![]() |
|
|
Vol. 19, Issue 2, 735-744, February 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

*Section of Molecular Genetics and Microbiology and the Institute for Cellular and Molecular Biology, University of Texas at Austin, Austin, TX 78712; and
Molecular, Cell, and Developmental Biology, University of California Santa Cruz, Santa Cruz, CA 95064
Submitted September 26, 2007;
Revised November 6, 2007;
Accepted November 28, 2007
Monitoring Editor: Karsten Weis
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
In yeast the large and small ribosomal subunits are assembled in the nucleolus and exported to the cytoplasm separately but in a Crm1-dependent manner (Moy and Silver, 1999
; Ho et al., 2000b
; Stage-Zimmermann et al., 2000
; Gadal et al., 2001
). Nmd3 is an essential nucleocytoplasmic shuttling protein that contains a leucine-rich NES and is required for Crm1-dependent export of the 60S subunit (Ho et al., 2000b
; Gadal et al., 2001
; Thomas and Kutay, 2003
; Trotta et al., 2003
). However, several questions arise regarding the export of ribosomal subunits. Transport of large cargo molecules is enhanced by the presence of multiple receptors (Ribbeck and Gorlich, 2001
). Thus, the ribosomal subunits might also employ multiple receptors. In addition, the channel of the NPC is comprised of disordered FG repeat–containing nucleoporins that form a mesh through weak hydrophobic interactions (Ribbeck and Gorlich, 2001
; Denning et al., 2003
; Patel et al., 2007
). The highly electronegative ribosomal subunits likely require additional proteins to present hydrophobic surfaces that can partition into this milieu. Finally, considering that the size of the 60S subunit approaches the upper limit of what can be accommodated by the NPC (Pante and Kann, 2002
), positioning the subunit for entry into the NPC channel may require multiple interactions between the 60S subunit and the NPC. Recently, the general mRNA export Mtr2-Mex67 heterodimer was shown to be required for 60S subunit export in yeast (Yao et al., 2007
). An mtr2-33 mutant specifically affects 60S subunit export but not mRNA export (Bassler et al., 2001
) and overexpression of MEX67 suppresses nmd3 mutants that are defective in 60S subunit export (Yao et al., 2007
; Lo and Johnson, unpublished data). Thus, Mtr2/Mex67 may partially bypass the functional requirement of Nmd3 and Crm1-mediated 60S subunit export.
Here, we demonstrate that export of the 60S subunit also relies on Arx1, a nucleo-cytoplasmic shuttling protein that is associated with pre-60S particles (Belaya et al., 2006
; Hung and Johnson, 2006
; Lebreton et al., 2006
). In the absence of Arx1, 60S particles enriched for Nmd3 and Crm1 as well as Mtr2 and Mex67 accumulate in the nucleus. Arx1 physically interacts with FG-domains of several nucleoporins, suggesting that Arx1 possesses a karyopherin-like feature to facilitate receptor-mediated 60S subunit export.
| MATERIALS AND METHODS |
|---|
|
|
|---|
::KanMX4 locus was amplified by PCR from strain AJY1901 using primers AJO563 (CTGGGTACCCGGCCGTCATGCCTCTGTGAAGCT) and AJO569 (5'-GCGGAGCTCCCGGGTCGACTGCAAGATTCTGAGCAAATG)¤ and the PCR product was transformed into CH1305. Plasmids used in this work are listed in Table 2. pAJ1029 was made by PCR amplification of ARX1 from wild-type yeast genomic DNA using primers AJO599 (5'-CTGAGCTCCCGGGTCATGCCTCTGTGAAGC) and AJO600 (5'-GCGGAGCTCCCGGGTATGATATACTTATATTATTTATATACTAGCTTTAGAAATGATGAA) and cloned as an SstI fragment into pAJ60. pAJ1481 was made by three part ligation of 1) PCR-amplified ARX1 using primers AJO876 (CTGTCGACGCTCTAGCTATCTCCCACGA) and AJO564 (5'-GCGCCCGGGCTTAATTAACATTTTCATGGTTTCTTCAACTC), 2) SstI- and SalI-digested fragment of pAJ1479 (Dong et al., 2004
|
|
.
The synthetic lethal screen was carried out as described using strain AJY1912 containing pAK1029 (Kranz and Holm, 1990
34,000 colonies screened, four recessive synthetic lethal or synthetic sick mutants were identified. The mutated genes were identified by complementation with a genomic library and complementing clones subcloned to identify the single gene responsible for complementation. We were unable to clone two of the mutants.
Genetic Interactions.
To test for genetic interactions between arx1
and nucleoporin mutants or export factors, AJY1901 or AJY2601 was crossed to selected nucleoporin mutants or nmd3(AAA), mtr2-33 or mex67-5 mutant strains (Table 2). Diploids were sporulated, dissected to isolate spore clones¤ and genotyped by appropriate markers.
