![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 19, Issue 11, 4909-4917, November 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ophthalmology and Visual Sciences Research Center, University of Pittsburgh School of Medicine, Pittsburgh, PA 15213
Submitted January 30, 2008;
Revised August 15, 2008;
Accepted September 4, 2008
Monitoring Editor: Joan Brugge
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
; Fini and Stramer, 2005; Jane et al., 2005; Netto et al., 2005; de Giorgi et al., 2007; Jang et al., 2007; Raja et al., 2007).
Activation of the epidermal growth factor receptor (EGFR) is absolutely required for induction of motility in many epithelia including the corneal epithelium and the epidermis after wounding (Hansen et al., 1997; Zieske et al., 2000; Block et al., 2004; Repertinger et al., 2004; Xu et al., 2004). Activation occurs as a result of proteolytic release of ligands of the EGFR, which resembles the well-characterized triple membrane-passing signaling pathway that causes transactivation of the EGFR after stimulation of numerous G-protein coupled receptors (Fischer et al., 2003; Ohtsu et al., 2006).
Recently, a few upstream signals that activate the EGFR after wounding sheets of epithelial cells have been identified. We have reported that phospholipase D (PLD), which catalyzes hydrolysis of phosphatidylcholine to the second-messenger phosphatidic acid (PA) (Exton, 2002; McDermott et al., 2004; Jenkins and Frohman, 2005; Cazzolli et al., 2006), is activated rapidly after wounding sheets of corneal epithelial cells, which in turn activates the EGFR (Mazie et al., 2006). Extracellular ATP provides a second signal that has been identified to be upstream of EGFR activation. ATP is released after wounding sheets of epithelial cells and results in transactivation of the EGFR through the G-protein–coupled P2Y class of purinergic receptors (Klepeis et al., 2004; Yang et al., 2004; Boucher et al., 2007; Yin et al., 2007).
The EGFR transactivation processes induced by exogenously added ATP and PA are similar, and ATP is known to induce activation of PLD in many systems (el-Moatassim and Dubyak, 1992; Gargett et al., 1996; Sun et al., 1999; Kusner and Adams, 2000; Perez-Andres et al., 2002; Pochet et al., 2003; Le Stunff et al., 2004). This leads to the hypothesis that ATP signals through PLD to activate the EGFR. Because ATP is freely diffusible, and the major driving forces for epithelial migration after wounding appear to be derived mainly from the first few rows of cells from the wound edge (Fenteany et al., 2000; Farooqui and Fenteany, 2005), we were interested in analyzing the spatial aspects of EGFR activation in wounded epithelial cell sheets.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
were from R&D Systems (Minneapolis, MN). Antibodies against Src-family kinases phosphorylated on tyr-416 and to the corresponding nonphosphorylated peptide were from Cell Signaling Technology (Beverly, MA). ATP, grade VII apyrase from potato, and reactive blue 2 were from Sigma (St. Louis, MO). Tyrphostin AG 1478, PP2, and Src kinase inhibitor 1 were from EMD Biosciences (San Diego, CA). Phosphatidic acid (1,2-dioctanoyl-sn-glycero-3-phosphate) was from Avanti Polar Lipids (Alabaster, AL). Cell culture reagents were from Mediatech (Herndon, VA), and other reagents and supplies were from Thermo Fisher Scientific (Pittsburgh, PA), unless noted.
Cell Culture and siRNA Transfection
Human corneal limbal epithelial (HCLE) cells (Gipson et al., 2003) were cultured in human keratinocyte serum-free medium (KSFM, Invitrogen, Carlsbad, CA) supplemented with 0.3 mM CaCl2, 25 µg/ml bovine pituitary extract, and 0.2 ng/ml epidermal growth factor (EGF). Before stimulations, cells were cultured for 4–5 h in the same medium without pituitary extract and EGF. Small interfering RNA (siRNA) oligonucleotides encoding the sense and antisense target sequences were synthesized by Applied Biosystems (Foster City, CA). The PLD1 siRNA was GUUAAGAGGAAAUUCAAGC, and the PLD2 siRNAa and siRNAb were UGGGGCAGGUUACUUUGCU and AGUCUUGAUGAGGUCUGCUC, respectively. BLAST searches (Altschul et al., 1990) with siRNA sequences revealed significant sequence homologies with only the targeted mRNAs. Unless otherwise noted, 50 nM siRNA was transfected into subconfluent cells at the time of seeding using the siPORT NeoFX lipid-based reverse transfection reagent (Applied Biosystems). Two days after transfections, cells were reseeded to generate confluent cultures and were used the following day. For every experiment reported here, expression of the relevant PLD isoforms was monitored by Western blot and found to be similar to that shown in Figure 2, A and B.
