![]() |
|
|
Vol. 19, Issue 4, 1717-1726, April 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Program in Cell Biology, Hospital for Sick Children, and Department of Biochemistry, University of Toronto, Toronto, ON, Canada M5G1X8
Submitted July 9, 2007;
Revised December 27, 2007;
Accepted January 30, 2008
Monitoring Editor: Erika Holzbaur
| ABSTRACT |
|---|
|
|
|---|
R-mediated phagocytosis. We show that several septins are expressed in RAW264.7 and J774 mouse macrophage cell lines and that SEPT2 and SEPT11 are colocalized with submembranous actin-rich structures during the early stages of Fc
R-mediated phagocytosis. In addition, SEPT2 accumulation is seen in primary human neutrophils and in nonprofessional phagocytes. The time course of septin accumulation mirrors actin accumulation and is inhibited by latrunculin and genistein, but not other inhibitors of phagocytosis. Inhibition of septin function by transient expression of the BD3 domain of BORG3, known to cause septin aggregation, or depletion of SEPT2 or SEPT11 by RNAi, significantly inhibited Fc
R-mediated phagocytosis of IgG-coated latex beads. Interestingly, this occurred without affecting the accumulation of actin or the actin-associated protein coronin-1. These observations show that, although not necessary for actin recruitment, septins are required for efficient Fc
R-mediated phagocytosis. | INTRODUCTION |
|---|
|
|
|---|
R) do so via a highly conserved extracellular Fc-binding domain (Ravetch and Kinet, 1991
Rs. Although the receptors themselves do not contain any intrinsic tyrosine kinase activity, several protein tyrosine kinases are known to be activated upon the clustering of Fc
Rs (Greenberg et al., 1994
RIIA receptor in nonphagocytic cells, such as COS or Chinese hamster ovary (CHO) cells, is sufficient to confer on them phagocytic properties (Indik et al., 1995a
Although Fc
R-mediated phagocytosis is an actin-dependent process, the role of other cytoskeletal elements is not particularly well understood. Several members of the septin family have been shown to be colocalized with filamentous actin (Kinoshita et al., 1997
, 2002
; Xie et al., 1999
), possibly by their binding to myosin (Joo et al., 2007
). Septins are a highly conserved family of filamentous GTPases that were originally identified in Saccharomyces cerevisiae as factors controlling bud-site selection (for reviews see Gladfelter et al., 2001
; Longtine and Bi, 2003
). However, since their discovery as factors that control cytokinesis in animal cells (Neufeld and Rubin, 1994
; Kinoshita et al., 1997
; Surka et al., 2002
), numerous observations suggest that septins may also regulate other important cellular functions including cell membrane dynamics and vesicle fusion events (Fares et al., 1995
, 1996
; DeMarini et al., 1997
; Hsu et al., 1998
; Beites et al., 1999
; Joo et al., 2005
).
In this study we investigated the role of mammalian septins during Fc
R-mediated phagocytosis. We find that the murine macrophage cell lines J774 and RAW264.7 express a subset of septin gene products. Antibodies to two of these, SEPT2 and SEPT11, reveal that these proteins transiently accumulate at the phagocytic cup in J774, RAW264.7, and human neutrophils and in CHO or HeLa cells engineered to phagocytose. Inhibition of septin function, either by the use of a dominant inhibitor of septins, or by RNA interference (RNAi)-mediated depletion, significantly inhibits Fc
R-mediated phagocytosis without affecting the signaling events required for actin accumulation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
DNA Constructs
The construction and utilization of mammalian expression vectors pEGFP-PLC
PH, pRFP-coronin-1, and pEGFP-PM have been described elsewhere (Botelho et al., 2000
; Scott et al., 2005
; Yan et al., 2005
). GFP3-BD3 plasmid (Joberty et al., 2001
) was kindly provided by I. G. Macara (University of Virginia, Charlottesville, VA). pmRFP-PLC
PH was generated by cutting the PH domain from pEGFP-PLC
PH vector using XhoI and BamHI and subcloning the fragment into the corresponding sites of pDsRed-Monomer C1 vector (Clontech, Mountain View, CA). To generate siRNA specific for nucleotides 524–544 relative to the start codon of the human septin 2, the following complementary pair of nucleotides for this region including a hairpin sequence containing a BamHI site were generated to include Acc65I and HindIII at the ends: 5'GTACCTCGAATATTGTGCCTGTCATTGGGATCCCAATGACAGGCACAATATTCTTTTTGGAAA3' and 5'AGCTTTTCCAAAAAGAATATTGTGCCTGTCATTGGGATCCCAATGACAGGCACAATATTCGAG3'. These were cloned into the corresponding sites of psiRNA-hH1GFPzeo vector, expressing short hairpin RNA (shRNA) and green fluorescent protein (GFP) from H1 and CMV promoters, respectively.
