![]() |
|
|
Vol. 19, Issue 12, 5347-5359, December 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Cell Biology, The Scripps Research Institute, La Jolla, CA 92037
Submitted August 29, 2008;
Revised October 1, 2008;
Accepted October 3, 2008
Monitoring Editor: David G. Drubin
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
100-kDa multidomain GTPase that was first identified as a microtubule binding and bundling protein (Shpetner and Vallee, 1989
The best-studied cellular function of dynamin is its involvement in clathrin-mediated endocytosis (CME; Hinshaw, 2000
; Sever et al., 2000
; Praefcke and McMahon, 2004
). However, dynamin has also been implicated in several other membrane-trafficking events including both caveolae-mediated and clathrin- and caveolin-independent endocytic pathways (Henley et al., 1998
; Oh et al., 1998
; Lamaze et al., 2001
; Pelkmans et al., 2002
), phagocytosis (Gold et al., 1999
; Yu et al., 2006
), macropinocytosis (Schlunck et al., 2004
), and trafficking from the trans-Golgi network (TGN; Jones et al., 1998
; Kreitzer et al., 2000
; Bonazzi et al., 2005
). Because these functions have mostly emerged from studying the effects of overexpression of dominant-negative dynamin mutants, they may reflect indirect or nonspecific effects. Moreover, it is not known whether different dynamin isoforms and/or splice variants participate in distinct membrane-trafficking events (McNiven et al., 2000
).
Recent studies have also implicated dynamin in cellular processes other than membrane trafficking. For example, dynamin may play significant roles in regulating actin assembly and reorganization via its interactions with many actin-binding proteins (Orth and McNiven, 2003
; Schafer, 2004
; Itoh et al., 2005
; Kruchten and McNiven, 2006
). Dyn2, but not Dyn1 can function as a signaling GTPase to trigger p53-dependent apoptosis (Fish et al., 2000
). Interestingly, this signaling activity does not require dynamin's ability to self-assemble into the collar-like structures linked to membrane fission in CME (Soulet et al., 2006
). Moreover, analysis of Dyn2/Dyn1 chimeras has shown that Dyn2's signaling activity is conferred by its GTPase domain, despite its high degree of sequence identity with Dyn1. It has also been suggested that dynamin plays a role in cytokinesis (Konopka et al., 2006
). Dynamin mutations prevent cleavage furrow completion in Drosophila embryos and small interfering RNA (siRNA)-mediated knockdown causes a cytokinesis defect in C. elegans. Dyn2 has been localized to the centrosome and its knockdown has been suggested to cause a centrosome cohesion defect in mammalian cells (Thompson et al., 2002
; Konopka et al., 2006
). The mechanisms guiding these diverse dynamin-mediated processes remain to be established.
The multiple cellular functions that have been reported for dynamins would suggest that the different dynamin isoforms and/or splice variants might have different specific functions (McNiven et al., 2000
). However, because dynamin is a tetramer (Hinshaw and Schmid, 1995
; Ramachandran et al., 2007
), overexpression of dominant-negative mutants—the approach most commonly taken to study dynamin function in vivo—might not distinguish subtle isoform and splice variant differences due to the formation of hetero-tetramers and nonselective dominant interference of all endogenous dynamin isoforms. Therefore, to identify isoform- and/or splice-variant–specific functions of dynamin, it would be necessary to perform isoform-specific knockout and reconstitution experiments. In support of this approach, it was recently shown (Ferguson et al., 2007
) that Dyn1 KO synapses exhibited a less severe phenotype than obtained with dominant-negative dynamin mutants, such as shibire (Koenig and Ikeda, 1989
) or with the dynamin inhibitor, dynasore (Newton et al., 2006
). These authors also provided evidence for isoform-specific function at the synapse because reexpression of either Dyn1 or Dyn3, but only to a lesser degree by Dyn2, could rescue the defect in Dyn1 KO neurons (Ferguson et al., 2007
).
Here we report the generation and characterization of a Dyn2 conditional KO fibroblastoid cell line that has allowed us to define isoform and splice-variant specific functions of the ubiquitously expressed dynamin isoform.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Differentiation and Immortalization of Dyn2flox/– ES cells
Maintenance and growth of the Dyn2flox/– ES cells was performed as previously described (Conner, 2001
). Differentiation of the Dyn2flox/– ES cells involved growth of the ES cells in suspension for 5 d, giving rise to embryoid bodies (EBs). The EBs were then subsequently plated on adherent tissue culture dishes, and differentiation and growth continued in the presence of DMEM with high glucose (4500 mg/l), 2 mM L-glutamine, and sodium pyruvate, containing 10% (vol/vol) FCS (Hyclone, Logan, UT), 1x MEM nonessential amino acids (from 100x stock), and 20 mM HEPES, pH 7.3. Passage of the adherent cells continued for four passage cycles, and immortalization was performed.
Dyn2flox/– cells were immortalized by infection with amphotropic retroviruses harboring the large T antigen from SV40 (kindly given by Peiqing Sun, The Scripps Research Institute). Clones of fibroblastoid-like cells were then generated after immortalization. These fibroblastoid Dyn2flox/– cells were maintained in MEM with 10% FCS for no more than 30 passages. To excise exon 1, the cells were infected with adenovirus expressing Cre recombinase (Vector Biolaboratories, Burlingame, CA).
