![]() |
|
|
Vol. 19, Issue 3, 1252-1260, March 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

,


*Macrophage Biology Laboratory, Veterans Affairs Medical Center, San Francisco, CA 94121;
Institute of Reproductive and Developmental Biology, Hammersmith Hospital, Imperial College London, London W12 0NN, United Kingdom;
Department of Microbial Pathogenesis, Genentech, Inc., San Francisco, CA 94080; ||Department of Psychiatry, University of California, San Francisco, San Francisco, CA 94158-2517; and ¶Department of Laboratory Medicine, University of California, San Francisco, San Francisco, CA 94143-0451
Submitted August 13, 2007;
Revised December 20, 2007;
Accepted January 4, 2008
Monitoring Editor: Sandra Schmid
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The traditional view of GPCR endocytosis is that it is regulated mainly at the level of recruitment of arrestin. Arrestins 2 and 3 (often called β-arrestins or nonvisual arrestins) bind directly both to phosphorylated GPCRs and to components of the clathrin machinery such as clathrin and adaptor protein (AP)2, thereby functioning as endocytic adaptors that localize GPCRs to clathrin-coated pits (Reiter and Lefkowitz, 2006
; DeWire et al., 2007
; Premont and Gainetdinov, 2007
; Traub and Lukacs, 2007
). Endocytosis of most proteins, once they localize to CCPs, is thought to occur "by default." Therefore, phosphorylation-dependent binding of arrestin to GPCRs is thought to be sufficient to drive the series of events that culminate in receptor internalization.
Recent data, however, suggest that regulated endocytosis is more complex. On activation, GPCRs localize only to a specified subset of coated pits. Furthermore, some GPCRs can modulate the lifetimes of CCPs even after clustering; as a result, they regulate their own endocytosis (Lakadamyali et al., 2006
; Mundell et al., 2006
; Puthenveedu and von Zastrow, 2006
). Therefore, an alternate hypothesis is that distinct mechanisms actively regulate each step of the process to fine-tune the kinetics of endocytosis. The present work provides evidence that GPCR endocytosis is regulated downstream of arrestin recruitment to activated receptors. We have identified Protein Linking IAP (CD47) to cytoskeleton (PLIC-2), also called ubiquilin-2, as a negative regulator of GPCR/arrestin clustering in CCPs. Inhibited clustering of GPCR–arrestin complexes in CCPs, mediated by the ubiquitin-like (UbL) domain of PLIC-2, leads to delaying endocytosis of GPCRs specifically, but not of other membrane cargo tested. Our results identify a novel function of a ubiquitin-like protein in inhibiting, rather than promoting, endocytosis of GPCRs. They further suggest that multiple mechanisms, in addition to recruitment of arrestins by activated GPCRs, function in fine-tuning the regulated endocytosis of this large and important family of signaling receptors.
| MATERIALS AND METHODS |
|---|
|
|
|---|
DNA Constructs
The Flag-tagged human V2 receptor (V2R) and Flag-tagged human β2-adrenergic receptor expressed in pcDNA3.1 have been described previously (Cao et al., 1999
; Klein et al., 2001
). Eps15
95/295 was previously characterized as a dominant-negative construct (Benmerah et al., 1999
). The GFP-arrestin3 cDNA was from Marc Caron (Duke University, Durham, NC). GFP-Dynamin K44AE was provided by D. Fortin (University of California, San Francisco). The DsRed-clathrin cDNA was described previously (Merrifield et al., 2002
; Puthenveedu and von Zastrow, 2006
).
PLIC Fusion Proteins
The GST-PLIC constructs have been described previously (Wu et al., 1999
). To generate GFP-tagged PLIC constructs, PLIC-1 and PLIC-2 coding sequences from GST-PLIC constructs (Wu et al., 1999
) were excised using EcoRI/SalI for PLIC-1 or SacI/Hind III for PLIC-2, and they were ligated into the pEGFP-C3 vector (BD Biosciences, San Jose, CA).
PLIC-2
UbL (amino acids [aa] 104-634) was generated by polymerase chain reaction (PCR) by using the following primers: 5'-GCACGCCGAATTCTTAGCCAGAACCGTCCGCAG-3' and 5'-GCCAGACCTCGAGTTAGGATGGCTGAGAGCCCAGCAG-3'. To generate GFP-PLIC-2
UBA (aa 1-579), the following PCR primers were used: 5'-CCGCCTTGAATTCTTATGGCTGAGAACGGCGAGA-3' and 5'-CCGCCTCGTCGACCTATTACACTTCAGGATTCGGCGGC-3'.
The PCR fragments were digested with EcoRI/XhoI (PLIC-2
UbL) or EcoRI/SalI (PLIC-2
UBA), and they were ligated into the vector pEGFP-C3 linearized with EcoRI/SalI. All constructs were sequenced to verify the absence of errors.
