![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 19, Issue 12, 5203-5213, December 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
*Molecular Oncogenesis Laboratory and Rome Oncogenomic Center, Experimental Oncology Department, Regina Elena Cancer Institute, 00158 Rome, Italy; and Biomolecular and Biotechnology Science Department, University of Milano, 20133 Milano, Italy
Submitted April 6, 2008;
Revised September 4, 2008;
Accepted September 17, 2008
Monitoring Editor: Richard K. Assoian
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). The NF-Y complex supports the basal transcription of a class of regulatory genes responsible for cell cycle progression, among which are mitotic cyclin complexes (Zwicker et al., 1995a,b; Bolognese et al., 1999; Farina et al., 1999; Korner et al., 2001; Gurtner et al., 2003, 2008; Di Agostino et al., 2006). Knock-out mice clearly demonstrates that NF-Y dependent transcription is essential during early mouse development (Bhattacharya et al., 2003). The NF-Y function in proliferation is also demonstrated by the inhibition of DNA binding by endogenous NF-Y, resulting in retardation of fibroblast growth, which is brought about by overexpression of a dominant negative mutant of the NF-YA subunit (Hu and Maity, 2000). The differential expression of NF-YA, altering NF-Y CCAAT-binding activity, has been observed in several cell lines and tissues both during cell cycle progression and under specific conditions. NF-YA expression is modulated during the cell cycle, being high in G1, further increasing in S, and then decreasing in the G2/M phase (Bolognese et al., 1999). Reduction of NF-YA expression has been reported in IMR-90 fibroblasts after serum deprivation (Chang et al., 1994) and in human monocytes (Marziali et al., 1997). The NF-YA protein is not expressed in terminally differentiated C2C12 muscle cells and adult skeletal muscle tissues (Farina et al., 1999; Gurtner et al., 2003, 2008). These observations show that levels of NF-YA dictate the function of the NF-Y complex. Interestingly, control of NF-YA accumulation is posttranscriptional, because NF-YA mRNA is relatively constant in growing and differentiated cells (Bolognese et al., 1999; Farina et al., 1999). Yet, the mechanisms regulating the stability of the NF-YA protein remain unknown.
The covalent addition of ubiquitin, a 76-amino acid protein highly conserved among eukaryotes, is an increasingly common posttranslation modification that controls both the expression and the activity of numerous proteins in the eukaryotic cell (Hershko and Ciechanover, 1998; Ciechanover et al., 2000). The ubiquitin–proteasome pathway is composed of the ubiquitin-conjugating system and the 26S proteasome; the latter contains the multicatalytic protease complex (Hochstrasser, 1996; Hershko and Ciechanover, 1998; Thrower et al., 2000). Frequent targets of the ubiquitin modification machinery are transcription factors (Shcherbik and Haines, 2004). Indeed, many short-lived transcription factors such as E2F-1 (Hofmann et al., 1996; Hateboer et al., 1996), IkB (Chen et al., 1996), p53 (Scheffner et al., 1990), SMAD2 (Lo and Massagué, 1999; Zhu et al., 1999), c-Jun (Treier et al., 1994), and β-catenin (Aberle et al., 1997; Orford et al., 1997; Puca et al., 2008) are regulated by ubiquitylation. Most of them are unstable proteins whose rate of destruction mirrors their ability to activate transcription. The exact nature of how activation and destruction are linked is not yet clear (Collins and Tansey, 2006; Kodadek et al., 2006).
Acetylation is a dynamic posttranslational modification of lysine residues. Proteins with intrinsic histone acetyltransferase (HAT) activity act as transcriptional coactivators by acetylating histones and thereby induce an open chromatin conformation, which allows the transcriptional machinery to access promoters. In addition to histones, some coactivators, such as p300/CBP and the P300/CBP–associated factor (PCAF), also targets transcription factors, influencing different aspects of their function (Sterner and Berger, 2000; Chan and La Thangue, 2001). An important level of regulation links acetylation levels and NF-Y activity. Functionally, inhibition of HDAC's activity by trichostatin A (TSA) treatment leads to 1) activation of the MDR1 (multidrug resistance promoter; Jin and Scotto, 1998); 2) a dramatic increase in the activity of TGF-β II receptor promoter (Park et al., 2002); and 3) activation of the HSP70 promoter in the absence of heat shock in Xenopus oocytes (Li et al., 1998). All these effects are strictly dependent on the presence of the CCAAT boxes. NF-Y interacts with hGCN5 (Currie, 1998), and NF-YB is acetylated in Xenopus by p300, but the consequences of this modification have not been addressed (Li et al., 1998). In vivo studies by chromatin immunoprecipitation on cell cycle–regulated promoters highlighted the dynamic behavior of NF-Y and HATs binding during cell cycle progression (Caretti et al., 2003; Salsi et al., 2003; Di Agostino et al., 2006).