Antibodies
Anti-Dyn1 antibody (ab3456) was purchased from Abcam (Cambridge, MA) and anti-Dyn2 antibody (sc-6400) was from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-β-tubulin antibody (T-4026) was from Sigma (St. Louis, MO) and anti-actin antibody (MAB1501R) was from Chemicon International (Temecula, CA). Anti-Dyn3 polyclonal serum was generously provided by S. Ferguson and P. De Camilli (Yale) because we found that the commercially available anti-Dyn3 antibody (Abcam, ab3458) recognized a nonspecific band of 100 kDa in all of our cell lysates. The rabbit anti-pan-dynamin (748) was generated in our lab and hemagglutinin (HA; 12CA5) antibodies were purified from hybridomas obtained from Ian Wilson (TSRI).
Retroviral Transduction and Fluorescence-activated Cell Sorting
HA-tagged human Dyn1 (ba) or rat Dyn2 (aa, ab, ba, and bb) were cloned into the retrovirus vector pMIEG3 containing an internal ribosome entry site allowing expression of enhanced green fluorescent protein (MIEG3-EGFP; Yang et al., 2006
). Alternatively, HA-Dyn1 (ba) or HA-Dyn2 (ba) were fused to GFP on their C-termini and used to generate retroviruses. Retroviral supernatant was prepared by using the Phoenix packaging cell system, and subsequent infection was carried out in the presence of 8 µg/ml Polybrene (Sigma) according to the described protocols (Guo and Zheng, 2004
). Cells were harvested 48 h after infection and GFP-positive cells with low expression levels were isolated using fluorescence-activated cell sorting (FACS).
Cell Cycle Distribution Analysis
Analysis of cell cycle distribution was determined by propidium iodide (PI) staining and flow cytometry. Cells were harvested by trypsinization and 70% cold ethanol fixation overnight. Cells were then washed in PBS and resuspended in PBS containing 10 µg/ml PI and 250 µg/ml RNase A. Cells were incubated at 37°C for 1 h before flow cytometric analysis. Histograms of the PI signal were obtained using FlowJo software (Tree Star, Ashland, OR).
Adenovirus Infection
Cells were coinfected with adenovirus expressing the tetracycline regulatable transactivator (tTA) and adenovirus encoding either HA-Dyn1K44A or HA-Dyn2K44A under control of a tetracycline-regulatable promoter as previous described (Fish et al., 2000
). Control cells were infected only with the tTA-adenovirus. Endocytosis assays were performed
24 h after infection.
Genotype and Protein Expression Analysis
To analyze the knockout efficiency of Cre adenovirus infection, total cellular DNA was isolated with DNeasy Blood and Tissue kit (QIAGEN, Chatsworth, CA), and the region of Dyn2 exon 1 was amplified with the primer pair: Dyn2-3515, CAGGTTGACGTTTCTGCGACCATTA, and Dyn2-4369, CAGCCATAGCCGGAACTAGAAGCAC (as Figure 1A indicates) in PCR. To analyze protein expression, lysates were obtained from cells after different times of Cre adenoviral infection and analyzed by Western blotting using anti-Dyn2 antibodies or anti-pan dynamin antibodies as indicated.
Endocytosis Assay
Transferrin internalization were performed as described (van der Bliek et al., 1993
) using biotinylated transferrin (Tfn) as ligand and assessing its internalization into an avidin-inaccessible compartment. For cholera toxin B (CTB) uptake, cells on coverslips were incubated with 1 µg/ml Alexa fluor-594 CTB (Invitrogen, Carlsbad, CA) for 30 min at 4°C and then shifted to 37°C medium to allow internalization. Cells were washed extensively with cold PBS and acid buffer (150 mM NaCl, 150 mM glycine, pH 2.0) and then fixed and mounted for fluorescence microscopy. Internalization of lactosylceramide (LacCer) was analyzed as described in Antonescu et al. (2008)
with some modification. Briefly, cells on coverslips were washed with cold PBS++ (PBS with 1 mM CaCl2 and 1 mM MgCl2) and incubated with 5 µg/ml BODIPY FL C5-LacCer (Molecular Probes, Eugene, OR) in PBS++ for 1 h at 4°C. After washing off unbound LacCer with ice-cold PBS+, cells were incubated with warm media for 5 min at 37°C and then arrested with two washes of ice-cold PBS++. LacCer remaining at the cell surface was then removed by six 10-min washes in 2% (wt/vol) defatted BSA (Sigma) at 10°C. After fixation and mounting, the cells were viewed under an epi-fluorescence microscope.
To analyze macropinocytosis, cells were starved in 0.2% serum for 16 h and then incubated with 1 mg/ml HRP with or without 10 ng/ml PDGF for 10 min in 37°C. The uptake was stopped by transferring to 4°C, and cells were washed six times with cold PBS++ containing 0.2% BSA. Cells were trypsinized, harvested, and lysed. Then the cleared lysate was assayed for enzyme activity and protein concentration.
p75 TGN Export Assay
The TGN-exit assay of p75-mRFP (from E. Rodriguez-Boulan, Weill Medical College of Cornell University, New York, NY) was performed as described (Bonazzi et al., 2005
) with some modification. Briefly, the cells transfected with p75-monermeric red fluorescent protein (mRFP) were incubated overnight in complete medium. To accumulate p75-mRPF in the TGN and deplete newly synthesized p75-mRPF from the early secretory pathway, the cells were incubated 3.5 h at 20°C in bicarbonate-free medium and 0.5 h under the same condition with 100 µg/ml cycloheximide. To monitor p75 exit from the TGN, the temperature was shifted to 32°C, and the samples were fixed with 4% paraformaldehyde at the indicated time.