Cell Culture and Transfection
HeLa and human embryonic kidney (HEK)-293 cells were maintained in DME-H21 medium supplemented with 10% fetal calf serum. Transient transfection was performed using Lipofectamine 2000 (Invitrogen) according to manufacturer's instructions. Experiments were performed 24 h post-transfection. 293 cells stably expressing the β2-adrenergic receptor (β2AR) were maintained under selection in 500 µg/ml G-418 (Geneticin; Invitrogen) and were characterized previously (Gage et al., 2005
).
GPCR Internalization Assay
Quantification of receptor internalization was obtained by measuring cell surface receptor expression with and without agonist treatment by flow cytometry, as described previously (Hanyaloglu et al., 2005
; Hanyaloglu and von Zastrow, 2007
). Briefly, transfected HeLa cells were incubated with M1 anti-FLAG antibody followed by agonist treatment for 0–45 min, then they were detached with trypsin, incubated with a PE-coupled anti-mouse secondary antibody (Sigma-Aldrich), and analyzed by flow cytometry (FACSCalibur; BD Biosciences). For each sample, 10,000 cells were counted, and the PE fluorescence intensity of GFP-positive cells was measured. All time points were carried out in duplicates, and the experiment was performed at least three times. The percentage of internalized receptor was determined by subtracting the percentage of cell surface levels of receptor after addition of agonist compared with levels in untreated cells.
For PLIC knockdown experiments, HeLa cells plated in 10-cm culture dishes at 40% confluence were transfected with 50 nM nonsilencing small interfering RNA (siRNA) (target sequence AATTCTCCGAACGTGTCACGT; QIAGEN, Valencia, CA), siRNA for PLIC-1 (targeted sequence GAAGAAATCTCTAAACGTTTT; Dharmacon RNA Technologies, Lafayette, CO), or siRNA for PLIC-2 (targeted sequence TCCCATAAAGAGACCCTAATA; QIAGEN) by using Lipofectamine 2000 (Invitrogen). Forty-eight hours later, cells were cotransfected with 50 nM siRNA and 12 µg of V2R cDNA. Cells were replated in 12-well plates, and they were used the next day for endocytosis assays as described above. Depletion was confirmed by Western blot by using anti PLIC-1 or PLIC-2 antibodies.
GFP-Arrestin3 Recruitment Assay
HeLa cells transfected with Flag-V2R, GFP-arrestin3, and, where indicated mycPLIC-2, were plated onto coverslips 4–6 h after transfection. After incubation with a rabbit Flag antibody (3.5 µg/ml; 20 min; 37°C), agonist treatments (10 µM AVP) were carried out for 0, 1, or 5 min. Cells were fixed, permeabilized, and stained for V2R and mycPLIC-2, and observed under a confocal microscope (LSM 510; Carl Zeiss, Jena, Germany) with a 63x oil objective, numerical aperture of 1.4. Twenty cells per condition were imaged, and arrestin localization was categorized as described in text.
Glutathione Transferase (GST) Pull-Down Assays
The assays were performed essentially as described previously (N'Diaye and Brown, 2003
). Briefly, bead-bound GST-PLIC-1 or PLIC-2 was incubated with HeLa cell lysates overnight at 4°C under constant agitation. GST, alone or in fusion with syntaxin-2, was used as negative control. The bead-bound material was analyzed by Western blot with antibodies against Eps15, Epsin-1, or Epsin-2.
EGF Internalization
HeLa cells transfected with the indicated GFP-tagged proteins: PLIC-1, PLIC-2, or Dynamin K44E) were serum-starved for 1 h at 37°C in 0.1% bovine serum albumin-containing DME. Alexa 647-EGF (100 ng/ml) was added for 10 min. At endpoint, cells were washed, and bound EGF was stripped off the membrane by addition of 50 mM acetic acid and 150 mM NaCl, pH 2.9. To control for residual membrane-bound EGF, a set of cells were incubated at 4°C with labeled EGF, and then they were incubated or not in acid strip buffer. After a phosphate-buffered saline (PBS) wash, cells from each assay condition were lifted off the plate with trypsin, fixed in 2% paraformaldehyde, and the EGF fluorescence associated with the GFP-positive population was analyzed by flow cytometry (FACSCalibur; BD Biosciences). The fluorescence of membrane-bound EGF was subtracted from all samples.