Wounding Models
For analysis of signaling in cells near wounds, HCLE cells were grown to confluence around agarose droplets, forming lanes one to five cells wide, and the cell sheets were acutely wounded by removal of the droplets, as described previously (Block et al., 2004). Protocols for Western blotting and the assay for PLD activity were described previously (Mazie et al., 2006).
For analysis of signaling in cells far from wounds, HCLE cells were grown to confluence around a single agarose strip, and the cell sheets were wounded by the removal of the strip. Reactions were stopped 10 min later by plunging the bottom of the dish into ice water and replacing the medium with ice-cold phosphate-buffered saline (171 mM NaCl, 10.1 mM Na2HPO4, 3.35 mM KCl, 1.84 mM KH2PO4, pH 7.2). Cells proximal to the wound were scraped using a polyethylene cell lifter (Corning Costar, Acton, MA) trimmed to 7 mm, effectively removing 
3 mm of cells from each side of the wound, and the remaining cells were lysed directly in 1% SDS.
To quantitate wound healing, HCLE cells were grown to confluence around a single agarose strip (Block et al., 2004) and induced to differentiate into a stratified epithelium (Gipson et al., 2003). Cells were transferred to Dulbecco's modified Eagle's medium:F-12 1:1 with 10% newborn calf serum (NCS), the agarose strip was removed, and healing was allowed to progress 14–18 h before fixation. Wound healing was monitored by measuring the widths of wounds, as described previously (Block et al., 2004). Experiments with mitomycin C have previously demonstrated that wounds in HCLE cells heal as a result of cell migration (Mazie et al., 2006).
Assays for AR and ATP Release
HCLE cells were incubated with KSFM without EGF and pituitary extract for 10 min. Conditioned medium was collected and centrifuged for 2 min at 5000 x g. The cell-free supernatants were aliquoted and stored at –20°C until further processing. AR was measured in the supernatants using the DuoSet ELISA (R&D Systems) according to manufacturer's protocol. ATP was measured in the cell-free tissue culture supernatants with the ATP Bioluminescent Assay Kit (Sigma). For normalization purposes, protein content of whole cell extracts was determined by the BCA protein assay (Pierce, Rockford, IL).
Immunofluorescence Analysis of Wounded Layers of HCLE Cells
HCLE cells were grown to confluence around a single agarose strip and were wounded by the removal of the strip. Reactions were stopped 10 min later by addition of 1/10 volume 37% formaldehyde. Cells were processed for immunofluorescence analysis as previously described (Block et al., 2004). Seven contiguous aligned fields (a total of 5 mm from the wound edge) per sample were captured on a Nikon TE2000E automated microscope (Melville, NY) with a 10x objective (NA 0.3) using the MetaMorph scanslide utility (Universal Imaging, West Chester, PA). For quantitation of phospho-ERK signal intensities, images were acquired at identical exposures, and the average intensities of 250- or 62.5-µm-wide regions were recorded for the entire 5-mm width of the image.
Live Cell Microscopy
HCLE cells were stratified around agarose strips in a 12-well dish, and medium was changed to 1:1 DMEM:F-12 with 10% NCS 24 h before experiment. Cells received no treatment or 30 U/ml apyrase, and agarose strips were left in place or removed, such that n = 3 for each condition. Cell migration was monitored for the subsequent 24 h with a Live Automated Cell Imager (Schmidt et al., 2008): cells were maintained in an environmentally controlled chamber (37°C and 5% CO2) on a robotic stage and were visualized with an inverted Nikon Eclipse TE 2000 U microscope equipped with a 10x objective and Photometric ES CoolSnap CCD camera (Woburn, MA). Time-lapse images were created, and cell velocities were calculated using MetaMorph by manually tracking individual cells. In each well, four cells from each of two regions at the wound edge and four cells from each of two regions 2 mm from the wound were analyzed. Cells were chosen arbitrarily, before viewing the time-lapse movie. The analysis was blinded to apyrase treatment, and in cells distal to the edge, the analysis was blinded to wounding. Because of errors in stage movement and manual tracking, the velocity of a fixed object was determined to be 0.1 µm/min, which was subtracted from calculated cell velocities.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
; Yang et al., 2004; Yin et al., 2007). We have found that major cell damage is not required for healing of wounds in sheets of corneal epithelial cells by a more gentle procedure that is based on removal of agarose strips or droplets in the cell layer (Block et al., 2004). To test whether ATP is released in this wounding assay, we used HCLE cells, which are human corneal limbal epithelial cells that have been immortalized by abrogation of p16INK4A/Rb and p53 functions and overexpression of the catalytic subunit of the telomerase holoenzyme (Gipson et al., 2003). As is seen in Figure 1A, wounding by this procedure also results in significant release of ATP. We have previously shown that wounding sheets of HCLE cells results in activation of PLD, and to determine whether this is a consequence of the released ATP, cell sheets were wounded in the presence of apyrase, which dephosphorylates extracellular ATP and ADP to AMP. Inclusion of 5 U/ml apyrase eliminated ATP effectively from the medium (Figure 1A), and apyrase reduced the PLD activity to basal levels after wounding (Figure 1B), which implies that activation of PLD is stimulated by the ATP that is released after wounding.