Yeast Two-Hybrid Analysis. To test for two-hybrid interactions between Arx1 and nucleoporins, the appropriate plasmids (see Figure 7A and Table 2) were introduced into the reporter strain PJ69-4A. Leu+ Trp+ or Leu+ Ura+ transformants were selected and tested in serial dilution assays on ura– trp– his– or leu– ura– his– triple-dropout medium supplemented with 3-AT as indicated. Plates were incubated at 30°C for 4 d.
Microscopy
For green fluorescent protein (GFP) microscopy, overnight cultures in selective media containing 2% glucose were fixed with formaldehyde (3.7% final concentration) for 40 min, washed three times in cold 0.1 M potassium phosphate buffer, pH 6.6, and resuspended in 0.1 M potassium phosphate, pH 6.6, 1.2 M sorbitol. For 4',6'-diamidino-2-phenylindole (DAPI) staining, Triton X-100 was added to fixed cells to a final concentration of 0.1% for 5 min, followed by DAPI at a final concentration of 1 µg/ml for 1 min. Cells were then washed three times with cold phosphate-buffered saline (PBS) and resuspended in PBS with 0.02% NaN3. Fluorescence was visualized on a Nikon Eclipse E800 microscope (Melville, NY) fitted with a 100x objective and a Photometrics CoolSNAP ES digital camera (Woburn, MA) controlled with the NIS-Element AR 2.10 software. Images were prepared using Adobe Photoshop 7.0 (San Jose, CA). Indirect immunofluorescence was performed as described previously (Ho and Johnson, 1999
) with anti-Nmd3 antibody.
In Vitro Binding
GST-TEV-HIS6-Arx1 was expressed from pAJ1031 in BJ5464 by growth in the presence of 1% galactose for 7 h at 30°C. All subsequent steps were carried out at 4°C. The cell pellet was washed and resuspended in extraction buffer (50 mM Tris·HCl, pH 8, 300 mM NaCl, 10% glycerol, 1 µM each pepstatin and leupeptin¤ and 1 mM PMSF). Cells were disrupted by vortexing with glass beads. NP40 was added to 0.1% and the extract was clarified by centrifugation for 10 min at 10,000 x g followed by 20 min at 30,000 x g. The extract was passed over a glutathione Sepharose column and washed with extraction buffer¤ followed by extraction buffer with NaCl adjusted to 50 mM¤ and eluted in the same buffer supplemented with 50 mM glutathione. Limiting TEV protease was added to the eluted protein and the sample was dialyzed overnight against 50 mM Tris·HCl¤ pH 8, 50 mM NaCl, 10% glycerol, 5 mM β-mercaptoethanol, 1 µM each leupeptin and pepstatin¤ and 1 mM PMSF. The cleaved protein was then passed over a glutathione Sepharose column equilibrated in 50 mM Tris·HCl, 50 mM NaCl, and 10% glycerol to remove glutathione S-transferase (GST) and uncleaved GST-Arx1. Binding of Arx1 to GST-Nups was essentially as described in Allen et al. (2002)
.
Other Methods
Sucrose gradient sedimentation, Western blotting and immunoprecipitations were as described (Hung and Johnson, 2006
). The antibodies used in this work were affinity purified rabbit anti-Nmd3, anti-Rpl8, anti-Mex67 (C. Dargemont, Institut Jacques Monod, Paris, France) and anti-Mtr2 (E. Hurt, Universität Heidelberg, Germany) monoclonal 9e10 anti-myc and 12CA5 anti-HA (Covance Laboratories, Madison, WI).
| RESULTS |
|---|
|
|
|---|
C14), resulting in a premature stop codon that eliminates the C-terminal 14 aa. Similarly, the genomic mutation in NUP120 was a deletion of nucleotide G3065 (nup120
C16), introducing a frame shift that eliminated the C-terminal 16 aa of Nup120. The identification of NMD3 and NUP120 as genetic interactors of ARX1 implies a role for Arx1 in 60S subunit export.