Transferrin Receptor Analysis
To analyze PLIC effect on steady-state levels of transferrin receptor, HeLa cells transfected with the indicated GFP-tagged proteins: PLIC-1, PLIC-2, or dominant-negative Eps15 was lifted off and incubated with a transferrin receptor antibody (clone OKT-9; 5 µg/ml) for 1 h at 4°C. Cells were rinsed twice with PBS and incubated with a PE-coupled anti-mouse immunoglobulin G secondary antibody for 30 min at 4°C. Cells were rinsed, and the PE fluorescence on the transfected cell population measured by flow cytometry (FACSCalibur; BD Biosciences).
Total Internal Reflection Fluorescence (TIRF) Microscopy Live Imaging
Imaging was carried out using a Nikon TE-2000E inverted microscope with a 60x TIRF objective (numerical aperture 1.45), and equipped for through-the-objective TIRF illumination. A 488-nm argon-ion laser (Melles Griot, Carlsbad, CA) and a 543-nm HeNe laser (Spectra Physics, San Jose, CA) were used as light sources. Transfected cells were imaged in Opti-MEM (Invitrogen) with 2% serum and 30 mM HEPES, pH 7.4, maintained at 37°C using a temperature-controlled stage (Bioscience Tools, San Diego, CA) and an objective warmer (Bioptechs, Butler, PA). Time-lapse sequences were acquired using a C9100-12 camera (Hamamatsu Photonics, Bridgewater, NJ) driven by IPLab (Scanalytics, Fairfax, VA). To quantify receptor clustering in PLIC-2–transfected cells, samples were fed with M1 anti-Flag antibody (20 min; 37°C) before agonist stimulation for 1 or 4 min. Cells were then washed in ice-cold PBS and fixed (–20°C methanol; 5 min).
Statistical Analysis
Each experiment was repeated at least three times. Statistical significance was determined using paired Student's t test; differences were considered significant at p
0.05.
| RESULTS |
|---|
|
|
|---|
7 min, similar to rates previously shown for the V2R (Pfeiffer et al., 1998
30 min; Figure 1A). This effect of PLIC-2 was specific, because expression of PLIC-1 at similar levels had no effect on V2R endocytosis (Figure 1A). We also analyzed the role of PLIC-2 for another GPCR that undergoes clathrin-mediated internalization, the β2AR (Moore et al., 1995
6 min in control to
15 min in PLIC-2 cells).
|
The UbL Domain of PLIC-2 Is Required for Regulation of GPCR Endocytosis
Both PLIC-1 and PLIC-2 are multidomain proteins containing an amino-terminal UbL domain and a carboxy-terminal ubiquitin-associated (UBA) domain (Figure 2A). The UBA domain interacts with ubiquitinated chains (Bertolaet et al., 2001
; Wilkinson et al., 2001
), whereas the UbL domain functions as a ligand for ubiquitin-interacting motifs or UIMs present in proteins associated with the proteasome (Walters et al., 2002
) and endocytic adaptors (Regan-Klapisz et al., 2005
). Given the role of protein ubiquitination in promoting GPCR endocytosis (Shenoy et al., 2001
; Hicke and Dunn, 2003
) and to gain mechanistic insight into the action of PLIC-2, we next determined which of these regions of the protein conferred the inhibitory effect on GPCR endocytosis. GFP-tagged deletion mutants of PLIC-2 were generated (Figure 2A), and they were tested for their ability to inhibit V2R internalization when overexpressed. These mutant constructs were expressed at similar levels to full-length GFP-PLIC-2 (as determined by flow cytometry; data not shown). In addition to being soluble in the cytosol, full-length PLIC-2 is mainly found in cytoplasmic aggregates, similar to those observed for PLIC-1 (Regan-Klapisz et al., 2005
). Truncation of the N-terminal UbL domain produced a mutant PLIC-2 with similar cellular localization to full-length PLIC-2 (Figure 2B). However, this mutant was defective in its ability to inhibit V2R internalization after agonist treatment (Figure 2C). In contrast, deletion of the UBA domain produced a mutant PLIC-2 that was still capable of inhibiting V2R internalization to similar levels as full-length PLIC-2 (Figure 2C), even though its localization was mainly cytosolic (Figure 2B), suggesting that the inhibitory effect on V2R endocytosis is not dependent on PLIC-2 localization to cytoplasmic aggregates.
|
PLIC-2 Interacts with the UIM-containing Endocytic Adaptors Eps15 and Epsin
The results mentioned above indicate that expression of PLIC-2 but not PLIC-1 inhibits GPCR endocytosis (Figure 1) and that this inhibition by PLIC-2 is dependent on the UbL domain (Figure 2). Because the UbL domain, present in both PLIC-1 and PLIC-2, is a known ligand for UIMs (Walters et al., 2002
; Regan-Klapisz et al., 2005
), we sought to identify possible UIM-containing proteins that would interact specifically with PLIC-2. Pull-down assays were performed in which GST-PLIC-1 or GST-PLIC-2 was incubated with HeLa cell lysates. Both PLIC-1 and PLIC-2 interacted with Eps15 in vitro (Figure 3A). However, Eps15 showed increased binding with PLIC-2 compared with PLIC-1 (Figure 3B), suggesting that PLIC-2 may bind Eps15 with a higher affinity than PLIC-1. In contrast to Eps15, Epsin (1 and 2) exhibited a specific interaction with PLIC-2, because no binding was detectable with PLIC-1 under similar experimental conditions (Figure 3A). Thus, these data identify preferential interaction of Epsin and Eps15 with PLIC-2 over PLIC-1. These UIM-containing proteins may represent possible endocytic adaptors involved in PLIC-2 regulation of receptor endocytosis.