Cell Culture and Transfection with DNA or shRNA
Culture conditions for mouse macrophage cell lines RAW 264.7, J774, and CHO cells stably transfected with Fc
RIIA receptor (CHO-IIA) have been described elsewhere (Hackam et al., 1997
; Vieira et al., 2003
). CHO-IIA cells and RAW 264.7 cells were transiently transfected by using FuGene 6 (Roche, Nutley, NJ) or Lipofectamine 2000 (Invitrogen, Carlsbad, CA) as suggested by the manufacturers. Cells were transfected either with GFP3-BD3 using GFP as a control for 36–48 h or with shRNA-septin 2 using shRNA-control as control for 84–96 h. All other plasmids were transfected for 24 h.
Isolation of Human Neutrophils
Human blood was obtained from healthy volunteers. The neutrophils were purified using Polymorphprep (Accurate Chemical and Scientific, Westbury, NY) gradient separation procedure according to the manufacturer's instructions. Isolated neutrophils were resuspended in PBS containing 1 mM calcium chloride, 1 mM magnesium chloride, and 10 mM glucose at
1 x 106 cells/ml and used within 6 h of isolation.
Phagocytosis Assays and Inhibitors Treatment
Latex beads were opsonized with 0.8 mg/ml human IgG, incubated for 1 h at 37°C, and washed with phosphate-buffered saline (PBS) 3 times. When noted, the cells were treated with 250 nM wortmannin or 5 µM latrunculin B for 30 min or 100 µg/ml genistein for 3 h before phagocytosis. Opsonized beads were allowed to attach to the cells for 10 min on ice in cold HEPES-buffered RPMI. Unbound beads were washed away with cold PBS. Phagocytosis was started by replacing cold medium with HEPES-buffered RPMI prewarmed to 37°C and incubated at 37°C for the designated time. When necessary, the beads were stained by incubating with Cy5-labeled donkey anti-human IgG on ice for 15 min. Cells were then fixed with 4% paraformaldehyde and permeabilized as described previously (Yan et al., 2005
). Endogenous SEPT2 was detected by immunostaining with rabbit anti-human septin 2 primary antibody and Cy3-, FITC-, or Cy5-labeled donkey anti-rabbit secondary antibodies. In the case of SEPT11, cells were fixed for 10 min in 1% paraformaldehyde at 37°C, as above, stained with Cy5 donkey anti-human antibody to detect external beads, and then permeabilized with MeOH at –20°C for 10 min.
For phagocytic index assays, RAW 264.7 or CHO-IIA cells transfected either with GFP-BD3 or with shRNA-septin 2 were treated as above. HeLa cells were transfected with siRNA for 2 d and then retransfected with a plasmid containing the Fc
IIA-GFP receptor, and phagocytosis was performed on the third day. The phagocytic index was calculated by counting the average numbers of internalized beads per cell and normalized to that of the controls performed the same day. The binding index was calculated by counting the average numbers of bound beads on the cell surface without performing phagocytosis and normalized as per the phagocytic index.