Deletion of the C-terminal fourteen amino acids of Nmd3 resulted in strong nuclear localization of the protein (Figure 1A). We had previously localized the NES of Nmd3 to aa 491–500 based on sequence alignments and functional assays (Ho et al., 2000b
). Although the truncation in nmd3
C14 did not remove any of the residues previously implicated in export, it was possible to shift the alignment of the NES of Nmd3 five residues toward the C-terminus, to include L505 as the C-terminal hydrophobic residue of the NES (Figure 1B). This alignment gives a consensus leucine-rich NES and suggests that although the NES is highly conserved throughout eukaryotes, it has shifted slightly in position during evolution. Changing leucine 505 to alanine (nmd3L505A) had a strong effect on the localization of Nmd3 and cell growth (Hedges et al., 2006
) and was synthetic lethal with arx1
(data not shown). Thus, deletion of ARX1 is synthetic lethal with a defect in Nmd3 export function. We also tested the effect of nmd3
C14 and nmd3L505A on 60S subunit export. As expected, these mutants showed strongly impaired 60S export, judged by the accumulation of Rpl25-GFP in the nucleus (Figure 1A).
|
C14 and strongly synthetic sick with nup120
16. To observe the effect of the double mutants on 60S export, we made a conditional allele of ARX1 by fusing ubiquitin (UBI) to the N-terminus of the protein expressed under control of the regulatable GAL promoter (Dong et al., 2004
|
nup120
C16 cells severely impaired growth (Figure 2A) and led to nuclear accumulation of Nmd3 (Figure 2C). We also observed nuclear accumulation of Rpl25-GFP after repressing UBI-R-ARX1 (Figure 2C). The nuclear accumulation of Nmd3-GFP appeared faster than that of Rpl25-GFP because Nmd3 shuttles and is rapidly trapped in the nucleus. However, Rpl25-GFP remains associated with ribosomes in the cytoplasm. Consequently, to see a clear change in localization more time is required to deplete the cytoplasmic pool of Rpl25-GFP-containing 60S subunits after export is blocked. In contrast, in the presence of the stable UBI-M-ARX1 construct, Nmd3 began to accumulate in the nucleus only after 4 h of repression and we did not observe any significant nuclear accumulation of Rpl25-GFP (data not shown). We were not able to monitor the effect of ARX1 repression on either Nmd3 or Rpl25 localization in the arx1
nmd3
C14 mutant as the UBI-R-ARX1 construct was unable to complement this mutant.
ARX1 Shows Genetic Interaction with Other Nucleoporin Mutants
Considering the genetic interaction between ARX1 and NUP120, we asked if ARX1 would show genetic interactions with other nucleoporin mutants as well. From crosses of arx1
with a panel of nucleoporin mutants, representing different subcomplexes of the NPC, we found several additional nucleoporin mutants that interacted with arx1
(Table 3). In particular, mutations in NUP133 and NUP84, which together with NUP120 form the Nup84 subcomplex, showed strong synthetic interaction. In addition, nup82 and gle2 mutants showed strong genetic interaction, whereas nic96 and nup42 mutants showed weak interaction. Although the Nup84 complex is symmetrically disposed across the nuclear envelope, Nup82 and Gle2 are found on the cytoplasmic face (Suntharalingam and Wente, 2003
). Previous work has shown that both the Nup84 and the Nup82 complexes are involved in 60S export (Stage-Zimmermann et al., 2000
; Gleizes et al., 2001
).
|
Mutants
and nmd3 and nucleoporin mutants strongly suggest that Arx1 is involved in 60S export, possibly interacting with the NPC. If Arx1 were required for a late step in 60S export, we might expect accumulation of the Nmd3-bound 60S subunit in the nucleus. We previously showed that Rpl25-GFP accumulates in the nucleus in arx1
cells, indicating a defect in 60S subunit export (Hung and Johnson, 2006
cells. Furthermore, the Nmd3 present in the arx1
cells was essentially entirely bound to 60S (Figure 3B), demonstrating that export of the Nmd3-60S complex is inhibited in the absence of Arx1. It should be noted that the Nmd3 present in the cytoplasm of wild-type cells is also bound to 60S subunits and must exist only transiently as a free protein during reimport into the nucleus (Ho et al., 2000a
cells but not a change in the ratio of bound to unbound protein.
|
cells could be due to a failure to recruit Crm1. Alternatively, Arx1 could act downstream of Crm1 loading, preventing efficient export of the pre-60S complex. We tested this by immunopurification of Nmd3 from wild-type and arx1
cells, probing for Crm1 by Western blotting. Indeed, we observed an increase in Crm1 present in the Nmd3-IP (Figure 4A). Because the interaction of Crm1 with ligands is labile in extracts, due to the loss of RanGTP, we also used a functional mutant Nmd3 (Nmd3-supra NES) in which the NES has been altered to enhance Crm1 binding (Engelsma et al., 2004
cells (Figure 4A). This result did not necessarily demonstrate that Crm1 was enriched in a complex that contained the 60S subunit. To address this, we asked if Crm1 association with 60S subunits could be detected in sucrose gradients. Indeed, in the absence of Arx1, we observed an increased level of Crm1 cosedimenting with free 60S subunits (Figure 4B, fractions indicated by solid bars). These results indicate that Arx1 is not required for efficient recruitment of Crm1. Rather, Arx1 acts downstream Crm1 and without Arx1, pre-60S particles that are loaded with both Nmd3 and Crm1 accumulate in the nucleus.
