![]() |
|
|
Vol. 19, Issue 6, 2509-2519, June 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Molecular Biology, Umeå University, SE-901 87 Umeå, Sweden
Submitted September 12, 2007;
Revised February 19, 2008;
Accepted March 6, 2008
Monitoring Editor: Marianne Bronner-Fraser
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
E proteins can bind to E-box sequences, the DNA recognition sequences of MyoD responsive promoters of muscle-specific genes, as homodimers, but these are poor activators of expression from a MyoD responsive reporter. In contrast to overexpression of MyoD, overexpression of E12, E47, or HEB does not result in conversion of fibroblasts to muscle cells (Davis and Weintraub, 1992
). MyoD heterodimers with E-protein must therefore compete successfully with E-protein homodimers to enable muscle differentiation. Activity of MyoD, and most likely also Myf-5, leads to enhanced heterodimerization ability and increased expression of the protein through positive feedback loops (Yun and Wold, 1996
; Cole et al., 2004
). However, no mechanism has been described that enables initially expressed MyoD (or Myf-5) to successfully compete with E-protein homodimers at the critical promoters before the positive feedback mechanisms.
Various reports have demonstrated the importance of Ca2+ signaling and the Ca2+ sensor protein calmodulin (CaM) in activation of myogenic transcription factors and myogenesis (Delling et al., 2000
; McKinsey et al., 2002
; Porter et al., 2002
; Berger et al., 2003
; Friday et al., 2003
). E-protein homodimers have been shown to bind to Ca2+-loaded calmodulin (Ca2+/CaM) through their bHLH domain, resulting in inhibition of their DNA binding (Corneliussen et al., 1994
). We have also reported that transcriptional activation by E-proteins, but not by MyoD, can be inhibited by Ca2+/CaM through a direct physical interaction with the basic DNA-binding sequence in their bHLH domain, leading to inhibition of their in vivo DNA binding (Saarikettu et al., 2004
). The in vitro DNA binding of homodimers of the E-protein E12, but not MyoD heterodimers with E12, is inhibited by Ca2+/CaM (Corneliussen et al., 1994
). Ca2+ signaling has therefore the potential to enable activity of MyoD heterodimers with E-proteins in myogenesis through Ca2+/CaM inhibition of DNA binding of competing E-protein homodimers. In this report, we show that CaM-resistant mutants of E12 are inhibitory to MyoD-initiated myogenic conversion of transfected fibroblasts. Our data support the notion that Ca2+ signaling through CaM enables myogenic differentiation by inhibiting DNA binding of E-protein homodimers, thereby selectively promoting DNA binding of myogenic bHLH protein/E-protein heterodimers.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmids
The cDNAs coding for murine E12, basic sequence mutants m4, m5, and m847 of E12 and murine MyoD, all inserted in the mammalian expression vector pcDNAI/amp (Invitrogen), have been described previously (Saarikettu et al., 2004
). The E12 basic sequence mutants m8H47, m8N47, m8S47, and m8T47 inserted in pcDNAI/amp were generated by standard PCR mutagenesis as previously described (Saarikettu et al., 2004
). The SEF2-1 expression plasmid has been described previously (Saarikettu et al., 2004
). The MyoD and E-protein responsive luciferase reporters, 4x(MEF1)-luciferase and 6x(µE5 + µE2)-luciferase, respectively, and the hCMV-β-gal plasmid for normalization of transfections have been described previously (Corneliussen et al., 1994
). The cDNAs coding for rat Id1, Id2, and Id3, all inserted in pcDNA3 (Invitrogen), were kindly provided by Dr. Michael D. Walker (Weizmann Institute of Science, Rehovot, Israel). MyoD–E12 and MyoD–m847 "tethered" dimers in pcDNAI/amp were generated by fusing the C-terminus of MyoD at the restriction site TthIII1 to the N-terminus of either E12 or m847 mutant at the restriction site BsmI, using oligonucleotides encoding a previously described linker peptide (peptide number 2 of Neuhold and Wold, 1993
).