|
|
; Gargett et al., 1996; Sun et al., 1999; Kusner and Adams, 2000; Perez-Andres et al., 2002; Pochet et al., 2003; Le Stunff et al., 2004). Similarly to wound-stimulated PLD activity, ATP-stimulated PLD activity was blocked in HCLE cells transfected with PLD2 siRNAa but not in cells transfected with PLD1 siRNA (Figure 3A). Stimulation with apyrase-treated ATP (Figure 3B) or with 50 µM adenosine (not shown) did not activate PLD, indicating that activation is a direct effect of ATP. Addition of the EGFR kinase inhibitor tyrphostin AG 1478 did not inhibit activation of PLD by ATP (Figure 3B), although it completely inhibited EGFR activation by ATP in parallel incubations (not shown), indicating that the observed PLD activation is not a result of EGFR signaling.
|
Extracellular ATP transactivates the EGFR through stimulation of proteases at the cell surface, which cleave precursors of ligands for the receptor (Boucher et al., 2007; Yin et al., 2007). To establish a measure of the transactivation process, we assayed one such ligand, amphiregulin (AR), and found that wounding, addition of ATP, and stimulation with a water-soluble analog of PA, 1,2-octanoyl-sn-glycero-3-phosphate, all increased AR release (Supplemental Figure S3). Furthermore, neutralization experiments indicated that AR contributes to the activation of the EGFR in response to these treatments (Supplemental Figure S4). Because ATP activates the EGFR through PLD2, reduction of expression of PLD2 was expected to decrease secretion of AR in response to ATP. Reducing the level of PLD2 resulted in reduction of basal levels of secretion of AR and a larger reduction of the response to ATP stimulation, whereas interfering with the cellular levels of PLD1 had no effect (Figure 3E). The reduction of PLD2 by the two siRNA oligonucleotides and AR release correlate closely, suggesting that the reduction of AR release is the result of knockdown of PLD2 rather than of off-target effects (Supplemental Figure S5).
ATP Functions as a Long-Range Messenger that Activates the EGFR
Because ATP is freely diffusible, we examined whether extracellular ATP mediates EGFR activation in cells at a distance from wound edges (for details of the procedure, see Materials and Methods). Inclusion of apyrase in the medium had no detectable effect on basal levels of EGFR activity, but it abolished wound-induced stimulation (Figure 4). Extracellular signal-regulated kinases 1 and 2 (ERK1/2) are downstream targets of the EGFR that are important for wound healing (Rubinfeld and Seger, 2005; Katz et al., 2007; McKay and Morrison, 2007), and they responded similarly. As a control, we noted that treatments with apyrase did not reduce the activation of EGFR and ERK1/2 kinases after addition of EGF (Supplemental Figure S2).
|
|
|
), which is consistent with the notion that EGFR activation is the result of a proteolytic event. Also, the LA1 antibody, which blocks activation of the EGFR by ligands, and neutralizing anti-AR antibodies inhibited EGFR activation. Taken together these data support that the wound-proximal pathway activates the EGFR though a transactivation mechanism.