Microscopy
Laser-scanning confocal microscopy was performed using an LSA 510 laser scanning confocal microscope (Carl Zeiss MicroImaging, Thornwood, NY) with 63x or 100x oil immersion objective and analyzed using Photoshop 6.0 (Adobe, San Jose, CA). Spinning disk images were captured on a Zeiss Axiovert 200M equipped with a Quorum confocal spinning disk head (Quorum Technologies, Guelph, ON, Canada).
| RESULTS |
|---|
|
|
|---|
IIA receptor. As can be seen in Figure 1, SEPT2, SEPT6, SEPT10, and SEPT11 were abundantly expressed in all four cell types. SEPT9 was detectable in CHO cells but much less so in brain and not at all in RAW 264.7 or J774 cells. SEPT7 and was not studied here because of the lack of a suitable antibody, and SEPT12 is not shown because it is only abundantly expressed in testes and was not present in the brain or any of the cell lines (Steels et al., 2007
|
-Receptor–mediated Phagocytosis: SEPT2 and SEPT11 associate with forming phagosomes
R-mediated phagocytosis, another actin-dependent cellular process, we first examined their distribution in cells phagocytosing latex beads via Fc
RIIA receptors (Figure 2). Robust accumulation of SEPT2 was observed in the murine macrophage cell lines J774 and RAW 264.7, although a stronger accumulation was observed in the former. In J774 cells SEPT2 accumulated all around the particle (Figure 2, a and b), whereas in RAW264.7 cells the accumulation was most typically seen at the base of the phagosome pedestal (Figure 2, c and d). Strong accumulation was also observed in primary human neutrophils (Figure 2, e and f) and in CHO-IIA cells stably expressing the Fc
IIA receptor (Figure 2, g and h). It should be noted that the time course of phagocytosis in each of these models is quite different, with neutrophils being the fastest and CHO-IIA being the slowest. To determine if this was a specific accumulation of SEPT2, or involved multiple septins, likely in a complex, we also stained for SEPT11 (Figure 2, i and j). Although immunocytochemistry with this antibody is inferior to that of SEPT2, a clear accumulation of SEPT11 could be seen associated with the nascent phagosome in CHO-IIA cells.
|
R-mediated phagocytosis, we next explored the time course of their appearance on the phagosome. Given the slower kinetics of CHO-IIA phagocytosis, these cells were chosen to monitor the internalization process. CHO-IIA cells were challenged with human IgG-opsonized latex beads for different periods of time at 37°C, fixed, and then stained for filamentous actin using Alexa488-labeled phalloidin and SEPT2. Within 3–5 min, opsonized latex beads are seen engaged in phagocytosis. Unsealed phagosomes were identified by staining for external human IgG after light fixation in the absence of detergent (not shown) and are indicated with open arrows (Figure 3a). The accumulation of filamentous actin in collar-like structures is characteristic of nascent phagosomes (Kolotila and Diamond, 1988
|
PH (Scott et al., 2005
PH. As with actin, the SEPT2 and PIP2 levels decrease on sealed phagosomes with a similar time course (solid arrows, 10 min).
SEPT2 Accumulation Depends on Actin
To begin to examine the signals that are responsible for septin accumulation at the nascent phagosome, CHO-IIA cells were treated with inhibitors capable of blocking phagocytosis. Wortmannin, a potent inhibitor of type I and III PI3 kinases, partially inhibits phagocytosis of large particles (Araki et al., 1996
; Cox et al., 1999
). After confirming that wortmannin had inhibited phagocytosis under the conditions used (not shown), there remains robust accumulation of actin at the base of bound opsonized beads, and SEPT2 can be seen to accumulate at these sites (Figure 4, a and b), indicating that PI3-kinase activity is not required for SEPT2 accumulation. We therefore examined an upstream event in the signaling process, the activation of src-family tyrosine kinases (Greenberg et al., 1993
). Using the general inhibitor of tyrosine kinases, genistein, we found that in the majority of the cells actin accumulation at the phagosome was inhibited. In these cells the accumulation of SEPT2 was also significantly reduced (Figure 4, c and d), consistent with the role of tyrosine kinases in early stages of actin remodeling.