Because of the role of ubiquitylation and acetylation in regulating the stability of several transcription factors, we investigated whether the NF-Y complex was subjected to these posttranslational modifications. In this report, we show for the first time that modulation of expression of one NF-Y subunit, NF-YA is mediated, at least in part, by the ubiquitin–proteasome degradation system. Treatment of cells with specific proteasome inhibitors leads to a significant increase of the endogenous NF-YA protein. Mutation of four lysines in the NF-YA C-terminal domain affects ubiquitylation, and the resulting protein is more stable than the wild-type form, indicating that these lysines are targeted by the ubiquitylation pathway. Two of these lysines are also target of p300 acetyl transferase activity in vitro. Our results indicate that a posttranslational molecular mechanism regulates the transcriptional activity of NF-Y controlling the stability of the regulatory subunit of the complex, NF-YA, and suggest that a competition exist between ubiquitylation and acetylation of common lysine residues of this protein.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). Transient transfections in C2C12, HCT116, and NIH3T3 cells were carried out by the BES method according to the manufacturer's protocol. In each 60-mm plate, 1.5 x 105 cells were transfected with precipitates containing suitable concentrations of each reporter construct and of CMV β-galactosidase plasmid as an internal control for transfection efficiency. Treatments with peptide aldehydes proteasome inhibitors N-Ac-Leu-Leu-norleucinal (LLnL) were for 2, 4, or 8 h at the concentration of 50 µM, whereas those with Z-Leu-Leu-Leu-H (MG132) and N-acetyl-leucyl-leucyl-methioninal (LLM), were for 4 or 8 h at the concentration of 50 µM (All reagents were provided by Sigma, St. Louis, MO). For measurement of protein half-life, cells were treated for 15 min and 2 and 3 h with cycloheximide (Chx, Calbiochem, La Jolla, CA) at the concentration of 100 µg/ml or with Chx and LLnL together at the concentration of 100 µg/ml and 50 µM, respectively. The drugs were directly added to culture medium. Cells were harvested after treatments and lysed. The intensity of each band was evaluated by densitometry using the NIH Image J 1.61 software (http://rsb.info.nih.gov/ij/; National Institutes of Health, Bethesda, MD).
The plasmids used in transfection experiments were: NF-YA and -YB eucaryotic expression vectors carrying the NF-YA and -YB open reading frame (ORF) under control of the SV40 promoter; the NF-YA green fluorescent protein (GFP) carrying a fusion protein between GFP and the NF-YA ORF under control of the SV40 promoter; and hemagglutinin (HA)-tagged ubiquitin (UbHA) carrying a fusion protein formed by an epitope of the HA and the entire open reading frame of the ubiquitin between the CMV enhancer and promoter and the SV40 polyadenylation signal (gift from Dirk Bohmann, University of Rochester, Rochester, NY). To generate NF-YA GFP mutant proteins (YA-R1, -R2, -R3, and -R2÷R3), we used the Quickchange mutagenesis kit (Stratagene, La Jolla, CA) using appropriate primers on NF-YA GFP as template. Primer sequences will be available on request. In transfection assays, pcDNA3-p300 (gift from M. Levrero, University of Rome La Sapienza, Rome, Italy) was used. In cotransfection assays, pCCAAT-B2LUC and pmutCCAAT-B2LUC (Bolognese et al., 1999) were used. LUC activity was assayed on whole cell extract, as described (Brasier et al., 1989). The values were normalized for β-galactosidase and protein contents.
Assessment of Efficiency of Expression
The expression of NF-YA and YA-R1, -R2, and -R3, as GFP fusion proteins in Figure 5C, was quantified by counting 1000 cells from five different areas (320 x 240 µm) at 0, 8, 24, and 32 h after transfection in proliferating C2C12 transfected cells. The 0-h sample represents cells reseeded after an overnight transfection and harvested immediately after attachment.
Immunolocalization of NF-YA-GFP Proteins
Cells (1 x 105) were seeded on 16-mm2 coverslips overnight and fixed the next day in 4% formaldehyde. Slides were mounted in 50% glycerol and analyzed within 24 h. Cells were counterstained with Hoechst for DNA labeling. Images were analyzed with a Zeiss fluorescence microscope (Axioskop 20; Thornwood, NY).
Immunoprecipitation and Western Blots
Total, nuclear, and cytoplasmic extracts from C2C12 cells were prepared as previously described (Farina et al., 1999). Proteins were resolved on 10% or 12% SDS-PAGE. Western blotting was performed according to the manufacturer's directions using the following primary antibodies: rabbit polyclonal 
NF-YA and -YB (Rockland, Gilbertsville, PA), cyclinB1, cyclinA, cdk1p34, p300 (Santa Cruz Biotechnology, Santa Cruz, CA), mouse monoclonal NF-YA, a Hsp70 (StessGen Biotechnologies, San Diego, CA), -tubulin (Calbiochem), FK2 from Affiniti Research Products (Exeter, United Kingdom) and -acetyl-Lys (Upstate Cell Signalling, Waltham, MA), rat monoclonal HA (Sigma). Peroxidase activity of the appropriate secondary antibodies was visualized by enhanced chemiluminescence detection system (Amersham Biosciences, Piscataway, NJ). For immunoprecipitations the following antibodies were used: mouse monoclonal NF-YA (gift of R. Mantovani, University of Milano), rabbit polyclonal NF-YB (Rockland Biosciences, Gilbertsville, PA) mouse monoclonal FK2 (Affiniti), rat monoclonal HA (Sigma), and mouse, rabbit or rat serum purified antibodies as control. Precleared extracts were incubated with protein A/G-Sepharose beads (Pierce, Rockford, IL) in lysis buffer containing 0.05% BSA and antibodies, under constant shaking at 4°C for 2 h. After incubation, Sepharose bead–bound immunocomplexes were rinsed with lysis buffer and eluted in 50 µl of SDS sample buffer for Western blotting and probed with HA antibodies (Sigma). The ubiquitin ladder was quantified by measuring the signals of the bands by NIH Image 1.61 software.
Acetyltransferase Assay
Acetyltransferase assays were performed at 30°C, for 45 min using 1 µg of substrates, 50 ng of p300 or PCAF in 30 µl of assay buffer containing 10% glycerol, 50 mM Tris HCl (pH 8), 1 mM DTT, 1 mM PMSF, 10 mM sodium butyrate and 0.1 µCi of [3H]acetyl CoA (New England Nuclear, Boston, MA). The NF-YA, H3 and H4 proteins have been purified from inclusion bodies as previously described (Mantovani et al., 1992; Caretti et al., 1999). YA9 is an His-tag protein and it has been purified as previously described (Liberati et al., 1999; Zemzoumi et al., 1999). The thioredoxin (TRX) protein has been produced from pET-32b vector from Novagen (Madison, WI) according to the manufacturer's instructions. Samples were run on 12 or 15% SDS polyacrylamide gels, stained with Coomassie brilliant blue R-250, treated with Amplify (Amersham), dried, and autoradiographed.