|
|
PLIC-2 Delays Receptor Clustering at the Plasma Membrane
To determine directly whether PLIC-2 delays agonist-induced concentration of receptors in CCPs, TIRF microscopy was used to rapidly monitor GPCR clustering at the plasma membrane in live cells (Steyer and Almers, 2001
; Puthenveedu and von Zastrow, 2006
). In HEK-293 cells stably expressing Flag-β2AR used previously in TIRF studies (Puthenveedu and von Zastrow, 2006
), receptor clustering was evident within 30 s after agonist addition in untransfected cells. In cells expressing GFP-PLIC-2, however, there was a dramatic delay in receptor cluster formation (Figure 5B and Supplemental Video S1). Clustering of Flag-β2AR in these cells was not visible until
210 s after agonist addition, whereas much more rapid clustering of the GPCR was observed in surrounding (untransfected) cells not expressing GFP-PLIC-2 (Figure 5B and Supplemental Video S1). This effect was specific to PLIC-2, because wild-type GFP (not fused to PLIC-2) did not detectably delay receptor clustering compared with surrounding untransfected cells (Figure 5A and Supplemental Video S2).
|
The localization of PLIC-2 in relation to CCPs was also examined by live TIRF microscopy (Supplemental Videos S3 and S4). β2AR-expressing HEK-293 cells were cotransfected with DsRed-clathrin (previously characterized as a marker for CCPs; Merrifield et al., 2002
; Puthenveedu and von Zastrow, 2006
) and GFP-PLIC-2. Colocalization of GFP-PLIC-2 (Supplemental Video S3, top) with DsRed-clathrin (Supplemental S3, bottom) was minimal in untreated cells. Agonist stimulation induced a small increase in the colocalization between PLIC-2 and CCPs (Supplemental Video S4). This observation further supports a role for PLIC-2 in regulating association of activated GPCRs with CCPs.
Because PLIC-2 expression specifically delayed GPCR endocytosis at the level of receptor clustering in to CCPs without affecting arrestin recruitment, we next determined whether PLIC-2 overexpression reduced cellular levels of arrestin that could underlie the observed endocytic effects. The levels of endogenous arrestin were measured by Western blotting from cell lysates transfected with GFP-PLIC-2 (Figure 5D). Overexpression of PLIC-2 had no affect on the levels of arrestin in these cells. Together, these results provide strong evidence that PLIC-2 inhibits GPCR endocytosis by delaying receptor coclustering with arrestin into CCPs.
PLIC-2 Is Required for Negative Regulation of GPCR Endocytosis
We hypothesized that the inhibitory effect of PLIC-2 overexpression on GPCR endocytosis might indicate an essential role for endogenous PLIC-2 in this process, either by inhibiting or promoting GPCR endocytosis. Therefore, we examined the effects of depleting cellular PLIC-2 on GPCR endocytosis by using siRNA. Cellular levels of PLIC-2 and PLIC-1 were substantially reduced by transfection of siRNA specific for each isoform, but not with nonsilencing (control) siRNA (Figure 6A). Knockdown of PLIC-2 in cells expressing Flag-V2R significantly increased the rate of V2R internalization after agonist stimulation (Figure 6B). In contrast, depletion of endogenous PLIC-1 to at least the same extent did not affect the kinetics of receptor internalization (Figure 6B). To gain further evidence for the endogenous role of PLIC-2, and to establish that PLIC-2 exerted its effect on more than one GPCR, depletion studies were extended to the β2AR. Lowering cellular amounts of PLIC-2 in HeLa cells expressing the Flag-β2AR increased the rate of receptor internalization after agonist stimulation (Figure 6C). As observed with overexpression, cellular levels of arrestin were unaffected by siRNA-mediated depletion of PLIC-2 (Figure 6D). Therefore, although PLIC-2 overexpression delayed receptor endocytosis, depletion of PLIC-2 enhanced the rate of receptor endocytosis. Together, these observations indicate that endogenous PLIC-2 acts as negative regulator of GPCR endocytosis.