|
SEPT2 Function Is Required for Efficient Phagocytosis
The transient accumulation of SEPT2 at the phagosome raised the possibility that it may provide a necessary function for phagocytosis. To determine if septins are required for phagocytosis, we used two approaches to inhibit their function. First, we took advantage of a dominant inhibitor known to inhibit septins by causing their aggregation. Borg proteins are Cdc42 effectors, and one of the Borg isoforms, Borg3, was shown to bind to septins via its third Borg homology domain, BD3. Overexpression of BD3 fused to GFP was shown to result in the coaggregation of GFP-BD3 and septins into cytoplasmic structures in the majority of cells (Joberty et al., 2001
). The aggregation depletes the available septins, thereby inhibiting their function. We therefore overexpressed GFP-BD3 in CHO-IIA cells and found cytoplasmic aggregates in which SEPT2 and GFP colocalized in
50% of transfected cells (data not shown), similar to that previously reported (Joberty et al., 2001
), but for all of these studies we limited our analysis to those cells exhibiting a clear cytoplasmic aggregation of GFP. Transfected cells were exposed to opsonized latex beads, allowed to phagocytose at 37°C for 30 min, and unbound beads were washed away. After fixation without permeabilization, the cells were stained with anti-human IgG antibodies to detect external particles. As can be seen in Figure 5a, cells overexpressing GFP-BD3 (arrowhead) were unable to phagocytose particles, whereas those transfected with GFP alone (Figure 5b, arrowhead) were fully able to internalize numerous beads. To ensure that this was not an artifact of the CHO-IIA model system, we repeated the same experiments in RAW 264.7 cells. As shown in Figure 5c, transfected RAW 264.7 cells (arrowhead) were unable to ingest bound particles (open arrow), whereas neighboring untransfected cells phagocytosed particles completely (filled arrow). Again, control GFP-transfected cells, like their untransfected neighbors, were fully capable of robust phagocytosis (Figure 5d).
|
70% of the cells were effectively transfected, and by Western blotting we see an
50% decrease in SEPT2 levels (Figure 6d). In SEPT2-shRNA–transfected cells (in Figure 5e, GFP-positive cells, indicated with a white dotted line) there were few internalized beads and many more that could be detected by antibodies in nonpermeabilized cells (open arrow). In contrast, neighboring GFP-negative cells were capable of ingesting particles efficiently (filled arrows). Transfection of the vector containing a scrambled sequence had no effect on phagocytosis efficiency (Figure 5f). Similar results were obtained when RAW 264.7 cells were used, although the low efficiency of transfection precluded their quantification.
|
IIA receptor along with GFP-BD3 into CHOIIA cells and found that, like SEPT2, SEPT11 accumulates in the BD3 aggregate and phagocytosis is inhibited in these cells (Figure 5g). This inhibition of phagocytosis could be due solely to the depletion of SEPT2, which is also found in the aggregate, so to determine if SEPT11 is also required for phagocytosis we set out to deplete it by siRNA. Unfortunately, the sequence of SEPT11 in Chinese hamster is not known, and available rodent SEPT11 siRNA sequences did not appear to work in this cell line (data not shown). However, HeLa cells, like CHO cells, become phagocytic when forced to express the Fc
IIA receptor. We therefore tested two commercial siRNA reagents specific for distinct target sequences and found that they were efficient at depletion of human SEPT11 protein from HeLa cells (Figure 6f). We therefore transfected HeLa cells with siRNA specific for human SEPT11, subsequently transiently transfected a GFP-tagged version of the Fc
IIA receptor, and measured phagocytosis in the GFP-positive cells. As can be seen in Figure 5h, Fc
IIA receptor-GFP-positive cells, which were depleted of SEPT11, failed to internalize beads, in contrast to the negative control siRNA. The same results were obtained with both siRNA sequences (not shown). The results of three independent experiments were quantified and are shown in Figure 6. As can be seen in Figure 6, a–c and e, overexpression of Borg3 GFP-BD3 or shRNA depletion of SEPT2 and siRNA depletion of SEPT11 resulted in a significant decrease of between 50 and 70% of the phagocytosis without affecting the ability of the particles to bind to the phagocytic cells, for both the engineered phagocytic CHO-IIA and HeLa cells and the macrophage cell line RAW 264.7.