Elecrophoretic Mobility Shift Assays
DNA-binding reactions of Figure 7B was performed in NDB-100/BSA with 0.2–0.7 and 2 ng of NF-Y. The oligonucleotides used in electrophoretic mobility shift assays (EMSAs) were the cyclin B2 distal and middle CCAAT boxes described in Bolognese et al. (1999). Reactions were incubated for 20 min at room temperature and run in a 4.5% polyacrylamide gel (29:1 Acrylamide/Bis ratio) in 0.5x TBE at 4°C for 3 h.
RT-PCR
Total RNA from C2C12 cells was extracted using the TRIzol RNA isolation system (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. The first-strand cDNA was synthesized according to the manufacturer's instructions (M-MLV RT kit; Invitrogen). PCR was performed with HOT-MASTER Taq (Eppendorf, Fremont, CA) using 2 µl of cDNA reaction. PCR products were run on a 2% agarose gel and visualized with ethidium bromide. The sequences of oligonucleotide primers were as follows: NFYA: F5'atcccagcagccagtttggcag, R5'gaaaaatcgtccaccttcaccacg; p300: F5'atgccacagccccctattgg, R5'gagacactggtgcttgaccg.
The housekeeping aldolase A mRNA, used as an internal standard, was amplified from the same cDNA reaction mixture using the following specific primers: F5'tggatgggctgtctgaacgctgt and R5'agtgacagcagggggcactgt.
Small Interfering RNA Transfection
Human HCT116 cells were seeded at a density of 1.6 x 106 in 100-mm culture dishes in DMEM medium supplemented with 10% FBS. The next day, cells were transfected using Lipofectamine 2000 reagent (Invitrogen) following the manufacturer's instructions with 10 µl of 0.02 mM p300 small interfering RNA (siRNA; 5'-AAC CCC UCC UCU UCA GCA CCA-3'; Dharmacon Research, Boulder, CO), or nontargeting siRNA scramble (Dharmacon, Lafayette, CO) as a negative control.
Colony Formation Assay
NIH3T3 cells were cotransfected with wild-type NF-YA or its mutants (YA-R1, YA-R2, and YA-R3) and pBABE-PURO (10:1 ratio). The cells were selected in 2 µg/ml puromycin (Sigma) at 48 h after transfection, and the colonies were stained and counted 2 wk later. Plates were stained with 0.5 ml of 0.005% Crystal Violet for >1 h, and colonies were counted using a dissecting microscope.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
; Gurtner et al., 2003, 2008). Thus, we asked whether regulation of NF-YA expression occurs at posttranslational level in this cell system. To this end, myotubes were treated with LLnL and levels of NF-YA, -YB, and -YC were analyzed. (Figure 1A). We observed an increase of NF-YA protein prevalently in the nucleus but also in the cytoplasm.
|
). In myoblasts, MG132 treatment led to an increase of NF-YA in the cytoplasm. In contrast LLM had no effect on NF-YA protein levels (Figure 1B). As a positive control, we analyzed p53 protein level in the same experimental conditions, and we observed that, as expected, it accumulated in the nuclear fraction after both treatments. Both LLnL and MG132 inhibit the proteasome pathway (Wang 1990), whereas LLM is a strong inhibitor of calpain and cathepsin but a very weak inhibitor of the proteasome (Rock et al., 1994). Thus, inhibition of proteasome, but not of a cysteine protease, pathway results in NF-YA accumulation (Figure 1B). Taken together, these results indicate that NF-YA expression is markedly regulated at posttranslational level. In contrast, the levels of the YB and YC subunits are slightly affected by the proteasome inhibitors, suggesting that the modulation of expression of the NF-YA subunit could dictate the activity of the NF-Y trimer.
The Half-Life of NF-YA Is Increased by Proteasome Inhibition
Because ubiquitin-mediated protein destruction has been mainly implicated for short-lived proteins, we sought to determine the half-life of NF-YA. C2C12 cells were incubated with Chx (100 µg/ml) for 15 and 30 min and 1, 2, or 3 h. As shown in Figure 2A, by densitometric analysis, the amount of NF-YA protein decreased by 
50% after 2 h. In contrast to this, the steady-state levels of NF-YB were not modulated in the same experimental conditions, indicating that the half-life of these proteins is longer than 3 h.
|
NF-YA Protein Is Ubiquitylated In Vivo
To determine the involvement of ubiquitylation in NF-YA degradation, a fusion protein formed by an epitope of the HA and the entire open reading frame of the UbHA (Treier et al., 1994) was cotransfected in C2C12 cells with a vector coding for NF-YA. Total cell extracts were immunoprecipitated with increasing amounts of anti-NF-YA antibody. Western blot analysis detected smeared high-molecular-weight species, characteristic of ubiquitylated proteins, both with anti-HA (Figure 3A) and anti-NF-YA (Figure 3B) antibodies. Increasing amounts of anti-NF-YA antibody immunoprecipitated increasing amount of these protein forms. Reciprocal immunoprecipitation experiments showed that NF-YA putative ubiquitylated forms are present in the smeared high-molecular-weight species immunoprecipitated with the anti-HA antibody (Figure 3C). These species were not detected in immunoprecipitates with control antibody. In the same experimental conditions, low levels of high-molecular-weight species were detected in extract immunoprecipitated with anti-NF-YB antibody from C2C12 cells cotransfected with vectors coding for NF-YB and UbHA, suggesting that this subunit is ubiquitylated to a lesser extent than NF-YA (Figure 3D). This result is in agreement with the minimal effect of LLnL on NF-YB protein levels shown above.
