![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 19, Issue 11, 4660-4674, November 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Anatomy and Anthropology, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv 69978, Israel
Submitted October 17, 2007;
Revised July 30, 2008;
Accepted August 7, 2008
Monitoring Editor: Benjamin Margolis
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
; Huelsken and Birchmeier, 2001; Moon et al., 2002; Logan and Nusse, 2004; Nelson and Nusse, 2004). When misregulated, the Wnt signaling pathway is involved in oncogenesis (Peifer and Polakis, 2000; Polakis, 2000; Logan and Nusse, 2004; Barker and Clevers, 2006). This signaling pathway is broadly divided into the canonical and noncanonical Wnt signaling pathways. The canonical pathway, which regulates the ability of the β-catenin protein to drive activation of specific target genes, is initiated after binding of Wnt to the receptor/coreceptor complex comprised of the seven transmembrane Frizzled (Fz) receptor and low-density lipoprotein receptor-related proteins (LRP) 5 or 6. This results in the formation of Dishevelled (Dvl)-Fz complexes, which in turn relocalize Axin and activate Dvl, leading to inactivation of glycogen synthase kinase (GSK)-3β (Akiyama, 2000; Huelsken and Birchmeier, 2001). This process causes β-catenin to accumulate in the cytoplasm and to enter the nucleus, where it interacts with members of the T-cell factor/lymphoid enhancer factor (TCF/LEF) family of transcription factors. The direct interaction of TCF/LEF factors with nuclear β-catenin relieves TCF/LEF from corepressors and converts the TCF proteins into potent transcriptional activators, ensuring expression and activation of Wnt target gene expression (Hurlstone and Clevers, 2002). In the absence of a Wnt signal, β-catenin associates in a "destruction complex" together with Axin, adenomatous polyposis coli (APC), GSK-3β, casein kinase I (CKI), FRAT and others. When this protein complex is assembled, β-catenin is actively degraded by the cellular proteasome pathway (Peifer and Polakis, 2000). The noncanonical, β-catenin-independent Wnt signaling pathway that primarily modulates cell movements is subdivided into at least two additional pathways. One is the planar cell polarity (PCP) pathway, which activates the c-Jun-N-terminal kinase (JNK) and, perhaps, small GTP-binding proteins. Also activated is the Wnt/Ca2+ pathway: Wnt and Frizzled homologues can activate calcium/calmodulin-dependent kinase II (CamKII) and protein kinase C (PKC; Kohn and Moon, 2005; Widelitz, 2005).
The aberrant activation of the Wnt/β-catenin pathway has a well-established role in driving cancer progression (Barker and Clevers, 2006). This signaling pathway also plays a key role in diverse aspects of neurodevelopment by regulating axon guidance, dendritic development, axon remodeling, and synapse formation (reviewed in Wilson and Houart, 2004; Ciani and Salinas, 2005), and aberrant Wnt signaling is associated with neurodegenerative pathological conditions such as autism, schizophrenia, and Alzheimer's disease (AD; De Ferrari and Moon, 2006).
To better understand the correlation between the Wnt signaling pathway and neurodevelopment and neurodegenerative disorders, we have screened a human embryonic brain cDNA library using a novel method based on the ability of cells to survive only when the Wnt pathway is turned off. Here we present evidence for the identification of a novel set of direct and indirect Wnt regulators. We have divided these genes into distinct functional groups and have demonstrated that the modifier of cell adhesion (MOCA) negatively regulates Wnt signaling. MOCA, also called presenilin (PS)-binding protein (PBP) and dedicator of cytokinesis 3 (DOCK3), is a member of the DOCK180 family of proteins known to be involved in regulation of cytoskeletal organization and cell–cell interactions (Kashiwa et al., 2000). MOCA has been linked to AD pathology, activates Rac1, alters NIH3T3 cells morphology, and regulates N-cadherin–dependent adhesion (Namekata et al., 2004; Chen et al., 2005). In this study, we show for the first time that MOCA exists in a complex with β-catenin, represses the canonical Wnt pathway, decreases cell migration, and increases cell adhesion.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The mouse Axin coding region was inserted into the pREP4 using XhoI and BglII. The human wild-type β-catenin coding region was inserted into the pEGFP-C2 (Clontech) plasmid. A short-hairpin RNA construct was generated using the plasmid vector pSuper.retro.puro (OligoEngine, Seattle, WA). The targeting sequence for MOCA was 5'-GCAAGTAGTTGGAGCCTGTAA-3'. The Wnt-responsive, TCF-dependent luciferase constructs, pTOPFLASH and its mutated version pFOPFLASH and FLAG-tagged β-catenin (
S45, in which Ser45 is deleted), were kindly provided by Dr. H. Clevers (Utrecht University, Utrecht, The Netherlands) and have been described previously (Morin et al., 1997). Human Frizzled 1 (HFz1) described previously (Gazit et al., 1999) was kindly provided by Dr. S. A. Aaronson (Mount Sinai Medical Center, NY). FLAG-tagged Dvl and FLAG-tagged FRAT were kindly provided by Dr. A. Gazit (Tel Aviv University, Israel). FLAG-tagged GSK3-β was a kind gift from Dr. H. Eldar-Finkelman (Tel Aviv University). Wnt-3a-HA and pCMV/β-galactosidase (β-Gal) expression plasmids, used to evaluate the efficiency of transfection, were purchased from Upstate Biotechnology (Lake Placid, NY) and Clontech, respectively. pCMV-Renilla used to evaluate transfection efficiency was purchased from Promega (Madison, WI). The pCis2/HA-tagged MOCA plasmid, pCis2 empty vector, the siRNA MOCA, and scrambled sequence (Chen et al., 2005) were kindly provided by Dr. D. Schubert (The Salk Institute for Biological Studies, La Jolla, CA), the cyclin D1/Luciferase reporter harboring the β-catenin-TCF response element driving luciferase expression was kindly provided by Drs. R. G. Pestell and C. Albanese (Albert Einstein College of Medicine, New York, NY). MG132 (Calbiochem, San Diego, CA) and hygromycin (Invivogen, San Diego, CA) were used at concentrations as indicated.