|
). We first analyzed the possible role of the SFKs in the ATP/PLD2-dependent pathway by testing the effects of two structurally dissimilar SFK inhibitors, PP2 and Src Kinase Inhibitor I (SKI I), which are known to have distinct nonspecific effects (Bain et al., 2007). Incubating with either inhibitor blocked ATP-induced release of AR and activation of the EGFR (Supplemental Figure S6). To examine the role of SFKs in the ATP/PLD2-independent pathway, we noted that elimination of extracellular ATP with apyrase did not abolish activation of SFKs as monitored by immunoblotting with an antibody that recognizes the SFKs phosphorylated on tyr-416 (Roskoski, 2005; Figure 8, A and B). Blocking the EGFR with tyrphostin AG 1478 did not block SFK activation in HCLE cells, in agreement with the notion that SFK is upstream of EGFR activation (Xu et al., 2006 and data not shown). Importantly, incubation with either inhibitor blocked release of AR and activation of the EGFR in our standard wounding model in the presence of apyrase (Figure 8, C–E), although they did not inhibit EGFR activation by exogenous ligand (Supplemental Figure S7). Together these data indicate that one or more SFKs are required for EGFR transactivation in both the ATP/PLD2-dependent and -independent pathways.
|
; Bindschadler and McGrath, 2007). According to such models, it is not necessary to postulate the existence of any biochemical signals that affect cell behavior. To determine whether wounding induces increased velocities, positions of cells were recorded at various times by time-lapse microscopy. As is seen in Figure 9A, cells within 50 µm from the agarose barrier exhibited basal motility irrespective of induction of wounds. However, wounding induced significant increases of the velocities of the cells at the edge of wounds, and this was not affected by the presence of apyrase. We conclude that wounding does indeed elicit a biological response in the HCLE cells in that they move faster.
|
-32P]ATP and [-32P]ADP. As little as 0.3 U/ml apyrase was sufficient to degrade ATP and ADP completely, and 30 U/ml was fully active even after 14 h in cell culture (Supplemental Figure S8A). From these data, we conclude that extracellular ATP signaling is not necessary for wound healing in sheets of HCLE cells. Other reports have suggested that ATP signaling is critical for wound healing because healing and wound-induced EGFR activation are inhibited by the general P2 receptor antagonist reactive blue 2 (RB2; Klepeis et al., 2004; Boucher et al., 2007; Yin et al., 2007). We have confirmed these findings, but we have also observed that the same concentration of RB2 inhibited activation of the EGFR by AR, which makes RB2 an unsuitable reagent for this type of study (Supplemental Figure S8, B and C). |
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
; Yin et al., 2007). We report here the existence of a distinct mode of activation of the EGFR after wounding, which is not dependent on ATP signaling, based on the following observations: 1) Activation of the EGFR is unaffected by removal of extracellular ATP with apyrase in our standard wounding assay. 2) Extracellular ATP activates the EGFR through PLD2 signaling; however, knock-down of PLD2 does not inhibit EGFR activation in our standard wounding assay. 3) Visualization by immunofluorescence shows that the EGFR/ERK1/2 pathway is stimulated in cells near wounds in the presence of apyrase. 4) The enhanced velocity of cells near wounds is not affected by the presence of apyrase.
Elimination of extracellular ATP with apyrase did not affect the rate of wound healing, suggesting that the ATP/PLD2-dependent pathway is not required for healing of wounds. This is in agreement with one previous report describing similar results with Madin-Darby canine kidney epithelial cells (Farooqui and Fenteany, 2005), but differs from the conclusions reached by the use of the purinergic receptor antagonist RB2 (Klepeis et al., 2004; Boucher et al., 2007; Yin et al., 2007). We have found that RB2 also blocks EGFR activation by exogenous ligands. RB2 is therefore not a suitable reagent for determining the role of purinergic signaling in healing of wounds in corneal epithelial cells because EGFR activation is an absolute prerequisite for induction of motility.
A notable difference in the two pathways is their range of action. ATP is diffusible, and we found both by direct immunoblotting of cells at a distance from wounds and by immunofluorescence studies that ATP signaling activates the EGFR at least 0.5 cm from the wound edge. In contrast, the ATP/PLD2-independent signaling pathway acts only in cells near wounds. ATP is found in conditioned media after wounding at a concentration of 1–2 µM, which is sufficient to activate the EGFR (Yin et al., 2007) and PLD (Block and Klarlund, unpublished observations). ATP is now recognized as an extracellular messenger with numerous functions and has the potential of influencing other processes related to wound healing such as induction of inflammation, regeneration of nerves, and perhaps communication with underlying stroma (Bours et al., 2006; Burnstock, 2006, 2007a,b).