|
Ub; Fujimuro and Yokosawa, 2005). A twin filter was immunoblotted with anti-NF-YA rabbit polyclonal antibody. As shown in Figure 4A, the FK2 antibody recognized a smeared ladder in the anti-NF-YA immunoprecipitates. This antibody does not recognize the 43-kDa NF-YA protein that correspond to the posttranslational unmodified form (Farina et al., 1999; Gurtner et al., 2003). A similar ladder and unmodified NF-YA protein were recognized by anti-NF-YA antibody (Figure 4B). In good agreement with this, reciprocal immunoprecipitation experiments demonstrated that anti-NF-YA antibody recognized a smeared ladder in the immunoprecipitates performed with FK2 antibody, indicating that the smeared ladder contains ubiquitylated NF-YA protein (Figure 4C). In both experiments, no protein ladder was detected in immunoprecipitates performed with the control antibody. Taken together, these data strongly indicate that both exogenous and endogenous NF-YA is ubiquitylated in vivo and suggest that the ubiquitin–proteasome pathway degrades it.
|
|
70% (Figure 6C), whereas formation of ubiquitylated forms was essentially not inhibited in the YA-R1 mutant, in good agreement with its reduced stability (Figure 5D). We conclude that lysines K283, K289, K292, and K296 are those mainly ubiquitylated in the contest of the NF-YA protein.
|
). To investigate whether lysines target for ubiquitylation undergo p300-dependent acetylation, we used recombinant purified p300 and NF-YA in vitro acetylation studies (Figure 7A). As expected, p300 was able to self-acetylate and also acetylated recombinant full length NF-YA. Mapping the region acetylated by p300 using deletion mutant, we observed that the deletion mutant YA9, which contains all the ubiquitylated lysines, was acetylated in vitro by p300, clearly indicating that this conserved part of the protein is efficiently posttranslationally modified. As expected, the negative control, TRX, was not acetylated in the same experimental conditions. As positive control we analyzed the acetylation status of H3-H4 histones.
|
p300 Expression Impacts on NF-YA Ubiquitylation
Theoretically, acetylation of specific lysines could increase the stability of a protein, because it would prevent ubiquitylation of the same lysine residues. To determine if p300 could affect the expression of NF-YA, C2C12 cells were transfected with p300. The amount of NF-YA was slightly increased in the presence of ectopic p300 (Figure 8A). We verified the presence of ubiquitylated NF-YA forms in lysates of C2C12 cells cotransfected with p300 and NF-YA. Consistent with the higher stability of the protein, we observed that formation of ubiquitylated NF-YA forms was inhibited in cells overexpressing p300 compared with no p300 (Figure 8B), suggesting that p300 acetylation of NF-YA could prevent, at least in part, its ubiquitylation. Next, we assessed the function of p300 in normal physiological settings, employing siRNA against p300. To this end, human HCT116 cells were transfected with an oligo pool directed against p300 (sip300; Gong et al., 2006) or, as control, an unrelated sequence (scramble), and incubated in the presence of Chx, which blocks de novo protein synthesis. Cellular extracts were prepared 2 h after Chx addition, and levels of NF-YA and p300 proteins were determined by Western blot analysis. As shown in Figure 8C, p300 loss did not alter NF-YA half-life in untreated cells. However, in the presence of Chx, the antibody against NF-YA detected high-molecular-weight species in cells interfered for p300, suggesting the presence of NF-YA putative ubiquitylated forms. Taken together, these results indicate that p300 could increase the stability of NF-YA, suggesting that its acetylation might enhance its expression, potentially by interfering with the ubiquitin–proteasome pathway.
|
Acetylation and Ubiquitylation of NF-YA Protein in Pre- and Postmitotic Cells
To begin to investigate the functional relationship between acetylation and ubiquitylation of NF-YA, we analyzed the relative abundance of acetylated and ubiquitylated NF-YA species in nuclear and cytoplasmic cell compartments. For this purpose, C2C12 protein extracts were immunoprecipitated with anti-NF-YA and subsequently blotted with FK2 and anti-acetyl-lysine antibodies (Figure 9A). We observed that the nuclear compartment contained higher levels of acetylated NF-YA protein in comparison to the cytoplasmic one. Conversely, ubiquitylated NF-YA forms were more abundant in the cytoplasm. Of note, a strong decrease in acetylation was observed if an artificial increase of ubiquitylated NF-YA forms was induced in the nucleus with LLnL treatment (Figure 9B). These results support the hypothesis that acetylated NF-YA protein, acting as a transcription factor in the nucleus, is the active form, whereas the nonactive ubiquitylated form is prevalently stored in the cytoplasm. If this hypothesis is correct, we would expect that in postmitotic cells, where we have previously demonstrated absence of NF-Y activity (Farina et al., 1999; Gurtner et al., 2003; Gurtner et al., 2008), only ubiquitylated NF-YA species are expressed. As already shown in Figure 1A, myotubes express NF-YA only after treatment with LLnL. Thus, nuclear extracts from myotubes treated with LLnL were immunoprecipitated with anti-NF-YA and subsequently blotted with FK2 and anti-acetyl-lysine antibodies. As shown in Figure 9C, only ubiquitylated NF-YA species were present in differentiated nuclei under these experimental conditions (Figure 9C). Taken together, these results determine that the nuclei of premitotic cells contain mainly acetylated NF-YA protein, whereas in postmitotic cells, where NF-Y does not exert its activity, the protein is only ubiquitylated.
