Reactions were performed using SYBR Green mix and MyiQ real-time PCR detection system (Bio-Rad). Relative mRNA levels were calculated using the comparative Ct method (
Ct) (Pfaffl, 2001).
Inducible Cyclin B1 Cell Lines
Wild-type and 3A-cyclin B1 cDNA were kind gifts from Dr. Eisuke Nishida (Kyoto University, Kyoto, Japan) (Toyoshima et al., 1998). cDNAs were cloned into pENTR/3C vector, and, after verification by DNA sequencing, were recombined with pLenti4/TO/DEST using the LR Clonase II kit (Invitrogen). The generated pLenti4/TO/WT-Cyclin B1 and pLenti4/TO/3A-Cyclin B1 were packaged in 293FT cells, and the resulting lentiviral supernatants were used to infect a WM115 cell line expressing the tetracycline repressor (WM115-TR). Infected cells were selected with zeocin for 2 wk. Doxycycline (0.1 µg/ml) was used to induce gene expression.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
); however, the mechanisms underlying these effects are unknown. Consistent with our previous study, transfection of vertical growth phase WM115 cells with siRNA targeting Skp2 efficiently reduced Skp2 expression and up-regulated levels of p27Kip1 (Figure 1A, left). DNA content profiles showed that the percentages of Skp2 knockdown cells in the G0/G1 and S stages were decreased compared with controls, but percentages with 4N were progressively increased over 6 d (Figure 1A, right). At later time points (5 and 6 d), a small 8N peak was also detected indicative of endoreplication, a cell cycle that consists of repeated rounds of DNA synthesis without concomitant cell division (Edgar and Orr-Weaver, 2001). To rule out effects of "off-targets," we used two additional sequences to target Skp2 (Figure 1B, left). Accumulation of 4N was observed with both additional duplexes (Figure 1B, right), although the lower percentages of 4N and 8N cells correlated with decreased knockdown efficiency. Nevertheless, these data argue against off-target actions. Because the Skp2 siRNA duplex #13 was the most efficient, this individual sequence was used in subsequent experiments.
|
); however, we detected neither enhanced cleaved caspase-3 staining (Figure 1C) nor increased annexin V staining (data not shown) after Skp2 knockdown in WM115 cells. To determine whether our effects on 4N accumulation could be extrapolated to other melanoma cell lines, we knocked down Skp2 in vertical growth phase melanoma WM278 cells. Consistent with data from WM115, Skp2 knockdown in WM278 cells led to an increase in the 4N peak, although the 8N accumulation was not readily detectable in these cells (Figure 1D). These data show that Skp2 depletion affects cell cycle progression, but it does not directly regulate apoptosis in melanoma cells.
Depletion of p27Kip1 Does Not Reverse Effects of Skp2 Knockdown on the Cell Cycle
Mice studies have shown that combined knockout of p27Kip1 and Skp2 reverses effects of Skp2 knockout alone (Kossatz et al., 2004; Nakayama et al., 2004). To determine whether similar effects are observed in human melanoma cells, we performed double siRNA knockdown experiments. We optimized co-knockdown conditions to deplete p27Kip1 in Skp2 knockdown cells to levels comparable with control cells (Figure 2A). Surprisingly, Skp2 and p27Kip1 double knockdown melanoma cells still accumulated with 4N and 8N DNA contents (Figure 2B, quantitated in C). These results suggest that Skp2 effects on cell cycle progression in melanoma cells are independent of the accumulation of p27Kip1.
|
; Tsvetkov et al., 1999; Nakayama et al., 2000; Mendez et al., 2002; Bornstein et al., 2003; Kamura et al., 2003). Western blot analysis showed that cyclin E1 and Orc1 were both Skp2-regulated in melanoma cells; p57Kip2 was slightly up-regulated, whereas levels of p21Cip1 were decreased (Figure 3A). We determined the requirement of Orc1 and cyclin E1 in Skp2 effects on the cell cycle in double knockdown experiments. Orc1 is a key determinant of genomic sites in which prereplication complexes are to be assembled (DePamphilis, 2003). Despite efficient co-knockdown of Orc1 with Skp2, an accumulation of 4N cells was still detected (Supplemental Figure 1), although a small reduction in 8N accumulation was observed. Similarly, we efficiently co-knocked down cyclin E1 and Skp2 (Figure 3B). Reduction of cyclin E1 efficiently reduced the size of the 8N DNA peak that is induced after Skp2 depletion but only slightly reduced 4N accumulation (Figure 3C; quantitated in D). These data indicate that up-regulation of cyclin E1 and possibly Orc1 after Skp2 depletion may promote endoreplicative cycles in melanoma cells.