Cell Cultures, Transfections, and Luciferase Reporter Assays
Human embryonic kidney cell lines HEK293T, HEK293-EBNA (stably expressing the EBNA-1 gene; Invitrogen), L Wnt-3A cells (ATCC, Manassas, VA; no. CRL-2647), and colon carcinoma SW480 cells were cultured in DMEM supplemented with 10% fetal calf serum (FCS), and 100 U/ml penicillin/streptomycin. Undifferentiated P19 (mouse, C3H.He, teratocarcinoma) cells (ATCC; no. CRL-1825) were cultured in Alpha MEM supplemented with 5% FCS, and 100 U/ml penicillin/streptomycin. For neural differentiation, P19 cells were grown in Alpha MEM supplemented with 5% FCS and 1 µM retinoic acid (Sigma-Aldrich, St. Louis, MO) for 4 d and plated on poly-L-lysine (Sigma-Aldrich)-coated dished. Neural differentiated cells were then cultured in DMEM supplemented with 2.5% FCS and 2 mM glutamine (Biological Industries Israel, Beit Haemek, Israel). Cells were kept in a humidified 5% CO2 atmosphere at 37°C. For establishment of HEK293-EBNA cells stably expressing TCF/HSV-TK, cells were transfected with TCF/HSV-TK and selected by 10 µg/ml blasticidin (Invivogen). Different cell colonies stably expressing the TCF/HSV-TK (293EBNA-TK cells) plasmid were screened for their ability to specifically express the TK gene upon Wnt-3A activation.
For establishment of HEK293 cells stably expressing MOCA, cells were transfected with pCis2/HA-MOCA or with pCis2 as described previously (Chen et al., 2005) and selected by 800 µg/ml G418 (AG Scientific, San Diego, CA). SW480, P19, HEK293-EBNA, TCF/HSV-TK, and HEK293/MOCA cells were transfected using JetPEI (PolyPlus Transfection, New York, NY). For HEK293T cells, the standard CaPO4 precipitation method was used. For Wnt signaling reporter assays, HEK293T cells growing in 24-well dishes were transfected at 60–70% confluence with 0.2 µg of pTOPFLASH, 0.2 µg HFz1, 0.02 µg Wnt-3A-HA, 0.02 µg β-Gal and 0.2 µg of isolated plasmid (or Prep4 empty vector as a control), or various DNA concentrations of pCis2/HA-MOCA. Forty-eight hours after transfection, the luciferase levels were measured using a luciferase assay kit (Promega). For Wnt signaling reporter assays with siMOCA, HEK293/MOCA cells grown in 35-mm dishes were transfected with 1 µg of pTOPFLASH, 1 µg HFz1, 0.1 µg Wnt-3A-HA, 0.1 µg β-Gal, and 8 µg of siMOCA or scrMOCA (Chen et al., 2005). Luciferase levels were measured 72 h after transfection. To confirm activation of TCF luciferase in P19 cells, cells grown in 35-mm dishes were transfected with 1 µg FLAG-tagged β-catenin (S45) or empty vector, 1 µg of pTOPFLASH, and 0.1 µg pCMV-Renilla. Luciferase levels were measured 24 h after transfection. For TCF luciferase assay with siMOCA, P19 cells were transfected with 1 µg of pTOPFLASH, 0.1 µg pCMV-renilla, and 4 µg of siMOCA or scrMOCA (Chen et al., 2005) and 6 µg of pSuper/siMOCA or the appropriate pSuper/scrMOCA. Luciferase levels were measured 72 h after transfection of siMOCA constructs and 24 h after transfection of the pTOPFLASH plasmid. In all assays, FOPFLASH activity was measured by replacing the pTOPFLASH with pFOPFLASH under equivalent conditions of Wnt 3A-induced signaling. Data are presented as mean values and SDs for at least three independent experiments done in duplicate.
cDNA Library Amplification
Amplification of the plasmid library was done on selective agar plates to avoid disproportionate amplification. The previously transformed sample was diluted to a density of 2.2 x 104 colony-forming units/plate (in 0.4 ml LB/plate) and plated on 55 x 150-mm 2YT + Amp plates. Plates were incubated at 37°C for 17 h. Cells were harvested and combined from all plates for plasmid DNA isolation.
Functional pREP4/cDNA Library Screening
The cDNA expression library was transfected into 293EBNA-TK cells at 10 times the number of independent clones expressed in the library, a complexity that maximized the potential representation of the library genes. One plate of TCF/HSV-TK cells (3 x 106 cells/9-cm plate) was transfected with 10 µg of the library DNA. Twenty-four hours after transfection, cells were subdivided into 15 pools and plated on 9-cm plates. Twenty-four hours later, the growth medium was replaced with Wnt-3A–conditioned media (CM; Shibamoto et al., 1998) containing 3 µg/ml ganciclovir (Sigma-Aldrich). Two weeks later 350 µg/ml hygromycin B (Invivogen) was added to the growth medium. Plasmid DNA was recovered from cells that survived the selection using the Hirt's method as previously described (Chinsky and Soeiro, 1981). Control transfection colonies were fixed in cold methanol for 10 min followed by 10% Giemsa (Merck, Rahway, NJ) stain for 15 min.