PLD activation and release of extracellular ATP have both been reported to be upstream events that lead to EGFR transactivation after wounding (Klepeis et al., 2001, 2004; Mazie et al., 2006; Boucher et al., 2007; Yin et al., 2007). In this communication we report that these two signaling events are related by showing that ATP signals through PLD2 to activate the EGFR. The results reported here are to our knowledge the first descriptions of a role for PLD in ATP-stimulated EGFR transactivation. There is a growing list of cytokines and growth factors that stimulate EGFR transactivation (Higashiyama and Nanba, 2005; Ohtsu et al., 2006; Sanderson et al., 2006), and many of these, such as angiotensin II, bradykinin, endothelin-I, and lysophosphatidic acid also stimulate PLD activity (Martin et al., 1989; Bollag et al., 1990; Liu et al., 1992; van der Bend et al., 1992). A role for PLD2 has previously been reported for angiotensin II-mediated transactivation of the EGFR (Li and Malik, 2005), and it therefore seems reasonable to hypothesize that PLD2 mediates EGFR transactivation by stimuli other than ATP.
Our experiments suggest that one or more members of the SFKs are part of the signaling that leads to EGFR activation. SFK activity is necessary for EGFR transactivation by various stimuli, possibly by being closely coupled to sheddases of the ADAM family (Zhang et al., 2004, 2006). We have found that addition of PA to cells causes activation of SFKs (Block and Klarlund, unpublished observations), and overexpression of PLD2 has been shown to increase SFK activity (Ahn et al., 2003). This favors a model in which one or more of the SFKs are downstream of PLD2 activation after wounding.
In summary, our data indicate that two distinct mechanisms exist for EGFR activation. One depends on release of ATP, which can elicit EGFR activation at least 0.5 cm from wounds and which uses PLD2 as a signaling intermediary. This pathway undoubtedly contributes to induction of motility since addition of extracellular ATP or PA has been shown to enhance wound healing in many different epithelial cell lines (Sponsel et al., 1995; Dignass et al., 1998; Klepeis et al., 2004; Allen-Gipson et al., 2006; Mazie et al., 2006; Wesley et al., 2007; Yin et al., 2007), but it is not required for healing of wounds. The other pathway, which is not dependent on ATP/PLD2 signaling, acts locally at edges of wounds. The results of these and prior (Block et al., 2004; Mazie et al., 2006; Xu et al., 2006; Boucher et al., 2007; Yin et al., 2007) studies can be summarized by the model depicted in Figure 10. In this model, an unknown wound sensor (or sensors) causes activation of one or more SFKs and subsequent transactivation of the EGFR, either through ATP/PLD2 signaling or by a distinct intracellular mechanism.
|
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
Address correspondence to: Jes K. Klarlund (klarlundjk{at}upmc.edu)
Abbreviations used: AR, amphiregulin; EGFR, epidermal growth factor receptor; ERK1/2, extracellular signal–regulated kinase; HCLE, human corneal-limbal epithelial; KSFM, keratinocyte serum-free medium; PA, phosphatidic acid; PLD, phospholipase D; RB2, reactive blue 2.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Allen-Gipson, D. S., Wong, J., Spurzem, J. R., Sisson, J. H., and Wyatt, T. A. (2006). Adenosine A2A receptors promote adenosine-stimulated wound healing in bronchial epithelial cells. Am. J. Physiol. Lung Cell Mol. Physiol 290, L849–L855.
Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990). Basic local alignment search tool. J. Mol. Biol 215, 403–410.[CrossRef][Medline]
Bain, J., Plater, L., Elliott, M., Shpiro, N., Hastie, C. J., McLauchlan, H., Klevernic, I., Arthur, J. S., Alessi, D. R., and Cohen, P. (2007). The selectivity of protein kinase inhibitors: a further update. Biochem. J 408, 297–315.[Medline]
Bindschadler, M., and McGrath, J. L. (2007). Sheet migration by wounded monolayers as an emergent property of single-cell dynamics. J. Cell Sci 120, 876–884.
Block, E. R., Matela, A. R., SundarRaj, N., Iszkula, E. R., and Klarlund, J. K. (2004). Wounding induces motility in sheets of corneal epithelial cells through loss of spatial constraints: role of heparin-binding epidermal growth factor-like growth factor signaling. J. Biol. Chem 279, 24307–24312.
Bollag, W. B., Barrett, P. Q., Isales, C. M., Liscovitch, M., and Rasmussen, H. (1990). A potential role for phospholipase-D in the angiotensin-II-induced stimulation of aldosterone secretion from bovine adrenal glomerulosa cells. Endocrinology 127, 1436–1443.