|
). Skp2 knockdown cells displayed enhanced activation loop phosphorylation of Aurora-A (Figure 4A). Nuclear envelope breakdown occurs at the onset of anaphase. More than 95% of Skp2 knockdown cells displayed an intact nuclear envelope by nucleoporin staining (Figure 4B), but they stained negatively for phospho-histone H3 (data not shown). These data indicate that Skp2 knockdown cells arrest within G2/early M before the formation of mitotic chromosomes. We next examined the expression of regulators of the G2/M transition, specifically CDK1, cyclin B1, and cyclin A2 during a Skp2 time-course knockdown. Cyclin A was rapidly down-regulated followed by decreases in the expression of cyclin B1 and CDK1 in response to Skp2 knockdown compared with controls (Figure 4C). Down-regulation of cyclin B1, CDK1, and cyclin A occurred at the mRNA level, as determined by qRT-PCR (Figure 4C). Notably, a similar down-regulation of cyclin B1, CDK1, and cyclin A was observed after Skp2 knockdown in WM278 cells (Figure 4D). Together, these results are consistent with down-regulation of multiple mitotic regulators contributing to the cell cycle arrest in Skp2 knockdown cells.
|
; Taylor et al., 1999). We therefore engineered WM115 cells to inducibly express a mutant cyclin B1 (3A-cyclin B1) that resides in the nucleus due to lack of intact nuclear export signal (Figure 5A). Notably, expression of 3A-cyclin B1 was able to reverse the G2 arrest induced after Skp2 knockdown (Figure 5B). p27Kip1 levels remained high in Skp2 knockdown cells expressing 3A-cyclin B1, uncoupling regulation of p27Kip1 levels from G2/M progression. Thus, nuclear expression of cyclin B1 prevents the effects of Skp2 knockdown.
|
; Farina et al., 1999; Manni et al., 2001). Because the p53 status is wild type in WM115 and many other melanoma cell lines (Smalley et al., 2007), we determined the requirement of p53 in G2/M arrest and repression of mitotic regulators after Skp2 knockdown. We individually or jointly depleted cells of Skp2 and p53 (Figure 6A). p53 knockdown alone caused a reproducible increase in the Skp2 levels, an effect that may be mediated by p53 down-regulation of Cks1, a cofactor that stabilizes Skp2 expression (Rother et al., 2007). Notably, the Skp2 knockdown-induced G2/M arrest was efficiently reduced when p53 was co-knocked down in these cells (Figure 6B; quantitated in C). Similar effects were obtained with a second distinct p53 siRNA duplex (Supplemental Figure 3). Furthermore, cyclin B1, cyclin A, and CDK1 protein levels were enhanced in Skp2/p53 knockdown cells compared with Skp2 knockdown alone cells, and they were similar to levels in control cells (Figure 6D). The levels of p27Kip1, however, remained elevated in Skp2/p53 co-knockdown cells, providing further evidence that increased p27Kip1 levels could be separated from Skp2 effects on the cell cycle. Together, these data suggest that the cell cycle arrest and down-regulation of mitotic genes induced by Skp2 knockdown requires p53.