|
| DISCUSSION |
|---|
|
|
|---|
The PLICs are a family of four homologous proteins, each of which contains an amino-terminal UbL domain and a carboxy-terminal UBA domain. PLIC-1 (ubiquilin-1) and PLIC-2 (ubiquilin-2) are predominantly cytosolic proteins (Wu et al., 1999
), whereas ubiquilin 4 (also called A1U, or ubin) is primarily nuclear (Davidson et al., 2000
). Ubiquilin 3 is expressed exclusively in testis (Conklin et al., 2000
) and its subcellular localization has not been examined. Although PLIC proteins were described originally as cytosolic partners for the integral membrane protein CD47 (also called IAP) (Wu et al., 1999
), subsequent evidence suggested that PLIC proteins function in targeting ubiquitinated proteins to the proteasome (Mah et al., 2000
; Kleijnen et al., 2000
; Funakoshi et al., 2002
). Besides their roles in proteasome targeting, PLICs have been found associated with membranes and components of the cytoskeleton (Wu et al., 1999
), and it was suggested that they might have other cellular functions in addition to regulating protein degradation (Wu et al., 1999
). In line with this, we have previously shown that PLIC-1, but not PLIC-2, regulates signaling of GPCRs that are specifically coupled to Gi (N'Diaye and Brown, 2003
). These results, together with the present study, suggest that both PLICs have distinct roles in regulating GPCR activity.
Our present results show that PLIC-2 functions as a negative regulator of endocytosis for both the V2R and the β2AR. PLIC-2 overexpression inhibited the rate of agonist-induced internalization of these receptors. Conversely, depletion of endogenous PLIC-2 by using siRNA accelerated agonist-induced endocytosis of these GPCRs. Because PLIC-2 has multiple interaction domains (Wu et al., 1999
), the overexpression and knockdown results suggest that PLIC-2 levels determine a balance between promoting and inhibiting the rate of agonist-induced internalization, possibly by sequestering associated proteins involved in promoting receptor entry into CCPs. This idea is also consistent with our findings that the UbL domain of PLIC-2 is required for its inhibitory effects on endocytosis. The UbL domain of PLIC-1 has been reported to interact with UIM-containing endocytic adaptors such as Eps15, Eps15R, and hepatocyte growth factor receptor substrate, although functional evidence of a role for PLIC-1 UbL domain in receptor trafficking was not addressed (Regan-Klapisz et al., 2005
). We have also observed that PLIC-2 binds to similar UIM-containing proteins (Figure 3; data not shown). Given the high homology of the UbL domains between PLIC-1 and -2 it is not unexpected that both ubiquilins would bind similar UIM–containing proteins. However, our data excludes a role for PLIC-1 isoform in regulating GPCR endocytosis, suggesting that a UbL–UIM interaction specific to PLIC-2 is involved or that there may be a differential interaction between the PLICs and UIM-containing proteins. Interestingly, in vitro binding assays suggest that PLIC-2 but not PLIC-1 specifically interacts with Epsin1 and 2 and that PLIC-2 may bind Eps15 with a higher affinity than PLIC-1. It is still possible that PLIC-2–specific interactions with other unidentified UIM-containing proteins underlie the endocytic function of PLIC-2 in vivo, given that both Eps15 and Epsin are also involved in the internalization of other membrane cargo such as TfR (Vanden Broeck and De Wolf, 2006
) and EGFR (Sigismund et al., 2005
; Vanden Broeck and De Wolf, 2006
), and we observe that PLIC-2 specifically regulates GPCR endocytosis with no effect on TfR and EGFR. Given that Epsin and Eps15 function as cargo adaptors for the clathrin pathway, further work remains to fully understand the functional implication of these associations with PLIC-2 during GPCR recruitment to CCPs.
Despite the significant delay in ligand-induced endocytosis of two GPCRs, neither TfR nor EGFR internalization was affected by overexpression of either PLIC-1 or PLIC-2. The molecular basis for this cargo specificity is unclear. We have previously shown that TfR can be internalized via CCPs distinct to those containing GPCRs (Cao et al., 1999
; Puthenveedu and von Zastrow, 2006
). One possibility, therefore, is that PLIC-2 regulation of GPCR clustering rate may function at an early step of the mechanism contributing to the selective concentration of GPCRs in distinct CCP subsets (Cao et al., 1999
; Mundell et al., 2006
; Puthenveedu and von Zastrow, 2006
).