Boucher, I., Yang, L., Mayo, C., Klepeis, V., and Trinkaus-Randall, V. (2007). Injury and nucleotides induce phosphorylation of epidermal growth factor receptor: MMP and HB-EGF dependent pathway. Exp. Eye Res 85, 130–141.[CrossRef][Medline]
Bours, M. J., Swennen, E. L., Di Virgilio, F., Cronstein, B. N., and Dagnelie, P. C. (2006). Adenosine 5'-triphosphate and adenosine as endogenous signaling molecules in immunity and inflammation. Pharmacol. Ther 112, 358–404.[CrossRef][Medline]
Burnstock, G. (2006). Purinergic signalling—an overview. Novartis Found Symp 276, 26–48. discussion 48–57, 275–281.[Medline]
Burnstock, G. (2007a). Physiology and pathophysiology of purinergic neurotransmission. Physiol. Rev 87, 659–797.
Burnstock, G. (2007b). Purine and pyrimidine receptors. Cell Mol. Life Sci 64, 1471–1483.[CrossRef][Medline]
Cazzolli, R., Shemon, A. N., Fang, M. Q., and Hughes, W. E. (2006). Phospholipid signalling through phospholipase D and phosphatidic acid. IUBMB Life 58, 457–461.[Medline]
de Giorgi, V., Sestini, S., Massi, D., Ghersetich, I., and Lotti, T. (2007). Keratinocyte growth factor receptors. Dermatol. Clin 25, 477–485, vii.[CrossRef][Medline]
Dignass, A. U., Becker, A., Spiegler, S., and Goebell, H. (1998). Adenine nucleotides modulate epithelial wound healing in vitro. Eur. J. Clin. Invest 28, 554–561.[CrossRef][Medline]
el-Moatassim, C., and Dubyak, G. R. (1992). A novel pathway for the activation of phospholipase D by P2z purinergic receptors in BAC1.2F5 macrophages. J. Biol. Chem 267, 23664–23673.
Exton, J. H. (2002). Regulation of phospholipase D. FEBS Lett 531, 58–61.[CrossRef][Medline]
Farooqui, R., and Fenteany, G. (2005). Multiple rows of cells behind an epithelial wound edge extend cryptic lamellipodia to collectively drive cell-sheet movement. J. Cell Sci 118, 51–63.
Fenteany, G., Janmey, P. A., and Stossel, T. P. (2000). Signaling pathways and cell mechanics involved in wound closure by epithelial cell sheets. Curr. Biol 10, 831–838.[CrossRef][Medline]
Fini, M. E., and Stramer, B. M. (2005). How the cornea heals: cornea-specific repair mechanisms affecting surgical outcomes. Cornea 24, S2–S11.[CrossRef][Medline]
Fischer, O. M., Hart, S., Gschwind, A., and Ullrich, A. (2003). EGFR signal transactivation in cancer cells. Biochem. Soc. Trans 31, 1203–1208.[Medline]
Gargett, C. E., Cornish, E. J., and Wiley, J. S. (1996). Phospholipase D activation by P2Z-purinoceptor agonists in human lymphocytes is dependent on bivalent cation influx. Biochem. J 313, (Pt 2), 529–535.[Medline]
Gipson, I. K., Spurr-Michaud, S., Argueso, P., Tisdale, A., Ng, T. F., and Russo, C. L. (2003). Mucin gene expression in immortalized human corneal-limbal and conjunctival epithelial cell lines. Invest. Ophthalmol. Vis. Sci 44, 2496–2506.