Immunoprecipitation, Western Blot Analysis, and Cell Fractionation
For coimmunoprecipitations, HEK293T cells were cotransfected with 8 µg MOCA-hemagglutinin (HA) or HA-empty vector together with 7 µg β-cateninS45-FLAG or FLAG empty vector. Total cell lysates were prepared by solubilization in lysis buffer (150 mM NaCl, 50 mM Tris, pH 7.5, and 0.2% NP-40). Protein concentrations were determined by Coomassie Plus. Cell lysate (1.5 mg) was incubated with anti-FLAG M2-agarose affinity gel (Sigma-Aldrich) for 4 h at 4°C on a rocker platform. For coimmunoprecipitation of endogenous β-catenin, HEK293/MOCA, and HEK293/vector cells were lysed as described above. Precleared cell lysates (2 mg) were immunoprecipitated with 8 µg of HA-probe (Y-11) antibody (Santa Cruz Biotechnology, Santa Cruz, CA) overnight at 4°C. Protein A/G plus agarose beads (Santa Cruz Biotechnology) were added and incubated on a rocker platform at 4°C for 1 h. Beads were collected by centrifugation and washed three times in lysis buffer. Protein samples were analyzed by SDS-PAGE and transferred to nitrocellulose membranes, blocked with 5% low fat milk, and detected with the appropriate antibody.
To prepare membrane fractions, cells were washed in phosphate-buffered saline (PBS) and incubated for 5 min at room temperature in buffer S (0.25 M sucrose, 1 mM imidazole, and 5 mM MgCl2). The medium was aspirated and cells were harvested in buffer S containing 1 mM DTT and a cocktail of protease inhibitors, incubated on ice for 15 min, and then homogenized. Cells were centrifuged at 800 x g at 4°C to pellet nuclei, after which the supernatant was centrifuged at 4°C for 45 min at 100,000 x g in a Beckman TL-120.2 rotor (Hercules, CA). The supernatant (cytosol) was collected, and the remaining pellet (membrane fraction) was resuspended in buffer containing TNE (25 mM Tris, pH 7.4, 150 mM NaCl, 1% NP-40, 4 mM EDTA, 25 mM sodium fluoride, and 1 mM sodium orthovanadate) and sonicated. Protein concentrations from the cell fractions were determined using the Bio-Rad protein assay kit (Hercules, CA). For Western blot analysis cell lysates were prepared as described above for immunoprecipitates samples. Equal protein amounts were subjected to SDS-PAGE and transferred to nitrocellulose membranes. Filters were incubated with anti-HA rat mAb clone (3F10, Roche Diagnostics, Alameda, CA) diluted 1:2500, anti FLAG rabbit polyclonal antibody (Sigma-Aldrich) diluted 1:400, anti-β-catenin (BD Transduction Laboratories, Lexington, KY) diluted 1:5000, and anti-cyclin D1 clone (A-12) diluted 1:500 and anti-LEF 1 (H-70) diluted 1:300 (Santa Cruz Biotechnology). Anti-E-cadherin and anti-N-cadherin (BD Transduction Laboratories) were diluted 1:5000, whereas anti-GFP (green fluorescent protein) and anti-p120 (H-90; Santa Cruz Biotechnology) were diluted 1:500. β-actin (MP Biomedicals, Solon, OH), diluted 1:10,000, was used as a loading control. Horseradish peroxidase (HRP)-conjugated goat anti-rat antibody (Santa Cruz Biotechnology) and HRP goat anti-mouse and anti-rabbit antibodies (Jackson ImmunoResearch Laboratories, West Grove, PA) were used as secondary antibodies. Antibodies were visualized by enhanced chemiluminescence (Amersham Pharmacia, Piscataway, NJ).
RT-PCR
Total RNA was isolated from undifferentiated and neural differentiated P19 cells using Trireagent (Sigma-Aldrich) according to manufacturer's instructions. Total RNA from each sample (0.1–1 µg) was used to obtain the first-strand cDNA using SuperScript First-Strand Synthesis System for PCR (Invitrogen) according to manufacturer's protocol. The cDNA was used as a template for PCR using PCR ready mix (New England Biolabs, Ipswich, MA). The primers used for the PCR reactions were as follows: 5'CTGGATCCGGAAAATGGAG3' (forward) and 5'ACTCGCTCAGCATCCTCTGT3' (reverse) for the MOCA gene and 5'AGGCCAGACTTTGTTGGATT3' (forward) 5'TTTGGCTTTTCCAGTTTCACT3' (reverse) for HPRT gene. Amplification was performed at 94°C for 30 s, 57°C for 30 s, and 72°C for 1 min for 35 cycles. HPRT was used as an endogenous mRNA control. Data are presented as mean values and SDs for at least three independent experiments.