|
|
Forced Expression of a Stable NF-YA Protein Sustains Expression of Its Target Genes and Influences Cell Proliferation
To further support the hypothesis that a stable NF-YA protein could influence the expression of NF-Y target genes, we followed the expression of cyclin B1, cyclin A, and cdk1 (Farina et al., 1999; Manni et al., 2001; Gurtner et al., 2003, 2008; Imbriano et al., 2005; Di Agostino et al., 2006) after overexpression of wild-type NF-YA or mutant YA-R3 protein. As shown in Figure 11, in cells transfected with wild-type NF-YA, expression of these genes declined paralleling NF-YA decrease. In contrast, their expression was sustained in cells transfected with stable mutant YA-R3. Interestingly, the upward mobility shift of the cdk1 protein suggests phosphorylation and activation of this protein.
|
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
B, E2F1, β-catenin, and p53 need to be modulated to trigger their activation. Their intracellular levels are regulated by the ubiquitin/proteasome degradation pathway and it is clear that changes in their steady-state levels can influence the activity of the corresponding target genes (Scheffner et al., 1990; Treier et al., 1994; Chen et al., 1996; Hofmann et al., 1996; Aberle et al., 1997; Kodadek et al., 2006). Of note, many of these proteins are also acetylated. (Hofmann et al., 1996; Zhang and Bieker, 1999). Histones acetyl transferase enzymes, such as p300, serve multiple roles and are believed to target many, if not most, genes.
The results presented in this study reveal that both the ubiquitin–proteasome pathway and the acetylation status regulate the expression and the functional activity of the transcription factor NF-Y. We demonstrate that NF-YA undergoes the two different modifications targeting partially overlapping lysine residues. Our results open a scenario in which NF-YA acetylation of specific lysines might prevent subsequent ubiquitylation of the same residues, thereby inhibiting its proteasome-mediated degradation. Because NF-Y is important for promoter activation, it came as no surprise that interactions between this factor and p300 surfaced. Indeed, dynamic recruitment of p300 together with NF-Y, has been documented on cell cycle regulated promoters (Caretti et al., 2003; Salsi et al., 2003; Di Agostino et al., 2006; Gurtner et al., 2008).
NF-Y is composed of three subunits: NF-YA, -YB, and -YC. Although amounts of the NF-YB and -YC subunits are relatively constant, NF-YA protein expression fluctuates (Chang and Liu 1994; Marziali et al., 1997; Bolognese et al., 1999; Farina et al., 1999; Gurtner et al., 2003; Gurtner et al., 2008), indicating that it is the regulatory subunit of the trimer. In agreement with this hypothesis we observed that NF-YA, but not -YB and -YC expression, is regulated by the ubiquitin/proteasome pathway. Our studies on the NF-YA protein half-life strongly support the notion that the protein is regulated at posttranslational level. Indeed the half-life of NF-YA, which is 2 h in proliferating cells, is increased by inhibition of the proteosome pathway. This effect is specific for the NF-YA subunit, because no modulation of the NF-YB subunit half-life was observed in the same experimental conditions. Further we provide evidence that endogenous NF-YA is a substrate for ubiquitylation in vivo. This result, together with the finding that NF-YA is accumulated after proteasome inhibition, strongly indicates that the ubiquitin/proteasome pathway degrade this subunit.
The COOH terminus of NF-YA is highly conserved across species (Mantovani 1998). Indeed, in this region reside the domains essential for the function of the trimer: the interaction domain with the NF-YB and -YC dimer and the DNA-binding domain. On the basis of this, we reasoned that the six lysines present in this region might be also essential for regulation of NF-YA protein stability. Mutant proteins carrying amino acid substitutions of potential ubiquitylation sites in the COOH terminus of NF-YA (lysines K283, K289, K292, and K296) are more stable than wild-type protein. In agreement with this, mutation of these lysines markedly prevents the ubiquitylation of NF-YA protein, thus suggesting that these lysines play a major role in NF-YA protein stability. In contrast to this, the other two lysines present in the COOH terminus, K269 and K276, appear to be less involved in the regulation of NF-YA stability.
Interestingly, we have observed that two of the NF-YA ubiquitylated lysines are also target of p300 acetylation in vitro. Moreover, modulation of p300 abundance through ectopic expression or siRNA, impacts on NF-YA expression influencing formation of ubiquitylated NF-YA forms, suggesting that p300-mediated acetylation of NF-YA could prevent at least in part its ubiquitylation, potentially by interfering with the ubiquitin–proteasome pathway. Thus, our data suggest that competition between ubiquitylation and acetylation of overlapping lysine residues might constitute a mechanism to regulate NF-YA protein stability. Of note, the limited but significant conservation of these lysines suggests that NF-YA protein stability might be regulated in a similar manner in different species.