|
cells might also be loaded with Mex67 and Mtr2. Testing this by coimmunoprecipitation, we found that Mex67 and Mtr2 were strongly increased in the Nmd3-bound pre-60S particles from arx1
cells (Figure 5, compare lanes 1 and 3). Mex67 and Mtr2 were also enriched in particles blocked for export by Nmd3(AAA), containing three point mutations within its leucine-rich NES (Figure 5, compare lanes 2 and 4). This mutant does not interact efficiently with Crm1 (West et al., 2007
cells are enriched for two different export receptors, Crm1 and Mex67/Mtr2, but yet are defective for export. Of the mutations known to trap Nmd3 in the nucleus, all are in factors that act late in the 60S export pathway. These include Crm1 (Ho et al., 2000b
|
is synthetic lethal with nmd3 mutants that disrupt Crm1 interaction (Table 4A), we tested for pairwise genetic interactions with additional export factors. Indeed, we observed that arx1
was synthetic lethal with mtr2-33 (Figure 6A) and was synthetic sick with mex67-5 (Table 4A and data not shown). Conversely, overexpression of factors that are limiting might suppress export defects. For example, overexpression of Mex67 suppresses certain nmd3 mutants (Ho et al., 2000b
mutant. However, in many cases overexpression of an export factor was dominant negative in cells in which other 60S subunit export receptors or adapters were mutant. For example, overexpression of CRM1 was dominant negative in nmd3(AAA), arx1
, mex67-5¤ and mtr2-33 mutants (Figure 6B). Overexpression of NMD3 was also dominant negative in an arx1 mutant (Table 4B and Figure 6B) and co-overexpression had an additive dominant negative effect (data not shown).
|
|
cells. However, dominant negative interactions are more difficult to interpret. We suggest that a common mechanism of dominant negative effect among these factors is the disruption of bridging interactions by altering the stoichiometry of a bridging factor in a complex. For example, if Arx1 provides a means for the 60S subunit to interact with the NPC, then in the absence of Arx1, recruitment of the pre-60S complex to the NPC will be dependent on Mex67/Mtr2 and Nmd3/Crm1. In the Nmd3/Crm1 pathway, the 60S subunit is recruited to the NPC by bridging interactions between the 60S subunit, Nmd3, Crm1 and the NPC. Overexpression of Nmd3 could drive formation of Nmd3-60S and Nmd3-Crm1 complexes, preventing the formation of a 60S-Nmd3-Crm1 complex. Similarly, overexpression of Crm1 could simultaneously saturate Nmd3 and sites on the NPC, blocking recruitment of the pre-60S to the NPC. Hence, export would become more dependent on Mex67/Mtr2¤ which is required but not sufficient for efficient export.
Arx1 Physically Interacts with Nucleoporins
Arx1 was previously identified among proteins that interacted with Nup42 and Nup100 in vitro (Allen et al., 2001
). In these experiments, GST fusions of different nucleoporins were immobilized on beads that were then used as affinity matrices for purification of proteins from yeast whole cell extracts. In this analysis, it was possible that the interactions were indirect, bridged by other proteins or RNAs. As an alternative means to test these interactions, we used yeast two-hybrid analysis. Arx1 was expressed as a fusion to the GAL4 binding domain and was challenged with a panel of nucleoporin fusions to the GAL4 activation domain. We observed interactions between Arx1 and Nup100, Nup116¤ and Nup57 (Figure 7A). As a control we recapitulated the previously reported homotypic interaction of Nup116 FG domains (Figure 7A) as well as interactions of Nup116 with other Nup FG domains (data not shown; Patel et al., 2007
). These results support the previous biochemical identification of Arx1 nucleoporin association.
|
| DISCUSSION |
|---|
|
|
|---|
Sequence comparisons indicate that Arx1 has evolved from the family of type II methionyl aminopeptidases (MetAPs; Hung and Johnson, 2006
). However, catalytic residues in the active site are not conserved in Arx1, suggesting that it is not an active peptidase. Indeed, the human ortholog of Arx1, Ebp1, does not have peptidase activity (Monie et al., 2007
). These proteins have also diverged from MetAPs by the inclusion of loops and a C-terminal extension that, in Ebp1, provides an RNA-binding domain (Monie et al., 2007
). It remains to be determined if human Ebp1, which is involved in pre-60S metabolism in human cells (Squatrito et al., 2004
), also plays a role similar to that of Arx1 as an export receptor as the loops in Arx1 are much more extensive than those in Ebp1 and could provide additional interaction surfaces not found in Ebp1. This may be reminiscent of the acquisition of ribosome binding activity by Mex67 and Mtr2, a function specific to protein loops unique to the yeast proteins and not found in the metazoan proteins (Yao et al., 2007
). On the other hand, nucleophosmin has been reported to be required for export of 5S rRNA, and by extension, the 60S subunit, in human cells (Yu et al., 2006
). Nucleophosmin does not have an obvious ortholog in yeast. Thus, among the export adaptors for the large subunit, only Nmd3 appears to be well conserved in function as an export adapter. Nmd3 may represent the primordial 60S export factor for eukaryotic cells and additional adapters may have evolved independently in different eukaryotic lineages.