Immunofluorescence Staining
SW480 cells were transfected with pCis2/HA-tagged MOCA and 48 h later were fixed in 3.7% paraformaldehyde in PBS for 20 min at room temperature, permeabilized (0.1% triton in PBS) for 30 min, and blocked (1% BSA and 0.1% triton in PBS) for 1 h at room temperature. HEK293T cells transfected with pCis2/MOCA-HA were treated for 24 h with 20 mM LiCl (Sigma-Aldrich), and 24 h after transfection the cells were fixed as described above. HEK293/MOCA and HEK293/vector were grown on pre-coated poly-L-lysine coverslips and fixed (see above). Primary antibodies included mouse monoclonal anti-β-catenin, anti-E-cadherin, anti-N-cadherin (BD Transduction Laboratories) diluted 1:500, anti-HA rat mAb clone (3F10, Roche Diagnostics) diluted 1:300, active β-catenin (clone 8E7, Upstate Biotechnology) diluted 1:500, and anti-p120 (H-90, Santa Cruz Biotechnology) diluted 1:300. The cells were washed and exposed for 1 h to FITC-conjugated anti-mouse antibody (Sigma) and rhodamine anti-rat antibody (Molecular Probes, Eugene, OR). 4-6' diamidino-2 phenylindole (DAPI, Sigma) was used to stain cell nuclei. Fixed cells were imaged in a Leica SP2 confocal microscope (Leica Microsystems, Bannockburn, IL).
Migration Assay
Cell migration was assayed in 24-well, 8-mm pore membrane Transwell cell culture chambers (Costar, Cambridge, MA). Cells (0.75 x 105) were seeded in the upper chamber in DMEM medium. Growing medium or Wnt 3A CM (diluted 1:2) was added to the lower chamber. Twenty hours later the cells were fixed in cold methanol and stained with Giemsa. Cells that had migrated to the lower surface of the membrane were visualized, and the intensity of the Giemsa stained cells was quantified by a computer-assisted densitometer (TINA 2.0c; Fuji BAS, Tokyo, Japan).
Statistical Analysis
Results were presented as mean ± SEM. Statistical analysis among groups was performed using Student's t test. p < 0.05 was regarded as statistically significant.
Database Search
Database homology searches were carried out using the National Center for Biotechnology Information blast server (http://www.ncbi.nlm.nih.gov/).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). Previously it was shown that expression of the TK gene under control of a TCF-responsive promoter selectively kills cells treated with ganciclovir (Kwong et al., 2002). The feasibility of the system was confirmed: 293EBNA-TK cells were treated with Wnt-3A CM in the presence of ganciclovir and hygromycin B (a gene coding for hygromycin B resistance is expressed on the pREP4 vector). All cells died within 1 wk of treatment. In contrast, transfection of cells with a plasmid coding for Axin, a negative regulator of the Wnt pathway, allowed cell survival under the same conditions (Figure 1D). The Axin encoding plasmid was recovered from the cells (data not shown). This result suggests that negative regulators of the Wnt signaling pathway, such as Axin, can be isolated using this method.
|
|
(Clevers, 2006), PP2A (Li et al., 2001), DKK3 (Byun et al., 2005), E-cadherin (Orsulic et al., 1999), and noncanonical Wnt regulators (CAM kinase II; Montcouquiol et al., 2006). Other categories include PS-associated proteins (eight genes), cell adhesion proteins (seven genes), Ca2+-binding proteins (seven genes), trafficking proteins (six genes), cytoskeletal proteins (five genes), and transcription regulators (two genes). Some of these genes can be classified in more than one functional group. For example, BIN1 is both a trafficking-associated protein as well as an actin cytoskeleton-associated protein.
Secondary Screening of the Putative Wnt Inhibitors
The screen described above was suitable for the first round of functional selection, because in this system a single genetic change was sufficient to yield a weak yet selectable phenotype of increased survival in a population of cells subjected to a long-term selection. However, because this characteristic of the system may also lead to a significant level of nonspecific background, cDNAs obtained in the first round of selection had to be individually tested by a secondary test. The pTOPFLASH plasmid contains wild-type TCF-binding sites fused upstream to a luciferase reporter gene and is widely used for measuring the ability of a given gene to specifically activate or inhibit the Wnt signaling pathway (Morin et al., 1997). The pFOPFLASH plasmid contains mutated TCF-binding sites and serves as a control for Wnt signal specificity. Therefore, this assay was used as a secondary screen to test the isolated cDNAs for their ability to specifically inhibit the Wnt signaling pathway.
The pTOPFLASH or pFOPFLASH plasmids were cotransfected with plasmids expressing HFz1, HA-Wnt-3A, and individually isolated cDNA plasmids into HEK293T cells. The resulting luciferase levels were measured. As expected, most cDNAs decreased the Wnt signal by at least 20% (Figure 2). Some cDNA clones increased the Wnt signal and the rest did not specifically affect the TOPFLASH reporter plasmid activity (Figure 2). As our primary screen was aimed at identifying Wnt inhibitors, this secondary screen ensured robustness and specificity of the assay. The results from the secondary screen did not correspond exactly to the results from the primary screen. There are a number of reasons for these differences. First, a number of the cell colonies isolated in our primary screen contained more then one cDNA type (Table 1, Figure 2). When these cDNAs were expressed individually they did not decrease TOPFLASH values, but when the cDNAs were cotransfected (as in the primary screen), they synergistically inhibited the Wnt signal and reduced TOPFLASH levels (Figure 3A). Another difference between the screens is that under the primary screening conditions the cells were exposed to lower levels of Wnt signal for a longer time. As can be seen from Figure 3B, cells exposed to Wnt-3A CM (as in the primary screen) showed lower levels of Wnt signal compared with cells transfected with HFZ-1 and HA-Wnt-3A (as in the TOPFLASH screen). Finally, the effect on Wnt signaling may also depend on the gene dosage. For example, GSK-3, which was isolated in our screen, more strongly inhibited the Wnt signal at the lower DNA concentrations (Figure 3C).