SEPT2 Depletion Does Not Affect Actin Accumulation
Septins and actin are closely associated in cells (Kinoshita et al., 1997
; Xie et al., 1999
) and functional interdependence has been suggested to exist between them. Specifically, depletion of septins results in loss of stress fibers, suggesting that they stabilize actin filaments, and actin filaments appear to serve as templates for septin filament assembly (Kinoshita et al., 2002
; Schmidt and Nichols, 2004
). We therefore examined the effects of septin inhibition on actin accumulation at the nascent phagosome. As shown in Figure 7, a–c, in CHO-IIA cells expressing GFP-BD3 (Figure 7a), when particles bind to these cells there is robust accumulation of actin (arrows, Figure 7c) despite the failure to detect SEPT2 accumulation (Figure 7b). Similar observations are made with phosphotyrosine accumulation (Figure 7, d–f). This indicates that although septins may influence actin stability to some extent, they are not required for the accumulation of F-actin at the phagocytic cup.
|
| DISCUSSION |
|---|
|
|
|---|
RIIA.
The mechanisms recruiting septins to the phagosome are not yet clear, but we and others have previously shown that septins are capable of binding to phosphatidylinositol lipids (Zhang et al., 1999
; Casamayor and Snyder, 2003
; Rodriguez-Escudero et al., 2005
). Septins possess a conserved polybasic region adjacent to the GTPase domain that appears to be responsible for this interaction (Zhang et al., 1999
). In light of the importance of PIP2 production (Coppolino et al., 2002
; Defacque et al., 2002
) and phosphoinositide 3-kinase signaling (Araki et al., 1996
) to Fc
R-mediated phagocytosis, it is possible that one of roles of these lipids is in recruitment of the septins. Alternatively, others have shown that septins can be recruited to actin bundles by adaptor proteins such as anillin (Kinoshita et al., 2002
) and myosin (Joo et al., 2007
), raising the possibility that the accumulation of septins at the phagosome may be due to their assembly on actin-rich structures. However, anillin resides in the nucleus of interphase cells and would not be anticipated to be available as a linker. Hence, if septins are recruited to the phagosome by the presence of actin bundles, other scaffolding proteins such as myosin may be necessary to provide the linkage.
The exact role of septins in phagocytosis is unclear, but it does not appear to involve the recruitment or assembly of actin filaments in the vicinity of the nascent phagosome. This is somewhat surprising because mutations in yeast septins have been shown to affect the organization of filamentous actin (Adams and Pringle, 1984
). In addition, depletion of septins in mammalian cells results in a reduction of actin stress fibers (Kinoshita et al., 2002
; Joo et al., 2007
), suggesting that septins may play a role in stabilizing these structures. However, we observed significant actin accumulation at the site of Fc
RIIA receptor engagement, even in the absence of SEPT2 accumulation. In the case of SEPT2 or SEPT11 RNAi treatment, this could occur if other septins provided redundant roles in this process, but in cells transfected with GFP-BD3, all of the septins in the cell are aggregated together and therefore unavailable (unpublished observations and Joberty et al., 2001
).