|
; Ikediobi et al., 2006; Smalley et al., 2007). siRNA-mediated knockdown of Skp2 in WM983A up-regulated p27Kip1 levels, but it did not alter the expression of cyclin B1, CDK1, and cyclin A (Figure 7A, left). Additionally, in propidium iodide experiments, we did not observe accumulation of tetraploidy after Skp2 knockdown (Figure 7A, right). Similar experiments were performed in SK-MEL-28 cells, except that we generated doxycycline-inducible Skp2 shRNA cells due to resistance of these cells to transfection. Inducible knockdown of Skp2 in SK-MEL-28 cells enhanced p27Kip1 levels but did not elicit effects on G2/M regulators or 4N accumulation (Figure 7B). Together, these data indicate that Skp2 actions on the cell cycle are dependent on wild-type p53.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
) corroborating in situ data from human tumor samples (Li et al., 2004; Woenckhaus et al., 2005). Furthermore, we and others have shown that Skp2 is required for melanoma cell growth in vitro and in vivo (Katagiri et al., 2006; Sumimoto et al., 2006; Bhatt et al., 2007). This current study provides important new insight underlying Skp2 effects on the cell cycle progression in melanoma cells.
Skp2 knockdown cells display two main alterations in their cell cycle profile: accumulation of cells with 4N and 8N DNA content. The 4N accumulation likely reflects cellular arrest in G2/early M phase. Although G1 tetraploid arrest is also possible (Andreassen et al., 2001), we believe this is less likely given the high phosphorylation of the mitotic kinase Aurora-A and the reversal by expression of nuclear-localized cyclin B1. The 8N peak signifies endoreplication that consists of rounds of DNA synthesis without concomitant cell division (Edgar and Orr-Weaver, 2001). Similar 4N and 8N DNA phenotypes were observed in fibroblasts and hepatocytes derived from Skp2 knockout mice (Nakayama et al., 2000). A major difference in our findings to those in knockout mice is the role of accumulated p27Kip1. It is clear that p27Kip1 is targeted by Skp2 in G2 and M phases and that concomitant loss of p27Kip1 expression is sufficient to reverse the effects of Skp2 knockout in several cell types (Kossatz et al., 2004; Nakayama et al., 2004). However, our results in human melanoma cells demonstrate that reducing p27Kip1 to basal levels is not sufficient to reverse the effect of Skp2 depletion. These results may highlight important differences between Skp2 targets in normal and tumor cells and are consistent with findings from an activated K-Ras mouse model of lung carcinoma. In this model, expression of the p27Kip1 mutant T187A, which is resistant to Skp2-mediated degradation, did not improve tumor-free survival compared with wild-type mice (Timmerbeul et al., 2006). Cyclin E1 is another target of Skp2 (Nakayama et al., 2000). Our data indicate that the failure to degrade cyclin E1 as cells proceed through S phase likely promotes the endocycling phenotype. A role for cyclin E in endoreplication was previously highlighted in E-type cyclin knockout mice, which are embryonic lethal due to a failure of trophoblast cells to undergo normal endoreplicative cycles (Geng et al., 2003).
After Skp2 knockdown, we also observed repression of several G2/M regulators that contain multiple CCAAT boxes within their promoter region. CCAAT boxes in these promoters are bound by the coactivator NF-Y in complex with p53 (Sciortino et al., 2001; Caretti et al., 2003; Imbriano et al., 2005). This prompted us to analyze the dependence of Skp2 effects on p53, which is typically wild type in melanoma (Volkenandt et al., 1991; Weiss et al., 1993). We showed that the cell cycle arrest and decreased expression of G2/M regulators in Skp2 knockdown cells was dependent on p53 expression. Although p53 regulation of p21Cip1 mediates many of the actions of p53, we did not detect an increase of p21Cip1 after Skp2 knockdown (Figure 3), and co-knockdown of p21Cip1 with Skp2 did not reverse the G2/M accumulation (data not shown).