The inner channel of the nuclear pore complex is largely composed of FG-repeat–containing nucleoporins that create a hydrophobic meshwork, posing a permeability barrier that selectively controls the translocation of macromolecules (Ribbeck and Gorlich, 2001
; Denning et al., 2003
). Translocation of hydrophilic cargo through this hydrophobic channel of the NPC requires a mechanism for partitioning the cargo into such an environment. It has been speculated that large cargo molecules require multiple receptors, and this has been demonstrated for protein import in HeLa cells (Ribbeck and Gorlich, 2002
). On the other hand, the addition of a second import receptor synergistically stimulated import. The large subunit of the ribosome may be the bulkiest cargo to pass through the NPC. In addition, it is highly electronegative, due to the large amount of RNA on the surface of the subunit. Our results here with Arx1, combined with the previous demonstration that Nmd3 (Ho et al., 2000b
; Gadal et al., 2001
) and more recently the Mex67/Mtr2 heterodimer (Yao et al., 2007
) are required for export suggest that at least three receptors are used for efficient export in yeast. Considering the impact of nmd3 and mtr2 mutants on 60S export, and that Arx1 appears to be a stoichiometric component of the pre-60S complex, it seems likely that these receptors are present simultaneously on the subunit and are required in concert, rather than as alternative export pathways. We might expect these receptors to be distributed over the surface of the large subunit to allow the entire surface of the ribosome to partition into the NPC. Preliminary results suggest that Arx1 binds in the vicinity of the exit tunnel (Hung and Johnson, 2006
) whereas Nmd3 appears to bind to the joining surface (Sengupta, Bussiere, Frank and Johnson, unpublished data) on the opposite face of the subunit. The Mex67/Mtr2 heterodimer is suggested to bind 5S rRNA (Yao et al., 2007
), again potentially distal to Arx1 and Nmd3. In the case of nuclear import of large cargo molecules in HeLa cells, single import receptors were not sufficient for efficient translocation, but did promote tethering of cargo at the NPC. We have not observed tethering of preribosomal complexes at the NPC under conditions in which export is inhibited.
If multiple receptors are required for export, why are multiple different receptors used rather than multiple copies of a single receptor species? One possibility is that export with multiple different receptors is more efficient than multiple receptors of the same protein species, possibly avoiding competition between receptors for common binding sites. In addition, the different affinities of different receptors for their binding sites on nucleoporins could help to orient the ribosomal subunit with respect to the central channel of the NPC to facilitate its entry.
The presence of multiple receptors on the large subunit also raises the question of how subunit export is regulated. We have proposed previously that Nmd3 may act as a structural proofreading factor whose binding would depend on the proper assembly of a complex binding site that is presented only upon proper maturation of the subunit (Johnson et al., 2002
). Thus, the loading of Nmd3 would dictate the time of export. However, with multiple receptors, this seems a more complicated proposition. Would their loading be coordinated, or is there a hierarchy in their function, i.e., would one factor, such as Nmd3, be the primary determinant for release from the nucleolus or docking at the NPC whereas the other factors load later or perhaps function only at the NPC? Our preliminary results suggest that there is not a rigid hierarchy to the loading of these proteins. However, the accumulation of particles in the nucleus when one export receptor is disrupted could result in accumulation of Crm1 and Mex67/Mtr2 on these particles, possibly during abortive cycles of docking and release from the NPC.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Address correspondence to: Arlen Johnson (arlen{at}mail.utexas.edu)
| REFERENCES |
|---|
|
|
|---|
Allen, N. P., Patel, S. S., Huang, L., Chalkley, R. J., Burlingame, A., Lutzmann, M., Hurt, E. C., and Rexach, M. (2002). Deciphering networks of protein interactions at the nuclear pore complex. Mol. Cell Proteom 1, 930–946.
Bassler, J., Grandi, P., Gadal, O., Lessmann, T., Petfalski, E., Tollervey, D., Lechner, J., and Hurt, E. (2001). Identification of a 60S preribosomal particle that is closely linked to nuclear export. Mol. Cell 8, 517–529.[CrossRef][Medline]
Belaya, K., Tollervey, D., and Kos, M. (2006). FLIPing heterokaryons to analyze nucleo-cytoplasmic shuttling of yeast proteins. RNA 12, 921–930.