Microscopy
For indirect immunofluorescence staining, cells cultured overnight on poly-lysine–coated coverslips were fixed for 40 min with 4% paraformaldehyde and permeabilized with 0.05% saponin. After blocking with 2% BSA, cells were stained with either anti-HA or anti-β- tubulin antibodies. To detect actin, after 5 min PDGF or mock treatment and PBS wash, cells were fixed, permeabilized, and stained with Alexa Fluor 568-phalloidin (Invitrogen).
For Dyn1 and -2 localization, cells expressing either GFP-tagged dynamin or HA-tagged dynamin were fixed and permeabilized simultaneously with 2% warm paraformaldehyde and 0.5% Triton X-100 for 2 min, to reduce cytosolic background staining, and then fixed with 4% paraformaldehyde for 40 min. After immunofluorescence staining or mounting alone, cells were observed under wide-field epifluorescence microscopy using an inverted Olympus IX-70 microscope (Melville, NY).
| RESULTS |
|---|
|
|
|---|
|
Dyn2 KO Cells Exhibit Growth and Cytokinesis Defects
Dyn2 has been reported to function in chromosome cohesion (Thompson et al., 2004
) and in cytokinesis (Thompson et al., 2002
), and indeed we found that after excision of Dyn2 by Cre recombinase, the cells (hereafter referred to as Dyn2 KO cells) grew more slowly than the control (Dyn2flox/–) cells (Supplemental Figure S2A). PI staining and flow cytometric analysis of the DNA content did not reveal a specific defect in cell cycle progression (Supplemental Figure S2B), nor did we detect an increase in the percentage of multinucleate cells by DAPI staining (data not shown). We also did not detect an increase in apoptosis. However, given the strong evidence for a role for dynamin in cytokinesis in C. elegans and other organisms (Konopka et al., 2006
), we used real-time imaging to monitor cell division in control and Dyn2 KO cells (Supplemental Movies S1 and S2). Consistent with the DNA content analysis, both control and KO cells progressed through mitosis, from prophase to telophase, with similar kinetics (23.00 ± 13.08 and 24.00 ± 6.00 min, respectively). However, the time required for completion of the midbody separation in KO cells was significantly longer than in control cells. Compared with an average of 54 min for cytokinesis in control cells, even after 2.5 h of imaging, many Dyn2 KO cells still had not completed cytokinesis. Given the delay in midbody scission, we used immunofluorescence staining of β-tubulin to detect midbodies in control (Figure 2A) and Dyn2 KO cells (Figure 2, B and C), as an assay for this late cytokinesis defect. As expected, we found that the percentage of Dyn2 KO cells with detectable midbodies was higher than in control cells (Figure 2D). We also detected examples in which daughter Dyn2 KO cells were connected with long membrane tethers consistent with a late block in cytokinesis and suggesting that adherent daughter cells might complete cytokinesis as they migrate away from each other (Figure 2, B and C).
|
Dyn2 Is Specifically Required for Clathrin-mediated Endocytosis in Fibroblastoid Cells
Overexpression studies have suggested that Dyn1 and -2 also play functionally redundant roles in clathrin-mediated endocytosis (Altschuler et al., 1998
). Therefore, given the partial knockdown of total dynamin in these cells, we did not expect to see a strong defect in CME. However, CME of Tfn was inhibited by
80% in Dyn2 KO cells (Figure 3A), more than we would expect based on the proportional reduction of total dynamin. Moreover, overexpression of the dominant-negative Dyn1K44A mutant only slightly increased the level of inhibition of Tfn uptake (Figure 3B), indicating that the residual Tfn uptake in Dyn2 KO cells was both dynamin- and clathrin-independent. These data suggest that CME in these nonneuronal cells is preferentially dependent on Dyn2 compared with Dyn1.
|
10 times higher than endogenous levels, it could restore the Tfn uptake defect in Dyn2 KO cells to 80–90% of control (data not shown).
|
Together, these data show that in these nonneuronal cells, Dyn2 is significantly more effective than Dyn1 in supporting CME.