Septins have also been implicated in regulating the stability of the microtubule network by binding to the microtubule-stabilizing protein MAP4 (Kremer et al., 2005
), and microtubule dynamics have been implicated in phagocytosis (Araki, 2006
; Khandani et al., 2007
). However, we were unable to see changes in microtubule clustering, MTOC reorientation toward the phagosome, or changes in the levels of acetylated tubulin following SEPT2 knockdown or BD3 transfection (data not shown), as would be expected if septins regulated microtubule dynamics during this process. Another possible role of septins in phagocytosis could stem from their ability to anchor multiprotein complexes, as they do at the yeast bud neck during cytokinesis (Gladfelter et al., 2001
). In mammalian cells the recruitment of filamentous septins may aid in recruiting other associated multiprotein complexes (Joo et al., 2007
) to forming phagosomes on the plasma membrane and disruption of filaments would diminish the efficiency of the phagosomal machinery of the cell. Evidence suggests that mammalian septins also participate in vesicle trafficking (Hsu et al., 1998
; Beites et al., 2001
), a process important for efficient phagosome formation (Bajno et al., 2000
; Niedergang et al., 2003
). It will therefore be interesting to determine whether depletion of septins in phagocytic cells inhibits membrane/vesicle trafficking during Fc
R mediated phagocytosis.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Address correspondence to: William S. Trimble (wtrimble{at}sickkids.ca)
| REFERENCES |
|---|
|
|
|---|
Araki, N., Johnson, M. T., and Swanson, J. A. (1996). A role for phosphoinositide 3-kinase in the completion of macropinocytosis and phagocytosis by macrophages. J. Cell Biol 135, 1249–1260.
Araki, N. (2006). Role of microtubules and myosins in Fc gamma receptor-mediated phagocytosis. Front. Biosci 11, 1479–1490.[Medline]
Bajno, L., Peng, X. R., Schreiber, A. D., Moore, H. P., Trimble, W. S., and Grinstein, S. (2000). Focal exocytosis of VAMP3-containing vesicles at sites of phagosome formation. J. Cell Biol 149, 697–706.
Beites, C. L., Peng, X. R., and Trimble, W. S. (2001). Expression and analysis of properties of septin CDCrel-1 in exocytosis. Methods Enzymol 329, 499–510.[Medline]
Beites, C. L., Xie, H., Bowser, R., and Trimble, W. S. (1999). The septin CDCrel-1 binds syntaxin and inhibits exocytosis. Nat. Neurosci 2, 434–439.[CrossRef][Medline]
Botelho, R. J., Teruel, M., Dierckman, R., Anderson, R., Wells, A., York, J. D., Meyer, T., and Grinstein, S. (2000). Localized biphasic changes in phosphatidylinositol-4,5-bisphosphate at sites of phagocytosis. J. Cell Biol 151, 1353–1368.
Casamayor, A., and Snyder, M. (2003). Molecular dissection of a yeast septin: distinct domains are required for septin interaction, localization, and function. Mol. Cell. Biol 23, 2762–2777.
Coppolino, M. G., Dierckman, R., Loijens, J., Collins, R. F., Pouladi, M., Jongstra-Bilen, J., Schreiber, A. D., Trimble, W. S., Anderson, R., and Grinstein, S. (2002). Inhibition of phosphatidylinositol-4-phosphate 5-kinase Ialpha impairs localized actin remodeling and suppresses phagocytosis. J. Biol. Chem 277, 43849–43857.
Cox, D., Tseng, C. C., Bjekic, G., and Greenberg, S. (1999). A requirement for phosphatidylinositol 3-kinase in pseudopod extension. J. Biol. Chem 274, 1240–1247.
Crowley, M. T., Costello, P. S., Fitzer-Attas, C. J., Turner, M., Meng, F., Lowell, C., Tybulewicz, V. L., and DeFranco, A. L. (1997). A critical role for Syk in signal transduction and phagocytosis mediated by Fcgamma receptors on macrophages. J. Exp. Med 186, 1027–1039.
Defacque, H., Bos, E., Garvalov, B., Barret, C., Roy, C., Mangeat, P., Shin, H. W., Rybin, V., and Griffiths, G. (2002). Phosphoinositides regulate membrane-dependent actin assembly by latex bead phagosomes. Mol. Biol. Cell 13, 1190–1202.
DeMarini, D. J., Adams, A. E., Fares, H., De Virgilio, C., Valle, G., Chuang, J. S., and Pringle, J. R. (1997). A septin-based hierarchy of proteins required for localized deposition of chitin in the Saccharomyces cerevisiae cell wall. J. Cell Biol 139, 75–93.
Fares, H., Goetsch, L., and Pringle, J. R. (1996). Identification of a developmentally regulated septin and involvement of the septins in spore formation in Saccharomyces cerevisiae. J. Cell Biol 132, 399–411.