Immunocytochemistry and Myogenesis Assays
NIH-3T3 fibroblasts grown on glass coverslips were fixed with 2% paraformaldehyde in phosphate-buffered saline (PBS) for 15 min at room temperature and immunostained essentially as described previously (Hughes et al., 2001
). CaM immunostaining was performed using a rabbit polyclonal antibody against CaM (FL-149; Santa Cruz Biotechnology, Santa Cruz, CA) and fluorescein isothiocyanate (FITC)-conjugated donkey anti-rabbit IgG as secondary antibody (Jackson ImmunoResearch Laboratories, West Grove, PA). In myogenesis analyses, cells were immunostained using rabbit anti-MyoD antibody (M-318; Santa Cruz Biotechnology) and mouse anti-skeletal muscle myosin antibody (MF-20 concentrate; Developmental Studies Hybridoma Bank at the University of Iowa). Secondary antibodies were FITC-conjugated donkey anti-rabbit IgG and TRITC-conjugated donkey anti-mouse IgG (both from Jackson ImmunoResearch Laboratories). All antibodies were used at a dilution of 1:50. CaM immunostaining was analyzed by confocal microscopy using a Leica SP2 confocal imager system (Deerfield, IL). For myogenesis analyses, numbers of myosin-positive cells and the proportion of myosin-stained cells in the population of MyoD-stained cells were determined by visual observation using epifluorescence microscopy. For analyses of rescue of inhibition by small interfering RNA (siRNA) against E2A, NIH-3T3 fibroblasts were cotransfected with appropriate plasmid DNA and 10 pmol/105 cells of murine E2A siRNA (sc-35246; Santa Cruz Biotechnology) using Lipofectamine 2000, according to the manufacturer's recommendations.
Western Blot and Electrophoretic Mobility Shift Assays
Western blot was performed using the WesternBreeze immunodetection system (Invitrogen) according to the manufacturer's instructions, using antibodies to E12 (H-208), to MyoD (M-318; both from Santa Cruz Biotechnology) and to
-tubulin (clone B-5-1-2; Sigma-Aldrich, St. Louis, MO).
For electrophoretic mobility shift assays (EMSA), NIH-3T3 cells were transiently transfected with 2 µg of expression vector for E12 or E12 mutant and 2 µg of expression vector for MyoD. Twenty-four hours later, nuclear extracts were prepared as previously described (Saarikettu et al., 2004
) and used in EMSA with a MEF1 E-box sequence probe as previously described (Onions et al., 1997
).
Chromatin Immunoprecipitation
Transfected NIH-3T3 fibroblasts were cross-linked with 1% formaldehyde for 10 min at room temperature after 2 d in differentiation medium. Chromatin immunoprecipitation was performed as previously described (Saarikettu et al., 2004
) using 5 µg/ml anti-MyoD (M-318; Santa Cruz Biotechnology) antibody or 5 µg/ml anti-E47 (N-649; Santa Cruz Biotechnology) antibody, which also recognizes E12. The immunoprecipitated DNA was used as template to amplify a DNA sequence of the MyoD promoter containing two MyoD-binding E-boxes (Zingg et al., 1994
). The semiquantitative PCR amplification was with the primer pair 5'-GGTCAGTACAGGCTGGAGGA-3' and 5'-GTGTAGTAGGGCGGAGCTTG-3' and was resolved on a 1.5% agarose gel. The quantitative real-time PCR analysis of the chromatin immunoprecipitation was with the primer pair 5'-ACAGGCTGGAGGAGTAGAC-3' and 5'-GCCAATAGGAGTGTAGGG-3' and was normalized to the levels of immunoprecipitated glyceraldehyde-3-phosphate dehydrogenase (GAPDH) DNA.
Real-Time PCR
Total RNA was extracted using Trizol Reagent (Invitrogen) according to the instruction manual. First-strand cDNA was synthesized from 1 µg of total RNA using a cDNA synthesis kit with random hexamers (Fermentas, Hanover, MD) according to the manufacturer's instructions. Real-time PCR analysis was performed in triplicate in 25-µl reaction volumes using iTaq reaction mix (Bio-Rad, Richmond, CA) and the iCycler iQ Real-Time PCR Detection System (Bio-Rad). Primer sets were designed using Beacon Designer software (Bio-Rad). GAPDH was used as an internal control. Real-time PCR (RT-PCR) values were determined by Comparative Quantification (ABI Prism 7700 Sequence Detection System User Bulletin 2 (2001)). The GAPDH primers used were GCTTGTCATCAACGGGAAG and TTGTCATATTTCTCGTGGTTCA, and the TaqMan probe for GAPDH was 6-FAM-TCACCATCTTCCAGGAGCGAGACC-TAMRA. The primer specific for endogenous MyoD mRNA was TCTGACAGGACAGGACAGG, and the primer specific for exogenous MyoD mRNA was CTAGAGAACCCACTGCTTACT. The reverse primer was GCTCCATATCCCAGTTCCTG and the TaqMan probe was 6-FAM-CAACCCAAGCCGTGAGAGTCGTC-TAMRA for both the endogenous and the exogenous MyoD mRNA.