Dyn2 Is Required for PDGF-stimulated Macropinocytosis, But Not for Other Endocytic Pathways
Multiple, mechanistically distinct endocytic pathways operate in mammalian cells (Conner and Schmid, 2003
). To determine which of these might also specifically require Dyn2, we examined the uptake of other ligands and receptor classes. CTB is internalized by both caveolae-dependent and other raft-dependent endocytic pathways, which have been shown to be inhibited both by antibody microinjection and by overexpression of dominant negative dynamin mutants (Henley et al., 1998
; Oh et al., 1998
, Pelkmans et al., 2002
). We were unable to detect significant inhibition of CTB internalization in our Dyn2 KO cells (Figure 5A), although we confirmed findings of others that the overexpression of a dominant negative mutant Dyn2K44A blocks CTB uptake in our fibroblasts (Figure 5B). Similar results were obtained using BODIPY-LacCer, which is reported to be a more specific probe for caveolae-mediated endocytosis (Singh et al., 2003
; Figure 5C). Because overexpressed Dyn2K44A will dominantly interfere with the function of both endogenous Dyn2 and -1 isoforms, the more potent effect of dominant-negative overexpression suggests that the remaining Dyn1 may be sufficient to support CTB uptake in the Dyn2 KO cells. Alternatively, the overexpressed Dyn2K44A may inhibit CTB uptake through indirect effects or by sequestering some other essential component. Regardless these results indicate that Dyn2 is not specifically required for CTB or caveolae endocytosis.
|
The GEEC pathway has also been suggested to be responsible for the bulk of constitutive fluid phase endocytosis in mammalian cells (Kirkham et al., 2005
). Indeed, we found that constitutive fluid-phase endocytosis of HRP was not inhibited in Dyn2 KO cells (Figure 6A, serum-starved cells). Macropinocytosis, which is induced upon stimulation by growth factors, involves the actin-driven formation of membrane protrusions that engulf large volumes of fluids. There are conflicting reports as to a role for dynamin in macropinocytosis (Meier et al., 2002
; Schlunk et al., 2004
; Cao et al., 2007
). Macropinocytosis in our Dyn2 KO cells can be triggered by stimulation with PDGF, resulting in a transient, sixfold, increase in fluid phase uptake (Figure 6A, PDGF). This PDGF-stimulated increase in fluid phase endocytosis of HRP is partially inhibited in the Dyn2 KO cells to a degree that is roughly proportional to the extent of knockdown of total dynamin (i.e.,
50%). This suggests that both isoforms may function in PDGF-stimulated macropinocytosis and indeed, reintroduction of either Dyn1 or -2 restores full activity in this assay (Figure 6A).
|
Dyn2 Is Specifically Required for p75 Export from the TGN
There are conflicting reports as to whether dynamin plays a general role in transport of proteins from the TGN to the plasma membrane (Damke et al., 1994
; Altschuler et al., 1998
; Jones et al., 1998
; Kasai et al., 1999
), and more recent results suggest that dynamin's function in some TGN trafficking events might be cell-type specific (Bonazzi et al., 2005
). Nonetheless, there is a strong consensus for a requirement of Dyn2 in the export of the apical plasma membrane marker, p75/neurotrophin receptor, from the TGN (Kreitzer et al., 2000
; Bonazzi et al., 2005
). However, because these findings are based on overexpression of dominant-negative dynamin mutants, it is not known whether this represents an isoform-specific function of Dyn2. To test this we transfected Dyn2 KO cells with p75-mRFP overnight and then allowed newly synthesized protein to accumulate in the TGN by incubating cells for 4 h at 20°C. We then examined the efficiency of depletion of the TGN pool upon shift to 32°C. Whereas the accumulated p75-mRFP had left the TGN within 40 min in
70% of heterozygous control cells, its export was severely impaired in Dyn2 KO cells (Figure 7, A and C). This defect was rescued upon reintroduction of Dyn2, but not Dyn1 (Figure 7, B and C). Thus, although both of these dynamin isoforms can localize to the Golgi compartment (Figure 4B), the export of p75 from the TGN appears to be another isoform-specific function of Dyn2.
|
|
| DISCUSSION |
|---|
|
|
|---|
Perhaps the biggest surprise from these studies is our finding that clathrin-mediated endocytosis in these nonneuronal cells is preferentially supported by Dyn2 and is only weakly supported by Dyn1. This result, although unexpected, is complementary to findings from analysis of Dyn1 KO mice on isoform-specific functions of dynamin at the synapse (Ferguson et al., 2007
). These studies revealed that Dyn1 was specifically required for rapid synaptic vesicle recycling under conditions of intense stimulation, but was dispensable for synaptic vesicle recycling under steady-state conditions. Interestingly, neuronal Dyn3 redistributed to the synapse in Dyn1 KO mice, presumably to compensate for the loss of Dyn1 in mediating endocytosis and synaptic vesicle recycling, whereas Dyn2 remained diffusely distributed. Moreover, overexpression of Dyn1 or Dyn3 fully rescued the endocytosis defect in cultured Dyn1 KO neurons, whereas Dyn2 was much less effective. Similarly, others have reported that the rapid versus slow endocytic pathways trigger by stimulation of chromaffin cells are differentially sensitive to microinjected Dyn1 versus Dyn2 antibodies, respectively (Artelejo et al., 2002
). Thus, together these results suggest that the neuronal-specific Dyn1 and -3 isoforms have adapted to function during rapid stimulus-induced endocytosis, whereas Dyn2 has adapted to support constitutive CME in nonneuronal cells.