It has been demonstrated that ubiquitin-dependent proteolysis of several transcription factors regulates their transcriptional activity. For example after DNA damage, the largest subunit of RNA pol II is selectively targeted for ubiquitin-mediated proteolysis and this limits transcription until DNA damage is repaired (Krogan et al., 2004; Somesh et al., 2005). HIF-1 can be physiologically degraded through the ubiquitin-dependent proteasome pathway, and this negatively impacts on its transcriptional activity (Liu et al., 2007; Wei and Yu, 2007). On the contrary, in some cases, the activity of the proteasome is required for transcription. Transcriptional activation by the progesterone receptor is inhibited by drugs that inhibit the proteasome (Dennis et al., 2005); ubiquitylation of Gcn4, and the proteolytic function of the proteasome are necessary for transcription mediated by this factor (Lipford et al., 2005); Gal4 ubiquitylation and destruction are required for activation by Gal4. Defects in the ubiquitylation and stability of this transcriptional activator leads to inappropriate phosphorylation of RNA pol II and pre-mRNA processing (Muratani et al., 2005). Our data support the hypothesis that also the cellular function of NF-Y is regulated at the level of protein stability. We observed that a more stable NF-YA protein still retains and enhances its transcriptional activity sustaining the expression of target genes, cdk1, cyclin A, and cyclin B1. Thus, in the case of NF-YA, the ubiquitin-dependent proteasome pathway negatively impacts on NF-Y transcriptional activity. In good agreement with this, we observed that the NF-YA fraction in the nucleus, where it is suppose to act as transcription factor, is more acetylated than the cytoplasmic one, whereas the ubiquitylated form is prevalently stored in the cytoplasm. Moreover, we observed that the nuclei of premitotic cells contain largely acetylated NF-YA protein, whereas in postmitotic cells, where NF-Y does not exert its activity, NF-YA protein is only ubiquitylated.
Finally, we observed that degradation-resistant NF-YA mutants increase cell proliferation. As discussed above, these mutants also sustain expression of NF-Y target genes. Thus, one possibility is that these mutants increase cell proliferation through the up-regulation of NF-Y target genes. NF-Y could serve as a common transcription factor for an increasing number of cell cycle control genes (Elkon et al., 2003). This suggests that the more stable NF-YA protein could also sustain the expression of other genes involved in cell cycle progression, known to be targets of NF-Y. In agreement with this, the levels of NF-Y activity in the cells strongly influences cell proliferation. It has been reported that inhibition of NF-YA expression blocks cell cycle progression in G1 and G2 (Hu and Maity, 2000) and the knock out of the NF-YA subunit in mice leads to embryo lethality (Bhattacharya et al., 2003). Thus, there may be specific mechanisms for limiting free NF-Y levels, failure of which would compromise cell survival and/or homeostasis. The destruction of NF-YA by Ub-mediated proteolysis could be one of the mechanisms that the cells have evolved to keep the activity of NF-Y tightly regulated.
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
Address correspondence to: Giulia Piaggio (piaggio{at}ifo.it)
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Bhattacharya, A., Deng, J. M., Zhang, Z., Behringer, R., de Crombrugghe, B., and Maity, S. N. (2003). The B subunit of the CCAAT box binding transcription factor complex CBF/NF-Y) is essential for early mouse development and cell proliferation. Cancer Res 63, 8167–8172.
Bolognese, F., Wasner, F., Dohna, C. L., Gurtner, A., Ronchi, A., Muller, H., Manni, I., Mossner, J., Piaggio, G., Mantovani, R., and Engeland, K. (1999). The cyclin B2 promoter depends on NF-Y, a trimer whose CCAAT-binding activity is cell cycle regulated. Oncogene 18, 1845–1853.[CrossRef][Medline]
Brasier, A. R., Tate, J. E., and Habener, J. F. (1989). Optimized use of the firefly luciferase assay as a reporter gene in mammalian cell lines. Biotechniques 7, 1116–1122.[Medline]
Caretti, G., Motta, M. C., and Mantovani, R. (1999). NF-Y associates with H3–H4 tetramers and octamers by multiple mechanisms. Mol. Cell. Biol 19, 8591–8603.
Caretti, G., Salsi, V., Vecchi, C., Imbriano, C., and Mantovani, R. (2003). Dynamic recruitment of NF-Y and histone acetyltransferases on cell-cycle promoters. J. Biol. Chem 278, 30435–30440.
Chan, H. M., and La Thangue, N. B. (2001). p300/CBP proteins: HATs for transcriptional bridges and scaffolds. J. Cell Sci 4, 2363–2373.
Chang, Z. F., and Liu, C. J. (1994). Human thymidine kinase CCAAT-binding protein is NF-Y, whose A subunit expression is serum-dependent in human IMR-90 diploid fibroblasts. J. Biol. Chem 26, 17893–17898.
Chen, Z. J., Parent, L., and Maniatis, T. (1996). Site-specific phosphorylation of IkappaBalpha by a novel ubiquitination-dependent protein kinase activity. Cell 84, 853–862.[CrossRef][Medline]
Ciechanover, A., Orian, A., and Schwartz, A. L. (2000). Ubiquitin-mediated proteolysis: biological regulation via destruction. BioEssays 22, 442–451.[CrossRef][Medline]
Collins, G. A., and Tansey, W. P. (2006). The proteasome: a utility tool for transcription. Curr. Opin. Genet Dev 16, 197–202.[CrossRef][Medline]
Currie, R. A. (1998). Biochemical characterization of the NF-Y transcription factor complex during B lymphocyte development. J. Biol. Chem 273, 1430–1434.
Dennis, A. P., Lonard, D. M., Nawaz, Z., and O'Malley, B. W. (2005). Inhibition of the 26S proteasome blocks progesterone receptor-dependent transcription through failed recruitment of RNA polymerase II. J. Steroid. Biochem. Mol. Biol 94, 337–346.[CrossRef][Medline]
Di Agostino, S., Strano, S., Emiliozzi, V., Zerbini, V., Mottolese, M., Sacchi, A., Blandino, G., and Piaggio, G. (2006). Gain of function of mutant p53, the mutant p53/NF-Y protein complex reveals an aberrant transcriptional mechanism of cell cycle regulation. Cancer Cell 10, 191–202.[CrossRef][Medline]
Elkon, R., Linhart, C., Sharan, R., Shamir, R., and Shiloh, Y. (2003). Genome-wide in silico identification of transcriptional regulators controlling the cell cycle in human cells. Genome Res 13, 773–780.