Bischoff, F. R., Klebe, C., Kretschmer, J., Wittinghofer, A., and Ponstingl, H. (1994). RanGAP1 induces GTPase activity of nuclear Ras-related Ran. Proc. Natl. Acad. Sci. USA 91, 2587–2591.
Bischoff, F. R., Krebber, H., Smirnova, E., Dong, W., and Ponstingl, H. (1995). Co-activation of RanGTPase and inhibition of GTP dissociation by Ran-GTP binding protein RanBP1. EMBO J 14, 705–715.[Medline]
Bradatsch, B. et al. (2007). Arx1 functions as an unorthodox nuclear export receptor for the 60S preribosomal subunit. Mol. Cell 27, 767–779.[CrossRef][Medline]
Denning, D. P., Patel, S. S., Uversky, V., Fink, A. L., and Rexach, M. (2003). Disorder in the nuclear pore complex: the FG repeat regions of nucleoporins are natively unfolded. Proc. Natl. Acad. Sci. USA 100, 2450–2455.
Dong, J., Lai, R., Nielsen, K., Fekete, C. A., Qiu, H., and Hinnebusch, A. G. (2004). The essential ATP-binding cassette protein RLI1 functions in translation by promoting preinitiation complex assembly. J. Biol. Chem 279, 42157–42168.
Engelsma, D., Bernad, R., Calafat, J., and Fornerod, M. (2004). Supraphysiological nuclear export signals bind CRM1 independently of RanGTP and arrest at Nup358. EMBO J 23, 3643–3652.[CrossRef][Medline]
Gadal, O., Strauss, D., Kessl, J., Trumpower, B., Tollervey, D., and Hurt, E. (2001). Nuclear export of 60S ribosomal subunits depends on Xpo1p and requires a nuclear export sequence-containing factor, Nmd3p that associates with the large subunit protein Rpl10p. Mol. Cell. Biol 21, 3405–3415.
Gleizes, P. E., Noaillac-Depeyre, J., Léger-Silvestre, I., Teulières, F., Dauxois, J. Y., Pommet, D., Azum-Gelade, M. C., and Gas, N. (2001). Ultrastructural localization of rRNA shows defective nuclear export of preribosomes in mutants of the Nup82p complex. J. Cell Biol 155, 923–936.
Hedges, J., Chen, Y. I., West, M., Bussiere, C., and Johnson, A. W. (2006). Mapping the functional domains of yeast NMD3, the nuclear export adapter for the 60 S ribosomal subunit. J. Biol. Chem 281, 36579–36587.
Hedges, J., West, M., and Johnson, A. W. (2005). Release of the export adapter, Nmd3p, from the 60S ribosomal subunit requires Rpl10p and the cytoplasmic GTPase Lsg1p. EMBO J 24, 567–579.[CrossRef][Medline]
Ho, J., and Johnson, A. W. (1999). NMD3 encodes an essential cytoplasmic protein required for stable 60S ribosomal subunits in Saccharomyces cerevisiae. Mol. Cell. Biol 19, 2389–2399.
Ho, J. H., Kallstrom, G., and Johnson, A. W. (2000a). Nascent 60S ribosomal subunits enter the free pool bound by Nmd3p. RNA 6, 1625–1634.[Abstract]
Ho, J. H., Kallstrom, G., and Johnson, A. W. (2000b). Nmd3p is a Crm1p-dependent adapter protein for nuclear export of the large ribosomal subunit. J. Cell Biol 151, 1057–1066.
Hung, N. J., and Johnson, A. W. (2006). Nuclear recycling of the pre-60S ribosomal subunit-associated factor Arx1 depends on Rei1 in Saccharomyces cerevisiae. Mol. Cell. Biol 26, 3718–3727.
Hurwitz, M. E., and Blobel, G. (1995). NUP82 is an essential yeast nucleoporin required for poly(A)+ RNA export. J. Cell Biol 130, 1275–1281.
James, P., Halladay, J., and Craig, E. A. (1996). Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics 144, 1425–1436.[Abstract]
Johnson, A. W., Lund, E., and Dahlberg, J. (2002). Nuclear export of ribosomal subunits. Trends Biochem. Sci 27, 580–585.[CrossRef][Medline]
Kallstrom, G., Hedges, J., and Johnson, A. (2003). The putative GTPases Nog1p and Lsg1p are required for 60S ribosomal subunit biogenesis and are localized to the nucleus and cytoplasm, respectively. Mol. Cell. Biol 23, 4344–4355.
Kranz, J. E., and Holm, C. (1990). Cloning by function: an alternative approach for identifying yeast homologs of genes from other organisms. Proc. Natl. Acad. Sci. USA 87, 6629–6633.