|
|
). As shown in Figure 4A, transfection of MOCA resulted in a concentration-dependent decrease of the TOPFLASH activity. To confirm the specificity of the activity, the cells were transfected with pFOPFLASH. To further verify the specificity of the effect of MOCA on β-catenin signaling, RNA interference was used to inhibit MOCA expression in HEK293 cells that stably express MOCA (HEK293/MOCA). A small interfering RNA (siRNA) that was previously shown to specifically silence MOCA expression was used (Chen et al., 2005). As shown in Figure 4B, down-regulation of MOCA increased Wnt signaling levels compared with a control siRNA. Similar results were obtained using an additional siRNA targeting the MOCA transcript (described in Materials and Methods).
|
S45, FLAG-tagged GSK-3β, or empty vector. As shown in Figure 4C, MOCA-HA specifically coimmunoprecipitated with β-cateninS45-FLAG and with FLAG-GSK-3β. Next, HEK293T cells stably expressing MOCA (HEK293/MOCA) were used. Figure 4D shows that immunoprecipitates of MOCA included endogenous β-catenin. These results suggest that MOCA interacts with β-catenin either directly or through another protein in a complex. As MOCA is mainly expressed in neuronal cells (although we have found MOCA to be expressed in other tissue types; data not shown), we examined whether MOCA can affect the Wnt pathway in neuronal cells. For these experiments we used P19 cells, a pluripotent stem cell line of mouse teratocarcinomas that can be induced to differentiate into neuronal cells in the presence of retinoic acid (Kotani et al., 2002). First we confirmed that transfection of a stabilized form of β-catenin activated the Wnt pathway in both undifferentiated and differentiated P19 cells (Figure 4E). Next, we depleted MOCA from both undifferentiated and differentiated P19 cells that were transfected with the TOP/FOPFLASH plasmids. Results shown in Figure 4F demonstrate that depletion of MOCA induced TCF/β-catenin–dependent transcription although the total protein levels of β-catenin were not affected. Similar results were obtained using an additional siRNA targeting the MOCA sequence (data not shown).
MOCA Functions Downstream from β-Catenin to Represses Wnt Target Gene Expression
We conducted epistasis experiments, based on TOPFLASH assays, to identify the level within the Wnt signaling cascade at which MOCA acts. First, we examined cells transfected with plasmids encoding Wnt3A and HFz1, which stimulated TOPFLASH approximately eight times (Figure 5A). In cells overexpressing MOCA, the TOPFLASH values were reduced to 
35% of the control. MOCA expression also reduced the TOPFLASH levels of cells expressing Dvl, FRAT, or β-catenin suggesting that MOCA acts after the stabilization of β-catenin in the pathway. The cyclin D1 gene is regulated by β-catenin and plays an important role in growth of many types of tumors (Donnellan and Chetty, 1998). To determine the effect of MOCA on β-catenin–dependent gene expression, a reporter construct containing the cyclin D1 promoter gene was cotransfected with HA-tagged MOCA into HEK293T cells. The expression of MOCA led to suppressed cyclin D1 promoter activity (Figure 5B). To test whether MOCA reduced expression of Wnt-responsive genes, the levels of endogenous cyclin D1 and LEF1 expression were measured in SW480 cells that overexpressed MOCA. LEF1 was chosen for this assay as previous work has shown that the cyclin D1 promoter contains a consensus LEF-binding site that represents the main contributor to β-catenin transactivation (Soriano et al., 2001). Indeed, Western blot analysis revealed that the MOCA-induced inhibition of the Wnt canonical pathway was accompanied by decreased levels of expression of both cyclin D1 and LEF1 in SW480 cells (Figure 5C). Together, these results suggest that MOCA functions downstream of β-catenin to represses Wnt target gene expression.
|
). For this experiment SW480 cells were transfected with MOCA-HA and stained for both the HA-tagged MOCA and endogenous β-catenin. Untransfected SW480 cells showed strong, mostly nuclear staining of endogenous β-catenin, whereas MOCA transfectants expressed lower levels of nuclear β-catenin and higher levels of cytoplasmic β-catenin (Figure 6B). To further examine the effect of MOCA on the localization of β-catenin, HEK293T cells were incubated with LiCl, which leads to nuclear accumulation of active, dephosphorylated β-catenin that can be detected by using an antibody specific for the dephosphorylated form (dephospho-β-catenin antibody anti-ABC, clone 8E7). Dephosphorylated β-catenin transduces the Wnt signal (Staal et al., 2002; van Noort et al., 2002). As in SW480 cells, expression of MOCA in cells that express high levels of active β-catenin resulted in a decrease in nuclear levels of β-catenin and an increase in cytoplasmic levels of active (dephosphorylated) β-catenin. These data argue that MOCA does not affect the total amount of β-catenin but does affect the subcellular distribution of active β-catenin.