Fares, H., Peifer, M., and Pringle, J. R. (1995). Localization and possible functions of Drosophila septins. Mol. Biol. Cell 6, 1843–1859.[Abstract]
Gladfelter, A. S., Pringle, J. R., and Lew, D. J. (2001). The septin cortex at the yeast mother-bud neck. Curr. Opin. Microbiol 4, 681–689.[CrossRef][Medline]
Greenberg, S., Burridge, K., and Silverstein, S. C. (1990). Colocalization of F-actin and talin during Fc receptor-mediated phagocytosis in mouse macrophages. J. Exp. Med 172, 1853–1856.
Greenberg, S., Chang, P., and Silverstein, S. C. (1993). Tyrosine phosphorylation is required for Fc receptor-mediated phagocytosis in mouse macrophages. J. Exp. Med 177, 529–534.
Greenberg, S., Chang, P., and Silverstein, S. C. (1994). Tyrosine phosphorylation of the gamma subunit of Fc gamma receptors, p72syk, and paxillin during Fc receptor-mediated phagocytosis in macrophages. J. Biol. Chem 269, 3897–3902.
Greenberg, S., Chang, P., Wang, D. C., Xavier, R., and Seed, B. (1996). Clustered syk tyrosine kinase domains trigger phagocytosis. Proc. Natl. Acad. Sci. USA 93, 1103–1107.
Hackam, D. J., Rotstein, O. D., Schreiber, A., Zhang, W., and Grinstein, S. (1997). Rho is required for the initiation of calcium signaling and phagocytosis by Fcgamma receptors in macrophages. J. Exp. Med 186, 955–966.
Hsu, S. C., Hazuka, C. D., Roth, R., Foletti, D. L., Heuser, J., and Scheller, R. H. (1998). Subunit composition, protein interactions, and structures of the mammalian brain sec6/8 complex and septin filaments. Neuron 20, 1111–1122.[CrossRef][Medline]
Indik, Z. K., Park, J. G., Hunter, S., and Schreiber, A. D. (1995a). The molecular dissection of Fc gamma receptor mediated phagocytosis. Blood 86, 4389–4399.
Indik, Z. K., Park, J. G., Pan, X. Q., and Schreiber, A. D. (1995b). Induction of phagocytosis by a protein tyrosine kinase. Blood 85, 1175–1180.
Joberty, G., Perlungher, R. R., Sheffield, P. J., Kinoshita, M., Noda, M., Haystead, T., and Macara, I. G. (2001). Borg proteins control septin organization and are negatively regulated by Cdc42. Nat. Cell Biol 3, 861–866.[CrossRef][Medline]
Joo, E., Surka, M. C., and Trimble, W. S. (2007). Mammalian SEPT2 is required for scaffolding nonmuscle myosin II and its kinases. Dev. Cell 13, 677–690.[CrossRef][Medline]
Joo, E., Tsang, C. W., and Trimble, W. S. (2005). Septins: traffic control at the cytokinesis intersection. Traffic 6, 626–634.[CrossRef][Medline]
Khandani, A., Eng, E., Jongstra-Bilen, J., Schreiber, A. D., Douda, D., Samavarchi-Tehrani, P., and Harrison, R. E. (2007). Microtubules regulate PI-3K activity and recruitment to the phagocytic cup during Fcgamma receptor-mediated phagocytosis in nonelicitied macrophages. J. Leukoc. Biol 82, 417–428.
Kiefer, F., Brumell, J., Al-Alawi, N., Latour, S., Cheng, A., Veillette, A., Grinstein, S., and Pawson, T. (1998). The Syk protein tyrosine kinase is essential for Fcgamma receptor signaling in macrophages and neutrophils. Mol. Cell. Biol 18, 4209–4220.