Hansen, L. A., Alexander, N., Hogan, M. E., Sundberg, J. P., Dlugosz, A., Threadgill, D. W., Magnuson, T., and Yuspa, S. H. (1997). Genetically null mice reveal a central role for epidermal growth factor receptor in the differentiation of the hair follicle and normal hair development. Am. J. Pathol 150, 1959–1975.[Abstract]
Higashiyama, S., and Nanba, D. (2005). ADAM-mediated ectodomain shedding of HB-EGF in receptor cross-talk. Biochim. Biophys. Acta 1751, 110–117.[Medline]
Jacinto, A., Martinez-Arias, A., and Martin, P. (2001). Mechanisms of epithelial fusion and repair. Nat. Cell Biol 3, E117–E123.[CrossRef][Medline]
Jane, S. M., Ting, S. B., and Cunningham, J. M. (2005). Epidermal impermeable barriers in mouse and fly. Curr. Opin. Genet. Dev 15, 447–453.[CrossRef][Medline]
Jang, A. C., Starz-Gaiano, M., and Montell, D. J. (2007). Modeling migration and metastasis in Drosophila. J. Mammary Gland Biol. Neoplasia 12, 103–114.[CrossRef][Medline]
Jenkins, G. M., and Frohman, M. A. (2005). Phospholipase D: a lipid centric review. Cell Mol. Life Sci 62, 2305–2316.[CrossRef][Medline]
Katz, M., Amit, I., and Yarden, Y. (2007). Regulation of MAPKs by growth factors and receptor tyrosine kinases. Biochim. Biophys. Acta 1773, 1161–1176.[Medline]
Klepeis, V. E., Cornell-Bell, A., and Trinkaus-Randall, V. (2001). Growth factors but not gap junctions play a role in injury-induced Ca2+ waves in epithelial cells. J. Cell Sci 114, 4185–4195.
Klepeis, V. E., Weinger, I., Kaczmarek, E., and Trinkaus-Randall, V. (2004). P2Y receptors play a critical role in epithelial cell communication and migration. J. Cell. Biochem 93, 1115–1133.[CrossRef][Medline]
Kusner, D. J., and Adams, J. (2000). ATP-induced killing of virulent Mycobacterium tuberculosis within human macrophages requires phospholipase D. J. Immunol 164, 379–388.
Le Stunff, H., Auger, R., Kanellopoulos, J., and Raymond, M. N. (2004). The Pro-451 to Leu polymorphism within the C-terminal tail of P2X7 receptor impairs cell death but not phospholipase D activation in murine thymocytes. J. Biol. Chem 279, 16918–16926.
Li, F., and Malik, K. U. (2005). Angiotensin II-induced Akt activation through the epidermal growth factor receptor in vascular smooth muscle cells is mediated by phospholipid metabolites derived by activation of phospholipase D. J. Pharmacol. Exp. Ther 312, 1043–1054.
Liu, Y., Geisbuhler, B., and Jones, A. W. (1992). Activation of multiple mechanisms including phospholipase D by endothelin-1 in rat aorta. Am. J. Physiol 262, C941–C949.[Medline]
Martin, T. W., Feldman, D. R., Goldstein, K. E., and Wagner, J. R. (1989). Long-term phorbol ester treatment dissociates phospholipase D activation from phosphoinositide hydrolysis and prostacyclin synthesis in endothelial cells stimulated with bradykinin. Biochem. Biophys. Res. Commun 165, 319–326.[CrossRef][Medline]
Mazie, A. R., Spix, J. K., Block, E. R., Achebe, H. B., and Klarlund, J. K. (2006). Epithelial cell motility is triggered by activation of the EGF receptor through phosphatidic acid signaling. J. Cell Sci 119, 1645–1654.
McDermott, M., Wakelam, M. J., and Morris, A. J. (2004). Phospholipase D. Biochem. Cell Biol 82, 225–253.[CrossRef][Medline]
McKay, M. M., and Morrison, D. K. (2007). Integrating signals from RTKs to ERK/MAPK. Oncogene 26, 3113–3121.[CrossRef][Medline]
Netto, M. V., Mohan, R. R., Ambrosio, R., Jr, Hutcheon, A. E., Zieske, J. D., and Wilson, S. E. (2005). Wound healing in the cornea: a review of refractive surgery complications and new prospects for therapy. Cornea 24, 509–522.[CrossRef][Medline]
Ohtsu, H., Dempsey, P. J., and Eguchi, S. (2006). ADAMs as mediators of EGF receptor transactivation by G protein-coupled receptors. Am J. Physiol. Cell Physiol 291, C1–C10.
Perez-Andres, E. et al. (2002). Activation of phospholipase D-2 by P2X(7) agonists in rat submandibular gland acini. J. Lipid Res 43, 1244–1255.