|
). The effect of MOCA on junction proteins was evaluated in SW480 cells. When grown in sparse cultures (subconfluent), SW480 cells do not form adherence junctions and express low levels of adherence proteins (Gavert and Ben-Ze'ev, 2007). Results shown in Figure 7 demonstrate that expression of MOCA in SW480 cells leads to a dramatic expression of both E- and N-cadherin. Expression of MOCA did not change the levels of expression of the p120 protein. As in the LiCl-treated HEK293T cells (Figure 6B), expression of MOCA led to reduced levels of active β-catenin in the nucleus. It is interesting to note that under these experiment conditions, MOCA colocalized with cytoplasmic active β-catenin and with E- and N-cadherin, indicating that these proteins may be part of the same protein complex.
|
) our results demonstrate that expression of MOCA dramatically increased the levels of E-cadherin and had a more moderate effect on the levels of β-catenin and N-cadherin expression (Figure 8A). Western blot analysis on cells fractionated into membrane and cytoplasmic pools confirmed this observation and showed that expression of MOCA led to elevated levels of membrane bound β-catenin (Figure 8B). It is interesting to note that although the total levels of p120 did not change as a result of the expression of MOCA, an additional, shorter p120 isoform was expressed under these conditions. It has been shown that association of the shorter p120 isoform with E-cadherin is correlated with strong cell–cell adhesion (Seidel et al., 2004). To test whether MOCA can enhance cell adhesion and as a result suppress cell migration, we performed migration assays. Both normal growing medium and Wnt3A-conditioned medium were used in Transwell chambers. We observed that under both of these conditions, cells migrated to the bottom chamber (Figure 8C). The Wnt3A CM had a more pronounced effect, as expected from its chemoattractant properties. This cell migration was inhibited, under both conditions, in cells expressing MOCA relative to untransduced cells.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The PS-binding protein MOCA was isolated independently from three different cell colonies in the screen. Presenilin 1 (PS1) and presenilin 2 (PS2) are polytopic membrane proteins; these genes are mutated in people who have AD (Sherrington et al., 1995), and several lines of evidence support a role for Wnt signaling in AD (De Ferrari and Moon, 2006). We demonstrated that MOCA forms a cellular complex with β-catenin and specifically inhibits the Wnt pathway in both epithelial and neuronal cell lines. Moreover, MOCA functions downstream of the β-catenin degradation complex in the Wnt signaling pathway to suppress Wnt target gene expression. Our results suggest that MOCA does not facilitate degradation of β-catenin, but rather decreases nuclear levels of active β-catenin. Expression of MOCA increased the expression of cell adhesion molecules and as a result enhanced cell adhesion. Moreover, MOCA colocalized with these adhesion molecules in cancer cells and induced the expression of a short p120 isoform that has been associated with enhanced cell adhesion. It has been shown that under conditions that favor cell–cell adhesion, PS1 stabilizes the E-cadherin–catenin adhesion complex (Baki et al., 2001). Combined with the present data, this suggests that MOCA and PS may function synergistically to enhance cell adhesion. Increased levels of β-catenin at adherence junctions results in a decrease in the soluble free cytoplasmic β-catenin that is a key regulator of the Wnt signaling pathway. Because β-catenin must translocate to the nucleus to activate expression of target genes (Polakis, 2000), MOCA may reduce expression of Wnt target genes by increasing the levels of membrane-bound β-catenin.
It is important to note that our results (Figures 6
–8) demonstrate that MOCA is a cytoplasmatic and membrane-bound protein. On the other hand our epistasis experiments suggest that MOCA functions downstream or at the level of β-catenin. This could result from cytoplasmic sequestration of β-catenin by MOCA. Another possibility is that MOCA functions to down-regulate the Wnt signal by binding β-catenin in the cytoplasm and relocalizing β-catenin to the membrane. Other proteins that affect the Wnt pathway such as Axin, Dvl, and p120 have been shown to regulate the cellular distribution of β-catenin and in this way affect the signal (Cliffe et al., 2003; Spring et al., 2005; Bilic et al., 2007).
PSs interact with Wnt signaling components such as β-catenin (Tesco et al., 1998) and GSK-3β (Takashima et al., 1998). Both MOCA and β-catenin bind PS1, and the loss of both has been implicated in AD. Because our results do not show direct binding between β-catenin and MOCA, it is possible that this interaction is mediated through PS. It is interesting to note that AD-associated PS1 mutations increase the degradation of β-catenin in the cerebral cortex (Zhang et al., 1998) and that MOCA is expressed almost exclusively in the cerebral cortex and hippocampus, which are brain areas that are prone to nerve degeneration associated with AD (Kashiwa et al., 2000). All together, these data suggest that MOCA and PS may work together to regulate Wnt signaling involved in neurodevelopment and the pathogenesis of AD.
Wnt signaling is essential for many biological functions. Our data suggest that MOCA may be involved in these processes through regulation of Wnt signaling. Previous work (Chen et al., 2005), and this study show that expression of MOCA increased the levels of β-catenin in membranes of HEK293T cells. Moreover, it has been shown that β-catenin is stabilized after transport to the membrane (Chen et al., 2005) and that the binding of β-catenin to cadherins at the membranes leads to β-catenin stabilization (Nelson and Nusse, 2004). The two pools of β-catenin exert different functions: The membrane bound β-catenin is involved in cell–cell adhesion, whereas the cytosolic β-catenin is transported to the nucleus to activate Wnt target genes and promote cell proliferation. Therefore, by elevating the levels of membrane bound-β-catenin, MOCA may lead to a decrease in the levels of free β-catenin available for signaling, which, in turn, results in decreased expression of Wnt target genes. Thus, by regulating the localization of β-catenin and increasing cell–cell adhesion, MOCA plays an important role in determining cell fate.