Kutay, U., and Guttinger, S. (2005). Leucine-rich nuclear-export signals: born to be weak. Trends Cell Biol 15, 121–124.[CrossRef][Medline]
Lebreton, A., Saveanu, C., Decourty, L., Rain, J. C., Jacquier, A., and Fromont-Racine, M. (2006). A functional network involved in the recycling of nucleocytoplasmic pre-60S factors. J. Cell Biol 173, 349–360.
Monie, T. P., Perrin, A. J., Birtley, J. R., Sweeney, T. R., Karakasiliotis, I., Chaudhry, Y., Roberts, L. O., Matthews, S., Goodfellow, I. G., and Curry, S. (2007). Structural insights into the transcriptional and translational roles of Ebp1. EMBO J 26, 3936–3944.[CrossRef][Medline]
Moy, T. I., and Silver, P. A. (1999). Nuclear export of the small ribosomal subunit requires the Ran-GTPase cycle and certain nucleoporins. Genes Dev 13, 2118–2133.
Nehrbass, U., Kern, H., Mutvei, A., Horstmann, H., Marshallsay, B., and Hurt, E. C. (1990). NSP1: a yeast nuclear envelope protein localized at the nuclear pores exerts its essential function by its carboxy-terminal domain. Cell 61, 979–989.[CrossRef][Medline]
Nissan, T. A., Bassler, J., Petfalski, E., Tollervey, D., and Hurt, E. (2002). 60S pre-ribosome formation viewed from assembly in the nucleolus until export to the cytoplasm. EMBO J 21, 5539–5547.[CrossRef][Medline]
Page, A. M., Davis, K., Molineux, C., Kolodner, R. D., and Johnson, A. W. (1998). Mutational analysis of exoribonuclease I from Saccharomyces cerevisiae. Nucleic Acids Res 26, 3707–3716.
Pante, N., and Kann, M. (2002). Nuclear pore complex is able to transport macromolecules with diameters of about 39 nm. Mol. Biol. Cell 13, 425–434.
Park, E. C., Finley, D., and Szostak, J. W. (1992). A strategy for the generation of conditional mutations by protein destabilization. Proc. Natl. Acad. Sci. USA 89, 1249–1252.
Patel, S. S., Belmont, B. J., Sante, J. M., and Rexach, M. F. (2007). Natively unfolded nucleoporins gate protein diffusion across the nuclear pore complex. Cell 129, 83–96.[CrossRef][Medline]
Pemberton, L. F., and Paschal, B. M. (2005). Mechanisms of receptor-mediated nuclear import and nuclear export. Traffic 6, 187–198.[CrossRef][Medline]
Ribbeck, K., and Gorlich, D. (2001). Kinetic analysis of translocation through nuclear pore complexes. EMBO J 20, 1320–1330.[CrossRef][Medline]
Ribbeck, K., and Gorlich, D. (2002). The permeability barrier of nuclear pore complexes appears to operate via hydrophobic exclusion. EMBO J 21, 2664–2671.[CrossRef][Medline]
Santos-Rosa, H., Moreno, H., Simos, G., Segref, A., Fahrenkrog, B., Pante, N., and Hurt, E. (1998). Nuclear mRNA export requires complex formation between Mex67p and Mtr2p at the nuclear pores. Mol. Cell. Biol 18, 6826–6838.
Segref, A., Sharma, K., Doye, V., Hellwig, A., Huber, J., Luhrmann, R., and Hurt, E. (1997). Mex67p, a novel factor for nuclear mRNA export, binds to both poly(A)+ RNA and nuclear pores. EMBO J 16, 3256–3271.[CrossRef][Medline]
Squatrito, M., Mancino, M., Donzelli, M., Areces, L. B., and Draetta, G. F. (2004). EBP1 is a nucleolar growth-regulating protein that is part of pre-ribosomal ribonucleoprotein complexes. Oncogene 23, 4454–4465.[CrossRef][Medline]
Stage-Zimmermann, T., Schmidt, U., and Silver, P. A. (2000). Factors affecting nuclear export of the 60S ribosomal subunit in vivo. Mol. Biol. Cell 11, 3777–3789.
Suntharalingam, M., and Wente, S. R. (2003). Peering through the pore: nuclear pore complex structure, assembly, and function. Dev. Cell 4, 775–789.[CrossRef][Medline]
Thomas, F., and Kutay, U. (2003). Biogenesis and nuclear export of ribosomal subunits in higher eukaryotes depend on the CRM1 export pathway. J. Cell Sci 116, 2409–2419.