The mechanism underlying altered p53 function after Skp2 knockdown in melanoma warrants further investigation. This is not a trivial issue because p53 can be posttranslationally modified by several distinct mechanisms at multiple sites and recruit coactivators and corepressors (Kruse and Gu, 2008). A recent study showed that Skp2 sequesters the acetyltransferase p300, from binding p53 (Kitagawa et al., 2008). This action inhibited p53 acetylation and transactivation of p21Cip1, PUMA, and Bax after DNA damage, and it enhanced the sensitivity of cancer cells to apoptosis. To date, we have not detected alterations in the acetylation of p53 at C-terminal sites after Skp2 knockdown (data not shown), although notably DNA-damage–inducing agents are not present in our experimental conditions. Although we cannot rule out a similar mechanism because low levels of acetylation may be undetectable in basal conditions, our data indicate that Skp2 blocks the repressive functions of p53 on expression G2/M regulators and that it elicits effects on cell cycle progression. Ongoing experiments are designed to elucidate the mechanism of Skp2 effects on the repressor functions of p53. An additional feature of the Kitagawa study was that Skp2 actions were not dependent of its F-box function and down-regulation of p27Kip1. This notion is consistent with our findings and those of others (Kim et al., 2003) that Skp2 elicits actions on the cell cycle in addition to down-regulation of p27Kip1.
Skp2 depletion in melanoma cells leads to inhibition of cell proliferation despite the expression of mutant B-RAF. It is known that expression of oncogenes early in tumorigenesis leads to a senescent-like cell cycle arrest. Mutant B-RAF expression in human melanocytes initially leads to several rounds of proliferation, but subsequently it leads to a senescent-like arrest (Michaloglou et al., 2005), consistent with the observation that benign nevus cells harbor B-RAF mutations (Dong et al., 2003; Pollock et al., 2003). Activation of p53 is associated with the DNA-damage response, which inhibits G2/M progression. A DNA-damage response has been detected in preneoplastic lesions (Bartkova et al., 2005; Gorgoulis et al., 2005) and occurs during oncogene-induced cell cycle arrest (Bartkova et al., 2006; Di Micco et al., 2006), including arrested mutant B-RAF–expressing melanocytes (Denoyelle et al., 2006). Because we observe a G2 arrest after depletion of Skp2, up-regulation of Skp2 may represent one mechanism, in addition to loss of p16Ink4a, used by melanoma cells to overcome tumorigenesis barriers imposed during mutant B-RAF–mediated senescent-like arrest.
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
Address correspondence to: Andrew E. Aplin (aplina{at}mail.amc.edu)
Abbreviations used: CDK1, cyclin-dependent kinase 1; Orc1, origin recognition complex-1; qRT-PCR, real-time quantitative reverse transcription-polymerase chain reaction; SCF, Skp1/Cullin/F-box protein; shRNA, short hairpin RNA; siRNA, short-interfering RNA; Skp2, S phase kinase-associated protein 2.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Bartkova, J. et al. (2005). DNA damage response as a candidate anti-cancer barrier in early human tumorigenesis. Nature 434, 864–870.[CrossRef][Medline]
Bartkova, J. et al. (2006). Oncogene-induced senescence is part of the tumorigenesis barrier imposed by DNA damage checkpoints. Nature 444, 633–637.[CrossRef][Medline]
Bhatt, K. V., Hu, R., Spofford, L. S., and Aplin, A. E. (2007). Mutant B-RAF signaling and cyclin D1 regulate Cks1/S-phase kinase-associated protein 2-mediated degradation of p27(Kip1) in human melanoma cells. Oncogene 26, 1056–1066.[CrossRef][Medline]
Boisvert-Adamo, K., and Aplin, A. E. (2006). B-RAF and PI-3 kinase signaling protect melanoma cells from anoikis. Oncogene 25, 4848–4856.[CrossRef][Medline]
Boisvert-Adamo, K., and Aplin, A. E. (2008). Mutant B-RAF mediates resistance to anoikis via Bad and Bim. Oncogene 27, 3301–3312.[CrossRef][Medline]
Bolognese, F. et al. (1999). The cyclin B2 promoter depends on NF-Y, a trimer whose CCAAT-binding activity is cell-cycle regulated. Oncogene 18, 1845–1853.[CrossRef][Medline]
Bornstein, G., Bloom, J., Sitry-Shevah, D., Nakayama, K., Pagano, M., and Hershko, A. (2003). Role of the SCFSkp2 ubiquitin ligase in the degradation of p21Cip1 in S phase. J. Biol. Chem 278, 25752–25757.
Caretti, G., Salsi, V., Vecchi, C., Imbriano, C., and Mantovani, R. (2003). Dynamic recruitment of NF-Y and histone acetyltransferases on cell-cycle promoters. J. Biol. Chem 278, 30435–30440.