Dyn1 and -2 are 79% similar in their sequences and both are equally similar to the single dynamin isoforms in Drosophila and C. elegans. What might account for their differential ability to support CME in nonneuronal cells? We observed that Dyn2 colocalizes with endocytic coated pits to a greater extent than Dyn1; thus, this differential efficiency of targeting may contribute to their functional differences. However, studies with Dyn1-GFP have shown that it is recruited to clathrin-coated pits in nonneuronal cells before vesicle release (Merrifield et al., 2002
), and thus other factors must also contribute to this striking functional difference. We list three, not mutually exclusive, possibilities. First, the differential activities may reflect differences in their biochemical and enzymatic properties. Most biochemical analyses have focused on Dyn1; however, previous studies have shown that Dyn2 has a higher propensity for self-assembly compared with Dyn1 and may have a higher basal rate of GTP hydrolysis (Warnock et al., 1997
; Lin et al., 1997
). Interestingly, nonconserved residues in the PH domain have been shown to confer isoform-specific functions that distinguish Dyn1 and -2 activity in compensatory endocytosis in adrenal cells (Artelejo et al., 1997
). A more careful and thorough comparison of Dyn1 and -2 enzymatic activities and biochemical properties may reveal differences that account for their differing activities in CME. A second possibility is that Dyn1 and -2 interact differentially with different partner proteins. These partners could either differentially affect dynamin's biochemical properties or its intracellular targeting. Most dynamin partners interact with dynamin through its C-terminal proline/arginine domain (PRD). These domains are indeed the most divergent between the two isoforms, although they are both highly basic (pI
12) and proline rich (30%). Although most dynamin partners have been identified from analysis of brain lysates, to our knowledge when tested they have been shown to bind to both Dyn1 and -2. However, in light of our findings, it will be interesting to look for Dyn2-specific binding partners in nonneuronal cell lysates. A third possibility relates to differential regulation of the two dynamin isoforms by posttranslational modification (Cousin and Robinson, 2001
). Both dynamin isoforms are known to be phosphorylated in vivo, and it may be that regulatory kinases and/or phosphatases necessary for Dyn1 function are not present or properly regulated in nonneuronal cells. Further experiments will be necessary to test these three possibilities.
As was observed for synaptic vesicle recycling, overexpression of dominant-negative dynamin mutants inhibited a broader set of endocytic pathways than did knockout of a single dynamin isoform. These data suggest that the remaining Dyn1 is functional in nonneuronal cells for mediating other forms of endocytosis that, for example, lead to CTB uptake. Dyn1 was also able to support PDGF-stimulated macropinocytosis as effectively as Dyn2. Thus, Dyn1 is not completely inactive in nonneuronal cells. From these data we can also infer that the mechanism for Dyn1 and -2 function in PDGF-stimulated macropinocytosis is distinct from the mechanism for Dyn2 function in CME.
There are conflicting results as to the requirement for dynamin in macropinocytosis. Others have reported that dominant-negative mutants of dynamin do not inhibit adenovirus-stimulated macropinocytosis (Meier et al., 2002
) or vaccinia-virus induced macropinocytosis (Mercer and Helenius, 2008
) and that microinjection of Dyn2 antibodies or siRNA depletion of Dyn2 does not inhibit EGF-stimulated macropinocytosis (Cao et al., 2007
). In contrast, and consistent with our findings, overexpression of dominant-negative Dyn2 was previously shown to inhibit PDGF-stimulated macropinocytosis in Rat1 cells (Schlunk et al., 2004
). It will be interesting to determine whether the differential requirement for dynamin reflects the different stimuli used to induce macropinocytosis. Are there mechanistically distinct macropinocytic pathways or might dynamin be differentially involved in the signaling pathways that lead to actin reorganization and macropinocytosis in response to these different stimuli?
A role for dynamin in cytokinesis has been shown in both C. elegans and Drosophila; however, our study provides the first direct evidence that mammalian dynamin is also required for cytokinesis. Although we cannot rule out earlier effects of the Dyn2 deficiency on cytokinesis, we observed daughter cells connected with long membrane tubules in Dyn2 KO cells and an accumulation of midbodies, suggesting a late stage defect in cytokinesis, possibly in membrane fission. Membrane fission in cytokinesis is, however, topologically distinct from membrane fission leading to vesicle release. In the latter, the dynamin collar must initiate membrane fission on the noncytoplasmic leaflet of the membrane, whereas in cytokinesis, fission must occur between cytoplasmic leaflets of the adjacent membranes. Thus, dynamin might serve other functions in cytokinesis, for example in vesicular trafficking (Albertson et al., 2005
). Alternatively, the role for dynamin in cytokinesis may reflect its activities in actin regulation. Interestingly, Dyn1 and -2 were functionally redundant for both cytokinesis and macropinocytosis, two actin-dependent processes. It will be important to identify dynamin mutants that uncouple these potentially distinct activities.
Finally, our in vivo reconstitution experiments are the first to analyze the functional specificity of the four Dyn2 splice variants in the absence of endogenous Dyn2. Although each has similar activities in supporting CME, our data suggests that the b variant of the first splice site within the middle domain is required for targeting Dyn2ba and Dyn2bb to the TGN and in enabling their function in p75 export from the Golgi. The middle domain can be subdivided into a more highly conserved N-middle, mutations in which impair dynamin oligomerization (Ramachandran et al., 2007
) and a more divergent C-middle, which bears the two Dyn2 splice regions (Schmid et al., 1998
). These data suggest that the C-middle domain might function in intracellular targeting. Further studies will be needed to determine the mechanism by which this splice variation affects this function.