A further key distinction between GPCRs, the TfR and the EGFR is the dependence on arrestins for internalization. Arrestin 3 (βARR-2) itself undergoes ligand-mediated ubiquitination, which has been shown to be required for β2AR internalization (Shenoy et al., 2001
). We did not observe any inhibitory effects of PLIC-2 expression on the rate of arrestin-3 translocation from the cytosol to the plasma membrane, or on cellular levels of arrestin, suggesting that PLIC-2 does not affect arrestin expression or its ability to associate with ligand-activated receptors. We did, however, observe that PLIC-2 retards the subsequent localization of GPCRs and arrestins to CCPs. This suggests that PLIC-2 specifically controls the rate at which receptor–arrestin complexes associate with the clathrin-associated coat structure. PLIC-2 could mediate this function by regulating the availability of a UIM-containing protein (such as Eps15 and/or Epsin) that facilitates cargo recruitment into CCPs. TIRF microscopy detected a small fraction of cellular PLIC-2 that associated transiently with CCPs, but the majority of PLIC-2 was present in the cytoplasm (Supplemental Videos S3 and S4). Thus, it remains to be determined whether PLIC-2 regulates GPCR-arrestin recruitment locally, by interacting with individual CCPs, or more globally by interacting with the cellular pool of key endocytic protein(s) outside of CCPs. The proposed model would not require PLIC-2 localization at the plasma membrane or in CCPs to exert its functional effects. TIRF and confocal images indicate that PLIC-2 can localize to multiple compartments, and do not exclude the possibility that the site of PLIC-2 action could be in the cytosol and/or at the plasma membrane. Given that the UBA deletion mutant, known to prevent formation of PLIC-enriched cytoplasmic aggregates, also inhibited receptor internalization, suggests that these PLIC-containing structures are not required for PLIC-2 regulation of GPCR endocytosis.
Agonist-induced internalization of GPCRs is well known to contribute to regulating GPCR signaling by promoting rapid signal desensitization, or by activating signaling pathways after internalization. Therefore, by regulating the rate of GPCR endocytosis, PLIC-2 in turn could contribute to regulating the temporal and spatial dynamics of cell signaling from these receptors. It is interesting to note that PLIC-1 specifically regulates signaling from Gi-coupled receptors (N'Diaye and Brown, 2003
), whereas the V2R and β2AR used in this study are Gs-coupled receptors. However, we have observed similar inhibitory effects on endocytosis of a Gi-coupled receptor, the delta-opioid receptor, by PLIC-2 overexpression (data not shown), suggesting a broader scope for PLIC-2 function in GPCR endocytosis. Our results also provide support for the idea that the kinetics of regulated endocytosis are exquisitely regulated by intrinsic cellular mechanisms that either delay or promote cargo recruitment in to CCPs via PLIC-2 levels (this study), and/or the dynamics of the GPCR-containing CCP via regulation of the residency time that GPCRs remain in CCPs (Puthenveedu and von Zastrow, 2006
).
Overall, these studies identify an unprecedented role for the ubiquitin-like protein PLIC-2 in negatively regulating GPCR recruitment into CCPs, and they illustrate that a balance of both positive and negative cellular mechanisms exist which could tightly regulate GPCR signaling and membrane trafficking.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
These authors contributed equally to this work. ![]()
Address correspondence to: Eric Joel Brown (ericbr{at}gene.com)
Abbreviations used: β2AR, β2-adrenergic receptor; CCP, clathrin-coated pit; EGFR, epidermal growth factor receptor; Eps15, epidermal growth factor receptor protein substrate 15; PLIC, protein linking IAP to cytoskeleton; TfR, transferrin receptor; UBA, ubiquitin-associated-; UbL, ubiquitin-like; UIM, ubiquitin-interacting motif; V2R, V2 vasopressin receptor.
| REFERENCES |
|---|
|
|
|---|
Bertolaet, B. L., Clarke, D. J., Wolff, M., Watson, M. H., Henze, M., Divita, G., and Reed, S. I. (2001). UBA domains mediate protein-protein interactions between two DNA damage-inducible proteins. J. Mol. Biol 313, 955–963.[CrossRef][Medline]
Cao, T. T., Deacon, H. W., Reczek, D., Bretscher, A., and von Zastrow, M. (1999). A kinase-regulated PDZ-domain interaction controls endocytic sorting of the beta2-adrenergic receptor. Nature 401, 286–290.[CrossRef][Medline]
Conklin, D., Holderman, S., Whitmore, T. E., Maurer, M., and Feldhaus, A. L. (2000). Molecular cloning, chromosome mapping and characterization of UBQLN3 a testis-specific gene that contains an ubiquitin-like domain. Gene 249, 91–98.[CrossRef][Medline]
Davidson, J. D., Riley, B., Burright, E. N., Duvick, L. A., Zoghbi, H. Y., and Orr, H. T. (2000). Identification and characterization of an ataxin-1-interacting protein: A1Up, a ubiquitin-like nuclear protein. Hum. Mol. Genet 9, 2305–2312.