Farina, A., Manni, I., Fontemaggi, G., Tiainen, M., Cenciarelli, C., Bellorini, M., Mantovani, R., Sacchi, A., and Piaggio, G. (1999). Down-regulation of cyclin B1 gene transcription in terminally differentiated skeletal muscle cells is associated with loss of functional CCAAT-binding NF-Y complex. Oncogene 18, 2818–2827.[CrossRef][Medline]
Fujimuro, M., and Yokosawa, H. (2005). Production of antipolyubiquitin monoclonal antibodies and their use for characterization and isolation of polyubiquitinated proteins. Methods Enzymol 399, 75–86.[CrossRef][Medline]
Gong, J., Zhu, J., Goodman, O. B., Jr., Pestell, R. G., Schlegel, P. N., Nanus, D. M., and Shen, R. (2006). Activation of p300 histone acetyltransferase activity and acetylation of the androgen receptor by bombesin in prostate cancer cells. Oncogene 25, 2011–2021.[CrossRef][Medline]
Gurtner, A., Fuschi, P., Magi, F., Colussi, C., Gaetano, C., Dobbelstein, M., Sacchi, A., and Piaggio, G. (2008). NF-Y dependent epigenetic modifications discriminate between proliferating and postmitotic tissue. PlosOne 3, e2047.
Gurtner, A., Manni, I., Fuschi, P., Mantovani, R., Guadagni, F., Sacchi, A., and Piaggio, G. (2003). Requirement for down-regulation of the CCAAT-binding activity of the NF-Y transcription factor during skeletal muscle differentiation. Mol. Biol. Cell 14, 2706–2715.
Hateboer, G., Kerkhoven, R. M., Shvarts, A., Bernards, R., and Beijersbergen, R. L. (1996). Degradation of E2F by the ubiquitin-proteasome pathway: regulation by retinoblastoma family proteins and adenovirus transforming proteins. Genes Dev 10, 2960–2970.
Hershko, A., and Ciechanover, A. (1998). The ubiquitin system. Annu. Rev. Biochem 67, 425–749.[CrossRef][Medline]
Hochstrasser, M. (1996). Ubiquitin-dependent protein degradation. Annu. Rev. Genet 30, 405–439.[CrossRef][Medline]
Hofmann, F., Martelli, F., Livingston, D. M., and Wang, Z. (1996). The retinoblastoma gene product protects E2F-1 from degradation by the ubiquitin-proteasome pathway. Genes Dev 10, 2949–2959.
Hu, Q., and Maity, S. N. (2000). Stable expression of a dominant negative mutant of CCAAT binding factor/NF-Y in mouse fibroblast cells resulting in retardation of cell growth and inhibition of transcription of various cellular genes. J. Biol. Chem 275, 4435–4444.
Imbriano, C., Gurtner, A., Cocchiarella, F., Di Agostino, S., Basile, V., Gostissa, M., Dobbelstein, M., Del Sal, G., Piaggio, G., and Mantovani, R. (2005). Direct p53 transcriptional repression: in vivo analysis of CCAAT-containing G2/M promoters. Mol. Cell. Biol 25, 3737–3751.
Jin, S., and Scotto, K. W. (1998). Transcriptional regulation of the MDR1 gene by histone acetyltransferase and deacetylase is mediated by NF-Y. Mol. Cell. Biol 18, 4377–4384.
Kodadek, T., Sikder, D., and Nalley, K. (2006). Keeping transcriptional activators under control. Cell 127, 261–264.[CrossRef][Medline]
Korner, K., Jerome, V., Schmidt, T., and Muller, R. (2001). Cycle regulation of the murine cdc25B promoter: essential role for nuclear factor-Y and a proximal repressor element. J. Biol. Chem 276, 9662–9669.
Krogan, N. J., Lam, M. H., Fillingham, J., Keogh, M. C., Gebbia, M., Li, J., Datta, N., Cagney, G., Buratowsky, S., Emili, S., and Greenblatt, J. F. (2004). Proteasome involvement in the repair of DNA double-strand breaks. Mol. Cell 16, 1027–1034.[CrossRef][Medline]
Li, Q., Herrler, M., Landsberger, N., Kaludov, N., Ogryzko, V. V., Nakatani, Y., and Wolffe, A. P. (1998). Xenopus NF-Y pre-sets chromatin to potentiate p300 and acetylation-responsive transcription from the Xenopus hsp70 promoter in vivo. EMBO J 17, 6300–6315.[CrossRef][Medline]
Liberati, C., di Silvio, A., Ottolenghi, S., and Mantovani, R. (1999). NF-Y binding to twin CCAAT boxes: role of Q-rich domains and histone fold helices. J. Mol. Biol 29, 1441–1455.
Lipford, J. R., Smith, G. T., Chi, Y., and Deshaies, R. J. (2005). A putative stimulatory role for turnover in gene expression. Nature 438, 113–116.[CrossRef][Medline]
Liu, Y. V., Baek, J. H., Zhang, H., Diez, R., Cole, R. N., and Semenza, G. L. (2007). RACK1 competes with HSP90 for binding to HIF-1 and is required for O2-independent and HSP90 inhibitor-induced degradation of HIF-1. Mol. Cell 25, 207–217.[CrossRef][Medline]
Lo, R. S., and Massagué, J. (1999). Ubiquitin-dependent degradation of TGFbeta- activated Smad2. Nat. Cell Biol 1, 472–478.[CrossRef][Medline]
Manni, I., Mazzaro, G., Gurtner, A., Mantovani, R., Haugwitz, U., Krause, K., Engeland, K., Sacchi, A., Soddu, S., and Piaggio, G. (2001). NF-Y mediates the transcriptional inhibition of the cyclin B1, cyclin B2, and cdc25C promoters upon induced G2 arrest. J. Biol. Chem 276, 5570–5576.