Our results differ from a previous study that suggested that the a variant of the second splice site was required for Golgi targeting (Cao et al., 1998
). Because there is direct evidence for cell type differences in a dynamin requirement for VSV-G (vesicular stomatitis virus glycoprotein) export from the Golgi (Bonazzi et al., 2005
), these differences may also reflect real differences between the epithelial cells used by Cao et al. and the fibroblastoid cells we have studied. The Dyn1 splice variant we used (Dyn1ba) was most related to Dyn2ba, and although it was targeted to the Golgi, it was not able to support p75 export from the TGN. Thus the functional distinction between Dyn1 and -2 isoforms is most likely a reflection of their different abilities to support vesicle formation (at the TGN or PM) rather than a targeting defect. Importantly, given the inability of Dyn1 to support p75 export the splice variant specificity we have observed could not be due to differential hetero-oligomer formation with endogenous Dyn1.
Our unexpected finding that Dyn2 is more effective than Dyn1 in supporting CME in nonneuronal cells and our identification of other Dyn2-specific functions coupled to the fact that Dyn2 mutants are linked to human neuropathies (Niemann et al., 2006
) calls for more detailed functional analysis of Dyn2, a relatively understudied, yet ubiquitously expressed isoform of dynamin.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Address correspondence to: Sandra L. Schmid (slschmid{at}scripps.edu)
| REFERENCES |
|---|
|
|
|---|
Altschuler, Y., Barbas, S. M., Terlecky, L. J., Tang, K., Hardy, S., Mostov, K. E., and Schmid, S. L. (1998). Redundant and distinct functions for dynamin-1 and dynamin-2 isoforms. J. Cell Biol 143, 1871–1881.
Antonescu, C. N., Díaz, M., Femia, G., Planas, J. V., and Klip, A. (2008). Clathrin-dependent and independent endocytosis of glucose transporter 4 (GLUT4) in myoblasts: regulation by mitochondrial uncoupling. Traffic 9, 1173–1190.[CrossRef][Medline]
Artalejo, C. R., Lemmon, M. A., Schlessinger, J., and Palfrey, H. C. (1997). Specific role for the PH domain of dynamin-1 in the regulation of rapid endocytosis in adrenal chromaffin cells. EMBO J 16, 1565–1574.[CrossRef][Medline]
Artalejo, C. R., Elhamdani, A., and Palfrey, H. C. (2002). Sustained stimulation shifts the mechanism of endocytosis from dynamin-1-dependent rapid endocytosis to clathrin- and dynamin-2-mediated slow endocytosis in chromaffin cells. Proc. Natl. Acad. Sci. USA 99, 6358–6363.
Bonazzi, M. et al. (2005). CtBP3/BARS drives membrane fission in dynamin-independent transport pathways. Nat. Cell Biol 7, 570–580.[CrossRef][Medline]
Cao, H., Chen, J., Awoniyi, M., Henley, J. R., and McNiven, M. A. (2007). Dynamin 2 mediates fluid-phase micropinocytosis in epithelial cells. J. Cell Sci 120, 4167–4177.
Cao, H., Garcia, F., and McNiven, M. A. (1998). Differential distribution of dynamin isoforms in mammalian cells. Mol. Biol. Cell 9, 2595–2609.
Chen, M. S., Obar, R. A., Schroeder, C. C., Austin, T. W., Poodry, C. A., Wadsworth, S. C., and Vallee, R. B. (1991). Multiple forms of dynamin are encoded by shibire, a Drosophila gene involved in endocytosis. Nature 351, 583–586.[CrossRef][Medline]
Conner, D. A. (2001). Mouse embryonic stem (ES) cell culture. Curr. Protoc. Mol. Biol 4, 23.3.1–23.3.6. Chapter 23.
Conner, S. D., and Schmid, S. L. (2003). Regulated portals of entry into the cell. Nature 422, 37–44.[CrossRef][Medline]
Cousin, M. A., and Robinson, P. J. (2001). The dephosphins: dephosphorylation by calcineurin triggers synaptic vesicle endocytosis. Trends Neurosci 24, 659–665.[CrossRef][Medline]
Damke, H., Baba, T., Warnock, D. E., and Schmid, S. L. (1994). Induction of mutant dynamin specifically blocks endocytic coated vesicle formation. J. Cell Biol 127, 915–934.
Ferguson, S. M. et al. (2007). A selective activity-dependent requirement for dynamin 1 in synaptic vesicle endocytosis. Science 316, 570–574.
Fish, K. N., Schmid, S. L., and Damke, H. (2000). Evidence that dynamin-2 functions as a signal-transducing GTPase. J. Cell Biol 150, 145–154.
Gold, E. S., Underhill, D. M., Morrissette, N. S., Guo, J., McNiven, M. A., and Aderem, A. (1999). Dynamin 2 is required for phagocytosis in macrophages. J. Exp. Med 190, 1849–1856.
Guo, F., and Zheng, Y. (2004). Rho family GTPases cooperate with p53 deletion to promote primary mouse embryonic fibroblast cell invasion. Oncogene 23, 5577–5585.[CrossRef][Medline]
Henley, J. R., Krueger, E. W., Oswald, B. J., and McNiven, M. A. (1998). Dynamin-mediated internalization of caveolae. J. Cell Biol 141, 85–99.