Tran, E. J., and Wente, S. R. (2006). Dynamic nuclear pore complexes: life on the edge. Cell 125, 1041–1053.[CrossRef][Medline]
Trotta, C. R., Lund, E., Kahan, L., Johnson, A. W., and Dahlberg, J. E. (2003). Coordinated nuclear export of 60S ribosomal subunits and NMD3 in vertebrates. EMBO J 22, 2841–2851.[CrossRef][Medline]
West, M., Hedges, J. B., Lo, K. Y., and Johnson, A. W. (2007). Novel interaction of the 60S ribosomal subunit export adapter Nmd3 at the nuclear pore complex. J. Biol. Chem 282, 14028–14037.
Yao, W., Roser, D., Kohler, A., Bradatsch, B., Bassler, J., and Hurt, E. (2007). Nuclear export of ribosomal 60S subunits by the general mRNA export receptor Mex67-Mtr2. Mol. Cell 26, 51–62.[CrossRef][Medline]
Yu, Y., Maggi, L. B., Jr, Brady, S. N., Apicelli, A. J., Dai, M. S., Lu, H., and Weber, J. D. (2006). Nucleophosmin is essential for ribosomal protein L5 nuclear export. Mol. Cell. Biol 26, 3798–3809.
Zabel, U., Doye, V., Tekotte, H., Wepf, R., Grandi, P., and Hurt, E. C. (1996). Nic96p is required for nuclear pore formation and functionally interacts with a novel nucleoporin, Nup188p. J. Cell Biol 133, 1141–1152.
This article has been cited by other articles:
![]() |
J. Merl, S. Jakob, K. Ridinger, T. Hierlmeier, R. Deutzmann, P. Milkereit, and H. Tschochner Analysis of ribosome biogenesis factor-modules in yeast cells depleted from pre-ribosomes Nucleic Acids Res., January 25, 2010; (2010): gkp1244v1 - gkp1244. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Meyer, L. A. Hoover, and E. A. Craig The Cytosolic J-protein, Jjj1, and Rei1 Function in the Removal of the Pre-60 S Subunit Factor Arx1 J. Biol. Chem., January 8, 2010; 285(2): 961 - 968. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Beliakova-Bethell, L. J. Terry, V. Bilanchone, R. DaSilva, K. Nagashima, S. R. Wente, and S. Sandmeyer Ty3 Nuclear Entry Is Initiated by Viruslike Particle Docking on GLFG Nucleoporins J. Virol., November 15, 2009; 83(22): 11914 - 11925. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-Y. Lo, Z. Li, F. Wang, E. M. Marcotte, and A. W. Johnson Ribosome stalk assembly requires the dual-specificity phosphatase Yvh1 for the exchange of Mrt4 with P0 J. Cell Biol., September 21, 2009; 186(6): 849 - 862. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kemmler, L. Occhipinti, M. Veisu, and V. G. Panse Yvh1 is required for a late maturation step in the 60S biogenesis pathway J. Cell Biol., September 21, 2009; 186(6): 863 - 880. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Parnell and B. L. Bass Functional Redundancy of Yeast Proteins Reh1 and Rei1 in Cytoplasmic 60S Subunit Maturation Mol. Cell. Biol., July 15, 2009; 29(14): 4014 - 4023. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Zemp, T. Wild, M.-F. O'Donohue, F. Wandrey, B. Widmann, P.-E. Gleizes, and U. Kutay Distinct cytoplasmic maturation steps of 40S ribosomal subunit precursors require hRio2 J. Cell Biol., June 29, 2009; 185(7): 1167 - 1180. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-Y. Lo and A. W. Johnson Reengineering Ribosome Export Mol. Biol. Cell, March 1, 2009; 20(5): 1545 - 1554. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Prohaska and N. Williams Assembly of the Trypanosoma brucei 60S Ribosomal Subunit Nuclear Export Complex Requires Trypanosome-Specific Proteins P34 and P37 Eukaryot. Cell, January 1, 2009; 8(1): 77 - 87. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Vanrobays, A. Leplus, Y. N. Osheim, A. L. Beyer, L. Wacheul, and D. L.J. Lafontaine TOR regulates the subcellular distribution of DIM2, a KH domain protein required for cotranscriptional ribosome assembly and pre-40S ribosome export RNA, October 1, 2008; 14(10): 2061 - 2073. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Lebreton, J.-C. Rousselle, P. Lenormand, A. Namane, A. Jacquier, M. Fromont-Racine, and C. Saveanu 60S ribosomal subunit assembly dynamics defined by semi-quantitative mass spectrometry of purified complexes Nucleic Acids Res., September 1, 2008; 36(15): 4988 - 4999. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. White, Z. Li, R. Sardana, J. M. Bujnicki, E. M. Marcotte, and A. W. Johnson Bud23 Methylates G1575 of 18S rRNA and Is Required for Efficient Nuclear Export of Pre-40S Subunits Mol. Cell. Biol., May 15, 2008; 28(10): 3151 - 3161. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||