Carrano, A. C., Eytan, E., Hershko, A., and Pagano, M. (1999). SKP2 is required for ubiquitin-mediated degradation of the CDK inhibitor p27. Nat. Cell Biol 1, 193–199.[CrossRef][Medline]
Davies, H. et al. (2002). Mutations of the BRAF gene in human cancer. Nature 417, 949–954.[CrossRef][Medline]
Denoyelle, C. et al. (2006). Anti-oncogenic role of the endoplasmic reticulum differentially activated by mutations in the MAPK pathway. Nat. Cell Biol 8, 1053–1063.[CrossRef][Medline]
DePamphilis, M. L. (2003). The ‘ORC cycle’: a novel pathway for regulating eukaryotic DNA replication. Gene 310, 1–15.[CrossRef][Medline]
Di Micco, R. et al. (2006). Oncogene-induced senescence is a DNA damage response triggered by DNA hyper-replication. Nature 444, 638–642.[CrossRef][Medline]
Dong, J., Phelps, R. G., Qiao, R., Yao, S., Benard, O., Ronai, Z., and Aaronson, S. A. (2003). BRAF oncogenic mutations correlate with progression rather than initiation of human melanoma. Cancer Res 63, 3883–3885.
Edgar, B. A., and Orr-Weaver, T. L. (2001). Endoreplication cell cycles: more for less. Cell 105, 297–306.[CrossRef][Medline]
Farina, A., Manni, I., Fontemaggi, G., Tiainen, M., Cenciarelli, C., Bellorini, M., Mantovani, R., Sacchi, A., and Piaggio, G. (1999). Down-regulation of cyclin B1 gene transcription in terminally differentiated skeletal muscle cells is associated with loss of functional CCAAT-binding NF-Y complex. Oncogene 18, 2818–2827.[CrossRef][Medline]
Geng, Y., Yu, Q., Sicinska, E., Das, M., Schneider, J. E., Bhattacharya, S., Rideout, W. M., Bronson, R. T., Gardner, H., and Sicinski, P. (2003). Cyclin E ablation in the mouse. Cell 114, 431–443.[CrossRef][Medline]
Gorgoulis, V. G. et al. (2005). Activation of the DNA damage checkpoint and genomic instability in human precancerous lesions. Nature 434, 907–913.[CrossRef][Medline]
Gstaiger, M., Jordan, R., Lim, M., Catzavelos, C., Mestan, J., Slingerland, J., and Krek, W. (2001). Skp2 is oncogenic and overexpressed in human cancers. Proc. Natl. Acad. Sci. USA 98, 5043–5048.
Guardavaccaro, D., and Pagano, M. (2004). Oncogenic aberrations of cullin-dependent ubiquitin ligases. Oncogene 23, 2037–2049.[CrossRef][Medline]
Ikediobi, O. N. et al. (2006). Mutation analysis of 24 known cancer genes in the NCI-60 cell line set. Mol. Cancer Ther 5, 2606–2612.
Imbriano, C., Gurtner, A., Cocchiarella, F., Di Agostino, S., Basile, V., Gostissa, M., Dobbelstein, M., Del Sal, G., Piaggio, G., and Mantovani, R. (2005). Direct p53 transcriptional repression: in vivo analysis of CCAAT-containing G2/M promoters. Mol. Cell. Biol 25, 3737–3751.
Kamura, T., Hara, T., Kotoshiba, S., Yada, M., Ishida, N., Imaki, H., Hatakeyama, S., Nakayama, K., and Nakayama, K. I. (2003). Degradation of p57Kip2 mediated by SCFSkp2-dependent ubiquitylation. Proc. Natl. Acad. Sci. USA 100, 10231–10236.