Hinshaw, J. E. (2000). Dynamin and its role in membrane fission. Annu. Rev. Cell Dev. Biol 16, 483–519.[CrossRef][Medline]
Hinshaw, J. E., and Schmid, S. L. (1995). Dynamin self-assembles into rings suggesting a mechanism for coated vesicle budding. Nature 374, 190–192.[CrossRef][Medline]
Itoh, T., Erdmann, K. S., Roux, A., Habermann, B., Werner, H., and De Camilli, P. (2005). Dynamin and the actin cytoskeleton cooperatively regulate plasma membrane invagination by BAR and F-BAR proteins. Dev. Cell 9, 791–804.[CrossRef][Medline]
Jones, S. M., Howell, K. E., Henley, J. R., Cao, H., and McNiven, M. A. (1998). Role of dynamin in the formation of transport vesicles from the trans-Golgi network. Science 279, 573–577.
Kasai, K., Shin, H. W., Shinotsuka, C., Murakami, K., and Nakayama, K. (1999). Dynamin II is involved in endocytosis but not in the formation of transport vesicles from the trans-Golgi network. J. Biochem 125, 780–789.
Kirkham, M., Fujita, A., Chadda, R., Nixon, S. J., Kurzchalia, T. V., Sharma, D. K., Pagano, R. E., Hancock, J. F., Mayor, S., and Parton, R. G. (2005). Ultrastructural identification of uncoated caveolin-independent early endocytic vehicles. J. Cell Biol 168, 465–476.
Koenig, J. H., and Ikeda, K. (1989). Disappearance and reformation of synaptic vesicle membrane upon transmitter release observed under reversible blockage of membrane retrieval. J. Neurosci 9, 3844–3860.[Abstract]
Konopka, C. A., Schleede, J. B., Skop, A. R., and Bednarek, S. Y. (2006). Dynamin and cytokinesis. Traffic 7, 239–247.[CrossRef][Medline]
Kreitzer, G., Marmorstein, A., Okamoto, P., Vallee, R., and Rodriguez-Boulan, E. (2000). Kinesin and dynamin are required for post-Golgi transport of a plasma-membrane protein. Nat. Cell Biol 2, 125–127.[CrossRef][Medline]
Kruchten, A. E., and McNiven, M. A. (2006). Dynamin as a mover and pincher during cell migration and invasion. J. Cell Sci 119, 1683–1690.
Krueger, E. W., Orth, J. D., Cao, H., and McNiven, M. A. (2003). A dynamin-cortactin-Arp2/3 complex mediates actin reorganization in growth factor-stimulated cells. Mol. Biol. Cell 14, 1085–1096.
Lamaze, C., Dujeancourt, A., Baba, T., Lo, C. G., Benmerah, A., and Dautry-Varsat, A. (2001). Interleukin 2 receptors and detergent-resistant membrane domains define a clathrin-independent endocytic pathway. Mol. Cell 7, 661–671.[CrossRef][Medline]
Lin, H. C., Barylko, B., Achiriloaie, M., and Albanesi, J. P. (1997). Phosphatidylinositol (4,5)-bisphosphate-dependent activation of dynamins I and II lacking the proline/arginine-rich domains. J. Biol. Chem 272, 25999–26004.
McNiven, M. A., Cao, H., Pitts, K. R., and Yoon, Y. (2000). The dynamin family of mechanoenzymes: pinching in new places. Trends Biochem. Sci 25, 115–120.[CrossRef][Medline]
Oeier, O., Boucke, K., Hammer, S. V., Keller, S., Stidwill, R. P., Hemmi, S., and Greber, U. F. (2002). Adenovirus triggers macropinocytosis and endosomal leakage together with its clathrin-mediated uptake. J. Cell Biol 158, 1119–1131.
Mercer, J., and Helenius, A. (2008). Vaccinia virus uses macropinocytosis and apoptotic mimicry to enter host cells. Science 320, 531–535.
Merrifield, C. J., Feldman, M. E., Wan, L., and Almers, W. (2002). Imaging actin and dynamin recruitment during invagination of single clathrin-coated pits. Nat. Cell Biol 4, 691–698.[CrossRef][Medline]
Newton, A. J., Kirchhausen, T., and Murthy, V. N. (2006). Inhibition of dynamin completely blocks compensatory synaptic vesicle endocytosis. Proc. Natl. Acad. Sci. USA 103, 17955–17960.
Niemann, A., Berger, P., and Suter, U. (2006). Pathomechanisms of mutant proteins in Charcot-Marie-Tooth disease. Neuromolecular Med 8, 217–242.[CrossRef][Medline]
Oh, P., McIntosh, D. P., and Schnitzer, J. E. (1998). Dynamin at the neck of caveolae mediates their budding to form transport vesicles by GTP-driven fission from the plasma membrane of endothelium. J. Cell Biol 141, 101–114.
Orth, J. D., and McNiven, M. A. (2003). Dynamin at the actin-membrane interface. Curr. Opin. Cell Biol 15, 31–39.[CrossRef][Medline]
Pelkmans, L., Püntener, D., and Helenius, A. (2002). Local actin polymerization and dynamin recruitment in SV40-induced internalization of caveolae. Science 296, 535–539.