DeWire, S. M., Ahn, S., Lefkowitz, R. J., and Shenoy, S. K. (2007). beta-Arrestins and cell signaling. Annu. Rev. Physiol 69, 483–510.[CrossRef][Medline]
Funakoshi, M., Sasaki, T., Nishimoto, T., and Kobayashi, H. (2002). Budding yeast Dsk2p is a polyubiquitin-binding protein that can interact with the proteasome. Proc. Natl. Acad. Sci. USA 99, 745–750.
Gage, R. M., Matveeva, E. A., Whiteheart, S. W., and von Zastrow, M. (2005). Type I PDZ ligands are sufficient to promote rapid recycling of G protein-coupled receptors independent of binding to N-ethylmaleimide-sensitive factor. J. Biol. Chem 280, 3305–3313.
Goodman, O. B., Jr, Krupnick, J. G., Santini, F., Gurevich, V. V., Penn, R. B., Gagnon, A. W., Keen, J. H., and Benovic, J. L. (1996). beta-Arrestin acts as a clathrin adaptor in endocytosis of the beta2-adrenergic receptor. Nature 383, 447–450.[CrossRef][Medline]
Hanyaloglu, A. C., McCullagh, E., and von Zastrow, M. (2005). Essential role of Hrs in a recycling mechanism mediating functional resensitization of cell signaling. EMBO J 24, 2265–2283.[CrossRef][Medline]
Hanyaloglu, A. C., and von Zastrow, M. (2007). A novel sorting sequence in the beta2-adrenergic receptor switches recycling from default to the Hrs-dependent mechanism. J. Biol. Chem 282, 3095–3104.
Herskovits, J. S., Burgess, C. C., Obar, R. A., and Vallee, R. B. (1993). Effects of mutant rat dynamin on endocytosis. J. Cell Biol 122, 565–578.
Hicke, L., and Dunn, R. (2003). Regulation of membrane protein transport by ubiquitin and ubiquitin-binding proteins. Annu. Rev. Cell Dev. Biol 19, 141–172.[CrossRef][Medline]
Kleijnen, M. F., Shih, A. H., Zhou, P., Kumar, S., Soccio, R. E., Kedersha, N. L., Gill, G., and Howley, P. M. (2000). The hPLIC proteins may provide a link between the ubiquitination machinery and the proteasome. Mol. Cell 6, 409–419.[CrossRef][Medline]
Klein, U., Muller, C., Chu, P., Birnbaumer, M., and von Zastrow, M. (2001). Heterologous inhibition of G protein-coupled receptor endocytosis mediated by receptor-specific trafficking of beta-arrestins. J. Biol. Chem 276, 17442–17447.
Lakadamyali, M., Rust, M. J., and Zhuang, X. (2006). Ligands for clathrin-mediated endocytosis are differentially sorted into distinct populations of early endosomes. Cell 124, 997–1009.[CrossRef][Medline]
Laporte, S. A., Oakley, R. H., Holt, J. A., Barak, L. S., and Caron, M. G. (2000). The interaction of beta-arrestin with the AP-2 adaptor is required for the clustering of beta 2-adrenergic receptor into clathrin-coated pits. J. Biol. Chem. 2000 275, 23120–23126.
Laporte, S. A., Oakley, R. H., Zhang, J., Holt, J. A., Ferguson, S. S., Caron, M. G., and Barak, L. S. (1999). The beta2-adrenergic receptor/betaarrestin complex recruits the clathrin adaptor AP-2 during endocytosis. Proc. Natl. Acad. Sci. USA 96, 3712–3717.
Mah, A. L., Perry, G., Smith, M. A., and Monteiro, M. J. (2000). Identification of ubiquilin, a novel presenilin interactor that increases presenilin protein accumulation. J. Cell Biol 151, 847–862.
Merrifield, C. J., Feldman, M. E., Wan, L., and Almers, W. (2002). Imaging actin and dynamin recruitment during invagination of single clathrin-coated pits. Nat. Cell Biol 4, 691–698.[CrossRef][Medline]
Moore, R. H., Sadovnikoff, N., Hoffenberg, S., Liu, S., Woodford, P., Angelides, K., Trial, J. A., Carsrud, N. D., Dickey, B. F., and Knoll, B. J. (1995). Ligand-stimulated beta 2-adrenergic receptor internalization via the constitutive endocytic pathway into rab5-containing endosomes. J. Cell Sci 108, 2983–2991.[Abstract]
Mundell, S. J., Luo, J., Benovic, J. L., Conley, P. B., and Poole, A. W. (2006). Distinct clathrin-coated pits sort different G protein-coupled receptor cargo. Traffic 7, 1420–1431.[CrossRef][Medline]
N'Diaye, E. N., and Brown, E. J. (2003). The ubiquitin-related protein PLIC-1 regulates heterotrimeric G protein function through association with Gbetagamma. J. Cell Biol 163, 1157–1165.