Katagiri, Y., Hozumi, Y., and Kondo, S. (2006). Knockdown of Skp2 by siRNA inhibits melanoma cell growth in vitro and in vivo. J. Dermatol. Sci 42, 215–224.[CrossRef][Medline]
Kim, S. Y., Herbst, A., Tworkowski, K. A., Salghetti, S. E., and Tansey, W. P. (2003). Skp2 regulates Myc protein stability and activity. Mol. Cell 11, 1177–1188.[CrossRef][Medline]
Kitagawa, M., Lee, S. H., and McCormick, F. (2008). Skp2 suppresses p53-dependent apoptosis by inhibiting p300. Mol. Cell 29, 217–231.[CrossRef][Medline]
Kossatz, U., Dietrich, N., Zender, L., Buer, J., Manns, M. P., and Malek, N. P. (2004). Skp2-dependent degradation of p27kip1 is essential for cell cycle progression. Genes Dev 18, 2602–2607.
Krek, W. (1998). Proteolysis and the G1-S transition: the SCF connection. Curr. Opin. Genet. Dev 8, 36–42.[CrossRef][Medline]
Kruse, J. P., and Gu, W. (2008). SnapShot: p53 posttranslational modifications. Cell 133, 930.[CrossRef][Medline]
Latres, E., Chiarle, R., Schulman, B. A., Pavletich, N. P., Pellicer, A., Inghirami, G., and Pagano, M. (2001). Role of the F-box protein Skp2 in lymphomagenesis. Proc. Natl. Acad. Sci. USA 98, 2515–2520.
Li, Q., Murphy, M., Ross, J., Sheehan, C., and Carlson, J. A. (2004). Skp2 and p27kip1 expression in melanocytic nevi and melanoma: an inverse relationship. J. Cutan. Pathol 31, 633–642.[CrossRef][Medline]
Manni, I., Mazzaro, G., Gurtner, A., Mantovani, R., Haugwitz, U., Krause, K., Engeland, K., Sacchi, A., Soddu, S., and Piaggio, G. (2001). NF-Y mediates the transcriptional inhibition of the cyclin B1, cyclin B2, and cdc25C promoters upon induced G2 arrest. J. Biol. Chem 276, 5570–5576.
Marumoto, T., Zhang, D., and Saya, H. (2005). Aurora-A–a guardian of poles. Nat. Rev. Cancer 5, 42–50.[CrossRef][Medline]
Mendez, J., Zou-Yang, X. H., Kim, S. Y., Hidaka, M., Tansey, W. P., and Stillman, B. (2002). Human origin recognition complex large subunit is degraded by ubiquitin-mediated proteolysis after initiation of DNA replication. Mol. Cell 9, 481–491.[CrossRef][Medline]
Michaloglou, C., Vredeveld, L. C., Soengas, M. S., Denoyelle, C., Kuilman, T., van der Horst, C. M., Majoor, D. M., Shay, J. W., Mooi, W. J., and Peeper, D. S. (2005). BRAFE600-associated senescence-like cell cycle arrest of human naevi. Nature 436, 720–724.[CrossRef][Medline]
Nakayama, K. et al. (2000). Targeted disruption of Skp2 results in accumulation of cyclin E and p27(Kip1), polyploidy and centrosome overduplication. EMBO J 19, 2069–2081.[CrossRef][Medline]
Nakayama, K., Nagahama, H., Minamishima, Y. A., Miyake, S., Ishida, N., Hatakeyama, S., Kitagawa, M., Iemura, S.-I., Natsume, T., and Nakayama, K. I. (2004). Skp2-mediated degradation of p27 regulates progression into mitosis. Dev. Cell 6, 661–672.[CrossRef][Medline]
Nakayama, K. I., and Nakayama, K. (2006). Ubiquitin ligases: cell-cycle control and cancer. Nat. Rev. Cancer 6, 369–381.[CrossRef][Medline]
Nalepa, G., Rolfe, M., and Harper, J. W. (2006). Drug discovery in the ubiquitin-proteasome system. Nat. Rev. Drug Discov 5, 596–613.[CrossRef][Medline]
Patton, E. E., Willems, A. R., and Tyers, M. (1998). Combinatorial control in ubiquitin-dependent proteolysis: don't Skp the F-box hypothesis. Trends Genet 14, 236–243.[CrossRef][Medline]
Pfaffl, M. W. (2001). A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29, e45.