Praefcke, G. J., and McMahon, H. T. (2004). The dynamin superfamily: universal membrane tubulation and fission molecules? Nat. Rev. Mol. Cell Biol 5, 133–147.[CrossRef][Medline]
Ramachandran, R., Surka, M., Chappie, J. S., Fowler, D. M., Foss, T. R., Song, B. D., and Schmid, S. L. (2007). The dynamin middle domain is critical for tetramerization and higher-order self-assembly. EMBO J 26, 559–566.[CrossRef][Medline]
Rappoport, J. Z., and Simon, S. M. (2003). Real-time analysis of clathrin-mediated endocytosis during cell migration. J. Cell Sci 1116, 847–855.
Sabharanjak, S., Sharma, P., Parton, R. G., and Mayor, S. (2002). GPI-anchored proteins are delivered to recycling endosomes via a distinct cdc42-regulated, clathrin-independent pinocytic pathway. Dev. Cell 2, 411–423.[CrossRef][Medline]
Schafer, D. A. (2004). Regulating actin dynamics at membranes: a focus on dynamin. Traffic 5, 463–469.[CrossRef][Medline]
Schlunck, G., Damke, H., Kiosses, W. B., Rusk, N., Symons, M. H., Waterman-Storer, C. M., Schmid, S. L., and Schwartz, M. A. (2004). Modulation of Rac localization and function by dynamin. Mol. Biol. Cell 15, 256–267.
Schmid, S. L., McNiven, M. A., and De Camilli, P. (1998). Dynamin and its partners: a progress report. Curr. Opin. Cell Biol 10, 504–512.[CrossRef][Medline]
Sever, S., Damke, H., and Schmid, S. L. (2000). Garrotes, springs, ratchets, and whips: putting dynamin models to the test. Traffic 1, 385–392.[CrossRef][Medline]
Shpetner, H. S., and Vallee, R. B. (1989). Identification of dynamin, a novel mechanochemical enzyme that mediates interactions between microtubules. Cell 59, 421–432.[CrossRef][Medline]
Singh, R. D., Puri, V., Valiyaveettil, J. T., Marks, D. L., Bittman, R., and Pagano, R. E. (2003). Selective caveolin-1-dependent endocytosis of glycosphingolipids. Mol. Biol. Cell 14, 3254–3265.
Soulet, F., Yarar, D., Leonard, M., and Schmid, S. L. (2005). SNX9 regulates dynamin assembly and is required for efficient clathrin-mediated endocytosis. Mol. Biol. Cell 16, 1058–2067.
Soulet, F., Schmid, S. L., and Damke, H. (2006). Domain requirements for an endocytosis-independent, isoform-specific function of dynamin-2. Exp. Cell Res 312, 3539–3545.[CrossRef][Medline]
Thompson, H. M., Cao, H., Chen, J., Euteneuer, U., and McNiven, M. A. (2004). Dynamin 2 binds gamma-tubulin and participates in centrosome cohesion. Nat. Cell Biol 6, 335–342.[CrossRef][Medline]
Thompson, H. M., Skop, A. R., Euteneuer, U., Meyer, B. J., and McNiven, M. A. (2002). The large GTPase dynamin associates with the spindle midzone and is required for cytokinesis. Curr. Biol 12, 2111–2117.[CrossRef][Medline]
Urrutia, R., Henley, J. R., Cook, T., and McNiven, M. A. (1997). The dynamins: redundant or distinct functions for an expanding family of related GTPases? Proc. Natl. Acad. Sci. USA 94, 377–384.
van der Bliek, A. M., and Meyerowitz, E. M. (1991). Dynamin-like protein encoded by the Drosophila shibire gene associated with vesicular traffic. Nature 351, 411–414.[CrossRef][Medline]
van der Bliek, A. M., Redelmeier, T. E., Damke, H., Tisdale, E. J., Meyerowitz, E. M., and Schmid, S. L. (1993). Mutations in human dynamin block an intermediate stage in coated vesicle formation. J. Cell Biol 122, 553–563.
Warnock, D. E., Baba, T., and Schmid, S. L. (1997). Ubiquitously expressed dynamin-II has a higher intrinsic GTPase activity and a greater propensity for self-assembly than neuronal dynamin-I. Mol. Biol. Cell 8, 2553–2562.
Yang, L., Wang, L., and Zheng, Y. (2006). Gene targeting of Cdc42 and Cdc42GAP affirms the critical involvement of Cdc42 in filopodia induction, directed migration, and proliferation in primary mouse embryonic fibroblasts. Mol. Biol. Cell 17, 4675–4685.
Yu, X., Odera, S., Chuang, C. H., Lu, N., and Zhou, Z. (2006). C. elegans dynamin mediates the signaling of phagocytic receptor CED-1 for the engulfment and degradation of apoptotic cells. Dev. Cell 10, 743–757.[CrossRef][Medline]
Related articles in Mol. Biol. Cell:
This article has been cited by other articles:
![]() |
S. B. Salvarezza, S. Deborde, R. Schreiner, F. Campagne, M. M. Kessels, B. Qualmann, A. Caceres, G. Kreitzer, and E. Rodriguez-Boulan LIM Kinase 1 and Cofilin Regulate Actin Filament Population Required for Dynamin-dependent Apical Carrier Fission from the Trans-Golgi Network Mol. Biol. Cell, January 1, 2009; 20(1): 438 - 451. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||