Kinoshita, M., Field, C. M., Coughlin, M. L., Straight, A. F., and Mitchison, T. J. (2002). Self- and actin-templated assembly of mammalian septins. Dev. Cell 3, 791–802.[CrossRef][Medline]
Kinoshita, M., Kumar, S., Mizoguchi, A., Ide, C., Kinoshita, A., Haraguchi, T., Hiraoka, Y., and Noda, M. (1997). Nedd5, a mammalian septin, is a novel cytoskeletal component interacting with actin-based structures. Genes Dev 11, 1535–1547.
Kolotila, M. P., and Diamond, R. D. (1988). Stimulation of neutrophil actin polymerization and degranulation by opsonized and unopsonized Candida albicans hyphae and zymosan. Infect. Immun 56, 2016–2022.
Kremer, B. E., Haystead, T., and Macara, I. G. (2005). Mammalian septins regulate microtubule stability through interaction with the microtubule binding protein MAP4. Mol. Biol. Cell 16, 4648–4659.
Longtine, M. S., and Bi, E. (2003). Regulation of septin organization and function in yeast. Trends Cell Biol 13, 403–409.[CrossRef][Medline]
Neufeld, T. P., and Rubin, G. M. (1994). The Drosophila peanut gene is required for cytokinesis and encodes a protein similar to yeast putative bud neck filament proteins. Cell 77, 371–379.[CrossRef][Medline]
Niedergang, F., Colucci-Guyon, E., Dubois, T., Raposo, G., and Chavrier, P. (2003). ADP ribosylation factor 6 is activated and controls membrane delivery during phagocytosis in macrophages. J. Cell Biol 161, 1143–1150.
Ravetch, J. V., and Kinet, J. P. (1991). Fc receptors. Annu. Rev. Immunol 9, 457–492.[Medline]
Rodriguez-Escudero, I., Roelants, F. M., Thorner, J., Nombela, C., Molina, M., and Cid, V. J. (2005). Reconstitution of the mammalian PI3K/PTEN/Akt pathway in yeast. Biochem. J 390, 613–623.[CrossRef][Medline]
Schmidt, K, and Nichols, B. J. (2004). Functional interdependence between septin and actin cytoskeleton. BMC Cell Biol 5, 43.[CrossRef][Medline]
Scott, C. C., Dobson, W., Botelho, R. J., Coady-Osberg, N., Chavrier, P., Knecht, D. A., Heath, C., Stahl, P., and Grinstein, S. (2005). Phosphatidylinositol-4,5-bisphosphate hydrolysis directs actin remodeling during phagocytosis. J. Cell Biol 169, 139–149.
Steels, J. D., Estey, M. P., Froese, C. D., Renaud, D., Pace-Asciak, C, and Trimble, W. S. (2007). Septin 12 is a component of the sperm annulus. Cell Motil. Cytoskelet 64, 794–807.[CrossRef][Medline]
Surka, M. C., Tsang, C. W., and Trimble, W. S. (2002). The mammalian septin MSF localizes with microtubules and is required for completion of cytokinesis. Mol. Biol. Cell 13, 3532–3545.
Vieira, O. V., Bucci, C., Harrison, R. E., Trimble, W. S., Lanzetti, L., Gruenberg, J., Schreiber, A. D., Stahl, P. D., and Grinstein, S. (2003). Modulation of Rab5 and Rab7 recruitment to phagosomes by phosphatidylinositol 3-kinase. Mol. Cell. Biol 23, 2501–2514.
Xie, H., Howard, J., Surka, M., and Trimble, W. (1999). Characterization of the mammalian septin H5: distinct patterns of cytoskeletal and membrane association from other mammalian septins. Cell Motil. Cytoskelet 43, 52–62.[CrossRef][Medline]
Yan, M., Collins, R. F., Grinstein, S., and Trimble, W. S. (2005). Coronin-1 function is required for phagosome formation. Mol. Biol. Cell 16, 3077–3087.
Zhang, J., Kong, C., Xie, H., McPherson, P. S., Grinstein, S., and Trimble, W. S. (1999). Phosphatidylinositol polyphosphate binding to the mammalian septin H5 is modulated by GTP. Curr. Biol 9, 1458–1467.[CrossRef][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||