Pochet, S., Gomez-Munoz, A., Marino, A., and Dehaye, J. P. (2003). Regulation of phospholipase D by P2X7 receptors in submandibular ductal cells. Cell Signal 15, 927–935.[CrossRef][Medline]
Raja, Sivamani, K., Garcia, M. S., and Isseroff, R. R. (2007). Wound re-epithelialization: modulating keratinocyte migration in wound healing. Front. Biosci 12, 2849–2868.[CrossRef][Medline]
Repertinger, S. K., Campagnaro, E., Fuhrman, J., El-Abaseri, T., Yuspa, S. H., and Hansen, L. A. (2004). EGFR enhances early healing after cutaneous incisional wounding. J. Invest. Dermatol 123, 982–989.[CrossRef][Medline]
Roskoski, R., Jr. (2005). Src kinase regulation by phosphorylation and dephosphorylation. Biochem. Biophys. Res. Commun 331, 1–14.[CrossRef][Medline]
Rubinfeld, H., and Seger, R. (2005). The ERK cascade: a prototype of MAPK signaling. Mol. Biotechnol 31, 151–174.[CrossRef][Medline]
Sanderson, M. P., Dempsey, P. J., and Dunbar, A. J. (2006). Control of ErbB signaling through metalloprotease mediated ectodomain shedding of EGF-like factors. Growth Factors 24, 121–136.[CrossRef][Medline]
Schmidt, B. T., Feduska, J. M., Witt, A. M., and Deasy, B. M. (2008). Robotic cell culture system for stem cell assays. Industrial Robot 35, 116–124.[CrossRef]
Sherratt, J. A., and Dallon, J. C. (2002). Theoretical models of wound healing: past successes and future challenges. CR Biol 325, 557–564.[CrossRef]
Sponsel, H. T., Breckon, R., and Anderson, R. J. (1995). Adenine nucleotide and protein kinase C regulation of renal tubular epithelial cell wound healing. Kidney Int 48, 85–92.[Medline]
Sun, S. H., Lin, L. B., Hung, A. C., and Kuo, J. S. (1999). ATP-stimulated Ca2+ influx and phospholipase D activities of a rat brain-derived type-2 astrocyte cell line, RBA-2, are mediated through P2X7 receptors. J. Neurochem 73, 334–343.[CrossRef][Medline]
van der Bend, R. L., de Widt, J., van Corven, E. J., Moolenaar, W. H., and van Blitterswijk, W. J. (1992). The biologically active phospholipid, lysophosphatidic acid, induces phosphatidylcholine breakdown in fibroblasts via activation of phospholipase D. Comparison with the response to endothelin. Biochem. J 285, (Pt 1), 235–240.[Medline]
Wesley, U. V., Bove, P. F., Hristova, M., McCarthy, S., and van der Vliet, A. (2007). Airway epithelial cell migration and wound repair by ATP-mediated activation of dual oxidase 1. J. Biol. Chem 282, 3213–3220.
Xu, K. P., Ding, Y., Ling, J., Dong, Z., and Yu, F. S. (2004). Wound-induced HB-EGF ectodomain shedding and EGFR activation in corneal epithelial cells. Invest. Ophthalmol. Vis. Sci 45, 813–820.
Xu, K. P., Yin, J., and Yu, F. S. (2006). SRC-family tyrosine kinases in wound- and ligand-induced epidermal growth factor receptor activation in human corneal epithelial cells. Invest. Ophthalmol. Vis. Sci 47, 2832–2839.
Yang, L., Cranson, D., and Trinkaus-Randall, V. (2004). Cellular injury induces activation of MAPK via P2Y receptors. J. Cell. Biochem 91, 938–950.[CrossRef][Medline]
Yin, J., Xu, K., Zhang, J., Kumar, A., and Yu, F. S. (2007). Wound-induced ATP release and EGF receptor activation in epithelial cells. J. Cell Sci 120, 815–825.
Zhang, Q., Thomas, S. M., Lui, V. W., Xi, S., Siegfried, J. M., Fan, H., Smithgall, T. E., Mills, G. B., and Grandis, J. R. (2006). Phosphorylation of TNF-alpha converting enzyme by gastrin-releasing peptide induces amphiregulin release and EGF receptor activation. Proc. Natl. Acad. Sci. USA 103, 6901–6906.
Zhang, Q., Thomas, S. M., Xi, S., Smithgall, T. E., Siegfried, J. M., Kamens, J., Gooding, W. E., and Grandis, J. R. (2004). SRC family kinases mediate epidermal growth factor receptor ligand cleavage, proliferation, and invasion of head and neck cancer cells. Cancer Res 64, 6166–6173.
Zieske, J. D., Takahashi, H., Hutcheon, A. E., and Dalbone, A. C. (2000). Activation of epidermal growth factor receptor during corneal epithelial migration. Invest. Ophthalmol. Vis. Sci 41, 1346–1355.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