Pollock, P. M. et al. (2003). High frequency of BRAF mutations in nevi. Nat. Genet 33, 19–20.[CrossRef][Medline]
Rother, K., Li, Y. Y., Tschop, K., Kirschner, R., Muller, G. A., Mossner, J., and Engeland, K. (2007). Expression of cyclin-dependent kinase subunit 1 (Cks1) is regulated during the cell cycle by a CDE/CHR tandem element and is downregulated by p53 but not by p63 or p73. Cell Cycle 6, 853–862.[Medline]
Sciortino, S., Gurtner, A., Manni, I., Fontemaggi, G., Dey, A., Sacchi, A., Ozato, K., and Piaggio, G. (2001). The cyclin B1 gene is actively transcribed during mitosis in HeLa cells. EMBO Rep 2, 1018–1023.[CrossRef][Medline]
Shim, E. H., Johnson, L., Noh, H. L., Kim, Y. J., Sun, H., Zeiss, C., and Zhang, H. (2003). Expression of the F-box protein SKP2 induces hyperplasia, dysplasia, and low-grade carcinoma in the mouse prostate. Cancer Res 63, 1583–1588.
Smalley, K. S. et al. (2007). An Organometallic Protein Kinase Inhibitor Pharmacologically activates p53 and induces apoptosis in human melanoma cells. Cancer Res 67, 1–9.
Sumimoto, H., Hirata, K., Yamagata, S., Miyoshi, H., Miyagishi, M., Taira, K., and Kawakami, Y. (2006). Effective inhibition of cell growth and invasion of melanoma by combined suppression of BRAF (V599E) and Skp2 with lentiviral RNAi. Int. J. Cancer 118, 472–476.[CrossRef][Medline]
Tatsumi, Y., Ohta, S., Kimura, H., Tsurimoto, T., and Obuse, C. (2003). The ORC1 cycle in human cells: I. cell cycle-regulated oscillation of human ORC1. J. Biol. Chem 278, 41528–41534.
Taylor, W. R., DePrimo, S. E., Agarwal, A., Agarwal, M. L., Schonthal, A. H., Katula, K. S., and Stark, G. R. (1999). Mechanisms of G2 arrest in response to overexpression of p53. Mol. Biol. Cell 10, 3607–3622.
Timmerbeul, I. et al. (2006). Testing the importance of p27 degradation by the SCFskp2 pathway in murine models of lung and colon cancer. Proc. Natl. Acad. Sci. USA 103, 14009–14014.
Toyoshima, F., Moriguchi, T., Wada, A., Fukuda, M., and Nishida, E. (1998). Nuclear export of cyclin B1 and its possible role in the DNA damage-induced G2 checkpoint. EMBO J 17, 2728–2735.[CrossRef][Medline]
Tsvetkov, L. M., Yeh, K. H., Lee, S. J., Sun, H., and Zhang, H. (1999). p27(Kip1) ubiquitination and degradation is regulated by the SCF(Skp2) complex through phosphorylated Thr187 in p27. Curr. Biol 9, 661–664.[CrossRef][Medline]
Volkenandt, M., Schlegel, U., Nanus, D. M., and Albino, A. P. (1991). Mutational analysis of the human p53 gene in malignant melanoma. Pigment Cell Res 4, 35–40.[CrossRef][Medline]
Weiss, J., Schwechheimer, K., Cavenee, W. K., Herlyn, M., and Arden, K. C. (1993). Mutation and expression of the p53 gene in malignant melanoma cell lines. Int. J. Cancer 54, 693–699.[Medline]
Woenckhaus, C., Maile, S., Uffmann, S., Bansemir, M., Dittberner, T., Poetsch, M., and Giebel, J. (2005). Expression of Skp2 and p27KIP1 in naevi and malignant melanoma of the skin and its relation to clinical outcome. Histol. Histopathol 20, 501–508.[Medline]
Yokoi, S., Yasui, K., Iizasa, T., Takahashi, T., Fujisawa, T., and Inazawa, J. (2003). Down-regulation of SKP2 induces apoptosis in lung-cancer cells. Cancer Sci 94, 344–349.[CrossRef][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