Oakley, R. H., Laporte, S. A., Holt, J. A., Barak, L. S., and Caron, M. G. (1999). Association of beta-arrestin with G protein-coupled receptors during clathrin-mediated endocytosis dictates the profile of receptor resensitization. J. Biol. Chem 274, 32248–32257.
Pfeiffer, R., Kirsch, J., and Fahrenholz, F. (1998). Agonist and antagonist-dependent internalization of the human vasopressin V2 receptor. Exp. Cell Res 244, 327–339.[CrossRef][Medline]
Premont, R. T., and Gainetdinov, R. R. (2007). Physiological roles of G protein-coupled receptor kinases and arrestins. Annu. Rev. Physiol 69, 511–534.[CrossRef][Medline]
Puthenveedu, M. A., and von Zastrow, M. (2006). Cargo regulates clathrin-coated pit dynamics. Cell 127, 113–124.[CrossRef][Medline]
Regan-Klapisz, E. et al. (2005). Ubiquilin recruits Eps15 into ubiquitin-rich cytoplasmic aggregates via a UIM-UBL interaction. J. Cell Sci 118, 4437–4450.
Reiter, E., and Lefkowitz, R. J. (2006). GRKs and beta-arrestins: roles in receptor silencing, trafficking and signaling. Trends Endocrinol. Metab 17, 159–165.[CrossRef][Medline]
Shenoy, S. K., McDonald, P. H., Kohout, T. A., and Lefkowitz, R. J. (2001). Regulation of receptor fate by ubiquitination of activated beta 2-adrenergic receptor and beta-arrestin. Science 294, 1307–1313.
Sigismund, S., Woelk, T., Puri, C., Maspero, E., Tacchetti, C., Transidico, P., Di Fiore, P. P., and Polo, S. (2005). Clathrin-independent endocytosis of ubiquitinated cargos. Proc. Natl. Acad. Sci. USA 102, 2760–2765.
Sorkin, A., and Von Zastrow, M. (2002). Signal transduction and endocytosis: close encounters of many kinds. Nat. Rev. Mol. Cell Biol 3, 600–614.[CrossRef][Medline]
Steyer, J. A., and Almers, W. (2001). A real-time view of life within 100 nm of the plasma membrane. Nat. Rev. Mol. Cell Biol 2, 268–275.[CrossRef][Medline]
Tanowitz, M., and von Zastrow, M. (2003). A novel endocytic recycling signal that distinguishes the membrane trafficking of naturally occurring opioid receptors. J. Biol. Chem 278, 45978–45986.
Traub, L. M., and Lukacs, G. L. (2007). Decoding ubiquitin sorting signals for clathrin-dependent endocytosis by CLASPs. J. Cell Sci 120, 543–553.
Vanden Broeck, D., and De Wolf, M. J. (2006). Selective blocking of clathrin-mediated endocytosis by RNA interference: epsin as target protein. Biotechniques 41, 475–484.[Medline]
von Zastrow, M. (2003). Mechanisms regulating membrane trafficking of G protein-coupled receptors in the endocytic pathway. Life Sci 74, 217–224.[CrossRef][Medline]
Walters, K. J., Kleijnen, M. F., Goh, A. M., Wagner, G., and Howley, P. M. (2002). Structural studies of the interaction between ubiquitin family proteins and proteasome subunit S5a. Biochemistry 41, 1767–1777.[CrossRef][Medline]
Wilkinson, C. R., Seeger, M., Hartmann-Petersen, R., Stone, M., Wallace, M., Semple, C., and Gordon, C. (2001). Proteins containing the UBA domain are able to bind to multi-ubiquitin chains. Nat. Cell Biol 3, 939–943.[CrossRef][Medline]
Wolfe, B. L., and Trejo, J. (2007). Clathrin-dependent mechanisms of G protein-coupled receptor endocytosis. Traffic 8, 462–470.[CrossRef][Medline]
Wu, A. L., Wang, J., Zheleznyak, A., and Brown, E. J. (1999). Ubiquitin-related proteins regulate interaction of vimentin intermediate filaments with the plasma membrane. Mol. Cell 4, 619–625.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
G. A. Yudowski, M. A. Puthenveedu, A. G. Henry, and M. von Zastrow Cargo-Mediated Regulation of a Rapid Rab4-Dependent Recycling Pathway Mol. Biol. Cell, June 1, 2009; 20(11): 2774 - 2784. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Saliba, M. Pangalos, and S. J. Moss The Ubiquitin-like Protein Plic-1 Enhances the Membrane Insertion of GABAA Receptors by Increasing Their Stability within the Endoplasmic Reticulum J. Biol. Chem., July 4, 2008; 283(27): 18538 - 18544. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||