In summary, we have identified a number of novel Wnt signaling inhibitors using a functional screen in mammalian cells. Although elucidation of the specific molecular connections among all our identified potential Wnt regulators and the Wnt signaling cascade is beyond the scope of this study, we have demonstrated a novel link between the Wnt signaling pathway and the MOCA protein. Because Wnt signaling is essential for normal development and pathogenesis of various cancers and neuronal diseases, the interaction between MOCA and the Wnt signaling pathway provides new insights into the molecular mechanisms of Wnt signaling and its associated cellular functions.
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
Address correspondence to: Rina Rosin-Arbesfeld (arina{at}tau.ac.il)
Abbreviations used: AD, Alzheimer's disease; MOCA, modifier of cell adhesion; PS, presenilin; TCF/LEF, T-cell factor/lymphoid enhancer factor.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Baki, L. et al. (2001). Presenilin-1 binds cytoplasmic epithelial cadherin, inhibits cadherin/p120 association, and regulates stability and function of the cadherin/catenin adhesion complex. Proc. Natl. Acad. Sci. USA 98, 2381–2386.
Barker, N., and Clevers, H. (2006). Mining the Wnt pathway for cancer therapeutics. Nat. Rev. Drug Discov 5, 997–1014.[CrossRef][Medline]
Bilic, J., Huang, Y. L., Davidson, G., Zimmermann, T., Cruciat, C. M., Bienz, M., and Niehrs, C. (2007). Wnt induces LRP6 signalosomes and promotes dishevelled-dependent LRP6 phosphorylation. Science 316, 1619–1622.
Byun, T., Karimi, M., Marsh, J. L., Milovanovic, T., Lin, F., and Holcombe, R. F. (2005). Expression of secreted Wnt antagonists in gastrointestinal tissues: potential role in stem cell homeostasis. J. Clin. Pathol 58, 515–519.
Capell, A., Grünberg, J., Pesold, B., Diehlmann, A., Cintron, M., Nixon, R., Beyreuther, K., Selkoe, D. J., and Haass, C. (1998). The proteolytic fragments of the Alzheimer's disease-associated presenelin-1 form heterodimers and occur as a 100-150-kDa molecular mass complex. J. Biol. Chem 273, 3205–3211.
Chen, Q., Chen, T. J., Letourneau, P. C., Costa Lda, F., and Schubert, D. (2005). Modifier of cell adhesion regulates N-cadherin-mediated cell-cell adhesion and neurite outgrowth. J. Neurosci 25, 281–290.
Chinsky, J., and Soeiro, R. (1981). Fv-1 host restriction of Friend leukemia virus: analysis of unintegrated proviral DNA. J. Virol 40, 45–55.
Ciani, L., and Salinas, P. C. (2005). WNTs in the vertebrate nervous system: from patterning to neuronal connectivity. Nat. Rev. Neurosci 6, 351–362.[Medline]
Clevers, H. (2006). Wnt/beta-catenin signaling in development and disease. Cell 127, 469–480.[CrossRef][Medline]
Cliffe, A., Hamada, F., and Bienz, M. (2003). A role of Dishevelled in relocating Axin to the plasma membrane during wingless signaling. Curr. Biol 13, 960–966.[CrossRef][Medline]
De Ferrari, G. V., and Moon, R. T. (2006). The ups and downs of Wnt signaling in prevalent neurological disorders. Oncogene 25, 7545–7553.[CrossRef][Medline]
Donnellan, R., and Chetty, R. (1998). Cyclin D1 and human neoplasia. Mol. Pathol 51, 1–7.[Abstract]
Gavert, N., and Ben-Ze'ev, A. (2007). beta-Catenin signaling in biological control and cancer. J. Cell Biochem 102, 820–828.[CrossRef][Medline]
Gazit, A., Yaniv, A., Bafico, A., Pramila, T., Igarashi, M., Kitajewski, J., and Aaronson, S. A. (1999). Human frizzled 1 interacts with transforming Wnts to transduce a TCF dependent transcriptional response. Oncogene 18, 5959–5966.[CrossRef][Medline]
Huelsken, J., and Birchmeier, W. (2001). New aspects of Wnt signaling pathways in higher vertebrates. Curr. Opin. Genet. Dev 11, 547–553.[CrossRef][Medline]
Hurlstone, A., and Clevers, H. (2002). T-cell factors: turn-ons and turn-offs. EMBO J 21, 2303–2311.[CrossRef][Medline]
Kashiwa, A., Yoshida, H., Lee, S., Paladino, T., Liu, Y., Chen, Q., Dargusch, R., Schubert, D., and Kimura, H. (2000). Isolation and characterization of novel presenilin binding protein. J. Neurochem 75, 109–116.[CrossRef][Medline]
Kohn, A. D., and Moon, R. T. (2005). Wnt and calcium signaling: beta-catenin-independent pathways. Cell Calcium 38, 439–446.[CrossRef][Medline]
Kotani, M., Osanai, T., Tajima, Y., Kato, H., Imada, M., Kaneda, H., Kubo, H., and Sakuraba, H. (2002). Identification of neuronal cell lineage-specific molecules in the neuronal differentiation of P19 EC cells and mouse central nervous system. J. Neurosci. Res 67, 595–606.[CrossRef][Medline]
Kwong, K. Y., Zou, Y., Day, C. P., and Hung, M. C. (2002). The suppression of colon cancer cell growth in nude mice by targeting beta-catenin/TCF pathway. Oncogene 21, 8340–8346.[CrossRef][Medline]
Li, X., Yost, H. J., Virshup, D. M., and Seeling, J. M. (2001). Protein phosphatase 2A and its B56 regulatory subunit inhibit Wnt signaling in. Xenopus. EMBO J 20, 4122–4131.[CrossRef]
Logan, C. Y., and Nusse, R. (2004). The Wnt signaling pathway in development and disease. Annu. Rev. Cell Dev. Biol 20, 781–810.[CrossRef][Medline]
Montcouquiol, M., Crenshaw, E. B., 3rd, and Kelley, M. W. (2006). Noncanonical Wnt signaling and neural polarity. Annu. Rev. Neurosci 29, 363–386.[CrossRef][Medline]
Moolten, F. L. (1986). Tumor chemosensitivity conferred by inserted herpes thymidine kinase genes: paradigm for a prospective cancer control strategy. Cancer Res 46, 5276–5281.