Mantovani, R., Pessara, U., Tronche, F., Li, X. Y., Knapp, A. M., Pasquali, J. L., Benoist, C., and Mathis, D. (1992). Monoclonal antibodies to NF-Y define its function in MHC class II and albumin gene transcription. EMBO J 11, 3315–3322.[Medline]
Mantovani, R. (1998). A survey of 178 NF-Y binding CCAAT boxes. Nucleic Acids Res 26, 1135–1143.
Mantovani, R. (1999). The molecular biology of the CCAAT boxes. Nucleic Acids Res 26, 1135–1143.
Marziali, G., Perrotti, E., Ilari, R., Testa, U., Coccia, E. M., and Battistini, A. (1997). Transcriptional regulation of the ferritin heavy-chain gene: the activity of the CCAAT binding factor NF-Y is modulated in heme-treated Friend leukemia cells and during monocyte-to-macrophage differentiation. Mol. Cell. Biol 17, 1387–1395.
Muratani, M., Kung, C., Shokat, K. M., and Tansey, W. P. (2005). The F box protein Dsg1/Mdm30 is a transcriptional coactivator that stimulates Gal4 turnover and cotranscriptional mRNA processing. Cell 120, 887–899.[CrossRef][Medline]
Orford, K., Crockett, C., Jensen, J. P., Weissman, A. M., and Byers, S. W. (1997). Serine phosphorylation-regulated ubiquitination and degradation of beta-catenin. J. Biol. Chem 272, 24735–24738.
Park, S. H. et al. (2002). Transcriptional regulation of the transforming growth factor beta type II receptor gene by histone acetyltransferase and deacetylase is mediated by NF-Y in human breast cancer cells. J. Biol. Chem 277, 5168–5174.
Puca, R., Nardinocchi, L., and D'Orazi, G. (2008). Regulation of vascular endothelial growth factor expression by homeodomain-interacting protein kinase-2. J. Exp. Clin. Cancer Res 27, 22–28.[CrossRef][Medline]
Rock, K. L., Gramm, C., Rothstein, L., Clark, K., Stein, R., Dick, L., Hwang, D., and Goldberg, A. L. (1994). Inhibitors of the proteasome block the degradation of most cell proteins and the generation of peptides presented on MHC class I molecules. Cell 78, 761–771.[CrossRef][Medline]
Salsi, V., Caretti, G., Wasner, M., Reinhard, W., Haugwitz, U., Engeland, K., and Mantovani, R. (2003). Interactions between p300 and multiple NF-Y trimers govern cyclin B2 promoter function. J. Biol. Chem 278, 6642–6650.
Scheffner, M., Werness, B. A., Huibregtse, J. M., Levine, A. J., and Howley, P. M. (1990). The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell 63, 1129–1136.[CrossRef][Medline]
Shcherbik, N., and Haines, D. S. (2004). Ub on the move. J. Cell. Biochem 93, 11–19.[CrossRef][Medline]
Somesh, B. P., Reid, J, Liu, W.-F., Søgaard, T.M.M., Erdjument-Bromage, H., Tempst, P., and Svejstrup, J. Q. (2005). Multiple mechanisms confining RNA polymerase II ubiquitination to polymerases undergoing transcriptional arrest. Cell 121, 913–923.[CrossRef][Medline]
Sterner, D. E., and Berger, S. H. (2000). Acetylation of histones and transcription-related factors. Mol. Biol. Rev 64, 435–459.
Thrower, J. S., Hoffman, L., Rechsteiner, M., and Pickart, C. M. (2000). Recognition of the polyubiquitin proteolytic signal. EMBO J 19, 94–102.[CrossRef][Medline]
Treier, M., Staszewski, L. M., and Bohmann, D. (1994). Ubiquitin-dependent c-Jun degradation in vivo is mediated by the delta domain. Cell 78, 787–798.[CrossRef][Medline]
Wang, K.K.W. (1990). Developing selective inhibitors of calpain. Trends Pharmacol. Sci 11, 139–142.[CrossRef][Medline]
Wei, W., and Yu, X. D. (2007). Hypoxia-inducible factors: crosstalk between their protein stability and protein degradation. Cancer Lett 257, 145–156.[CrossRef][Medline]
Zemzoumi, K., Frontini, M., Bellorini, M., and Mantovani, R. (1999). NF-Y histone fold alpha1 helices help impart CCAAT specificity. J. Mol. Biol 19, 327–337.
Zhang, W., and Bieker, J. (1999). Acetylation and modulation of erythroid Krüppel-like factor (EKLF) activity by interaction with histone acetyltransferases. Proc. Natl. Acad. Sci. USA 95, 9855–9860.[CrossRef]
Zhu, H., Kavsak, P., Abdollah, S., Wrana, J. L., and Thomsen, G. H. (1999). A SMAD ubiquitin ligase targets the BMP pathway and affects embryonic pattern formation. Nature 400, 687–693.[CrossRef][Medline]
Zwicker, J., Gross, C., Lucibello, F. C., Truss, M., Ehlert, F., Engeland, K., and Muller, R. (1995a). Cell cycle regulation of cdc25C transcription is mediated by the periodic repression of the glutamine-rich activators NF-Y and Sp1. Nucleic Acids Res 23, 3822–3830.
Zwicker, J., Lucibello, F. C., Wolfraim, L. A., Gross, C., Truss, M., Engeland, K., and Muller, R. (1995b). Cell cycle regulation of the cyclin A, cdc25C and cdc2 genes is based on a common mechanism of transcriptional repression. EMBO J 14, 4514–4522.[Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