Moon, R. T., Bowerman, B., Boutros, M., and Perrimon, N. (2002). The promise and perils of Wnt signaling through beta-catenin. Science 296, 1644–1646.
Morin, P. J., Sparks, A. B., Korinek, V., Barker, N., Clevers, H., Vogelstein, B., and Kinzler, K. W. (1997). Activation of beta-catenin-Tcf signaling in colon cancer by mutations in beta-catenin or APC. Science 275, 1787–1790.
Namekata, K., Enokido, Y., Iwasawa, K., and Kimura, H. (2004). MOCA induces membrane spreading by activating Rac1. J. Biol. Chem 279, 14331–14337.
Nelson, W. J., and Nusse, R. (2004). Convergence of Wnt, beta-catenin, and cadherin pathways. Science 303, 1483–1487.
Orsulic, S., Huber, O., Aberle, H., Arnold, S., and Kemler, R. (1999). E-cadherin binding prevents beta-catenin nuclear localization and beta-catenin/LEF-1-mediated transactivation. J. Cell Sci 112, (Pt 8), 1237–1245.[Abstract]
Peifer, M., and Polakis, P. (2000). Wnt signaling in oncogenesis and embryogenesis—a look outside the nucleus. Science 287, 1606–1609.
Polakis, P. (2000). Wnt signaling and cancer. Genes Dev 14, 1837–1851.
Rubinfeld, B., Souza, B., Albert, I., Muller, O., Chamberlain, S. H., Masiarz, F. R., Munemitsu, S., and Polakis, P. (1993). Association of the APC gene product with beta-catenin. Science 262, 1731–1734.
Seidel, B., Braeg, S., Adler, G., Wedlich, D., and Menke, A. (2004). E- and N-cadherin differ with respect to their associated p120ctn isoforms and their ability to suppress invasive growth in pancreatic cancer cells. Oncogene 23, 5532–5542.[CrossRef][Medline]
Sherrington, R. et al. (1995). Cloning of a gene bearing missense mutations in early-onset familial Alzheimer's disease. Nature 375, 754–760.[CrossRef][Medline]
Shibamoto, S., Higano, K., Takada, R., Ito, F., Takeichi, M., and Takada, S. (1998). Cytoskeletal reorganization by soluble Wnt-3a protein signalling. Genes Cells 3, 659–670.[Abstract]
Soriano, S., Kang, D. E., Fu, M., Pestell, R., Chevallier, N., Zheng, H., and Koo, E. H. (2001). Presenilin 1 negatively regulates beta-catenin/T cell factor/lymphoid enhancer factor-1 signaling independently of beta-amyloid precursor protein and notch processing. J. Cell Biol 152, 785–794.
Spring, C. M., Kelly, K. F., O'Kelly, I., Graham, M., Crawford, H. C., and Daniel, J. M. (2005). The catenin p120ctn inhibits Kaiso-mediated transcriptional repression of the beta-catenin/TCF target gene matrilysin. Exp. Cell Res 305, 253–265.[CrossRef][Medline]
Staal, F. J., Noort Mv, M., Strous, G. J., and Clevers, H. C. (2002). Wnt signals are transmitted through N-terminally dephosphorylated beta-catenin. EMBO Rep 3, 63–68.[CrossRef][Medline]
Takashima, A. et al. (1998). Presenilin 1 associates with glycogen synthase kinase-3beta and its substrate tau. Proc. Natl. Acad. Sci. USA 95, 9637–9641.
Tesco, G., Kim, T. W., Diehlmann, A., Beyreuther, K., and Tanzi, R. E. (1998). Abrogation of the presenilin 1/beta-catenin interaction and preservation of the heterodimeric presenilin 1 complex following caspase activation. J. Biol. Chem 273, 33909–33914.
van Noort, M., Meeldijk, J., van der Zee, R., Destree, O., and Clevers, H. (2002). Wnt signaling controls the phosphorylation status of beta-catenin. J. Biol. Chem 277, 17901–17905.
Widelitz, R. (2005). Wnt signaling through canonical and non-canonical pathways: recent progress. Growth Factors 23, 111–116.[CrossRef][Medline]
Wilson, S. W., and Houart, C. (2004). Early steps in the development of the forebrain. Dev. Cell 6, 167–181.[CrossRef][Medline]
Zhang, Z. et al. (1998). Destabilization of beta-catenin by mutations in presenilin-1 potentiates neuronal apoptosis. Nature 395, 698–702.[CrossRef][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
p < 0.001, Student's t test).