| RESULTS |
|---|
|
|
|---|
|
80% of the MyoD-expressing cells expressed myosin, and coexpression of wild-type E12 with MyoD at a ratio of 1:1 did not significantly affect myogenic conversion compared with expression of MyoD alone. In contrast to wild-type E12, all E12 basic domain mutants tested inhibited MyoD from inducing myogenic conversion (Figure 2B). The E12 mutants m4 and m5, which have only slightly decreased sensitivity to CaM (Saarikettu et al., 2004
10-fold by day 4 of differentiation (Figure 2F). In contrast, the ratio between endogenous and exogenous MyoD mRNA remained almost unchanged during 4 d in differentiation medium for the MyoD-transfected cells cotransfected with the m847 mutant of E12, and there was only a relatively small increase in this ratio on cotransfection with the m8N47 mutant (Figure 2F). Thus, the positive-feedback loop of MyoD to transcriptionally activate its own expression, which still functions when wild-type E12 is overexpressed, does not function in cells expressing a CaM-resistant mutant of E12 (see also below).
|
Correlation between CaM Resistance and Myogenesis Inhibition Properties of the E12 Basic Sequence Mutants
Analysis of the sensitivity of the m847 CaM-resistant mutant of E12 to the inhibitory HLH proteins Id1, Id2, and Id3 (Ruzinova and Benezra, 2003
) showed that this mutant is partially resistant to Id proteins (Figure 3A), possibly due to a reduced ability to dimerize with them. Because the sensitivity of E12 mutants to inhibition by Id proteins could affect their cooperation with MyoD in induction of myogenesis, CaM-resistant mutants of E12 that showed an Id sensitivity similar to that of wild-type E12 were essential to distinguish CaM and Id protein effects in our myogenesis analyses. Thus, the four E12 basic sequence mutants m8H47, m8N47, m8S47, and m8T47 (Figure 2A) were generated, and their sensitivities to inhibition by CaM and Id overexpression were determined and compared. As shown in Figure 3A, the four mutants were more sensitive than mutant m847 to inhibition by all Id proteins, but to different extents.
|
An alternative explanation to the results presented above would be that heterodimerization with MyoD to bind DNA is intrinsically poor in the mutants. We analyzed therefore the ability of the mutants to dimerize with MyoD to bind DNA. The analysis was made by EMSA in the absence of Ca2+ using nuclear extracts of transfected NIH-3T3 cells under growth conditions (Figure 3E). The appearance of the MyoD-E12-DNA complex was dependent on transfection with both the MyoD and the E12 expression plasmid (lane 3 and data not shown). All mutants were found to form DNA-binding heterodimers with MyoD with as high efficiency as wild-type E12 (Figure 3E). Thus, the inhibition of myogenesis by the CaM-resistant mutants is not through a deficient intrinsic ability of these mutants to efficiently heterodimerize with MyoD to bind DNA.
CaM-resistant Mutants of E12 Show Reduced Activation of Transcription upon Coexpression with MyoD
We then studied the effects of the E12 basic sequence mutants on transcriptional activation of a MyoD-responsive luciferase reporter by MyoD. This reporter contains four tandem MyoD-binding E-boxes and a basal promoter to drive luciferase expression (Corneliussen et al., 1994
). NIH-3T3 cells were transiently transfected and were allowed to differentiate for 4 d before analysis of the reporter activity. This activity was sevenfold higher in transfections of MyoD compared with transfections of E12, and as expected, coexpression of wild-type E12 with MyoD further activated the reporter activity synergistically by a factor of 7 (Figure 4A). All CaM-resistant mutants of E12 were less efficient than wild-type E12 in promoting transcriptional activation of the MyoD reporter by MyoD. The most CaM-resistant mutant, m847, was also the most deficient mutant in cooperating with MyoD to activate the reporter. Even mutant m8S47, which exhibited increased activation of transcription from the E-protein homodimer driven luciferase reporter in the transfected B-cell line (Figure 3A), was deficient in cooperation with MyoD to activate the MyoD reporter (Figure 4A). Thus, the results of the mutant analyses are compatible with our model (Figure 1B) where CaM functions as a Ca2+-regulated inhibitor of E-protein homodimers that could otherwise repress myogenic differentiation by competing with myogenic MyoD/E-protein heterodimers.
|
Because a decrease in intracellular Ca2+ resulted in an inhibition of expression from the MyoD responsive promoter by coexpressed MyoD and wild-type—but not mutant—E12 (Figure 4B), we were prompted to analyze the effects of an increase in intracellular Ca2+. Stimulation of cells with either a Ca2+ ionophore, ionomycin, or a Ca2+ pump inhibitor, thapsigargin, increased reporter activity in transfections of MyoD together with wild-type E12 but not together with the CaM-resistant mutant m8N47 (Figure 5A). To determine the duration of increased Ca2+ levels required for transcriptional activation by MyoD/E12 heterodimers, transfected cells were treated with ionomycin for the first 6, 12, or 24 h of differentiation only, and, as a control, for all 4 d. Ionomycin stimulation for 12 h was sufficient to obtain most of the induction, and 24 h was sufficient to give an induction level that was not significantly lower than the stimulation during the whole 4-d differentiation period (Figure 5B). These results suggest that activation of MyoD/E12 by Ca2+ stimulation is a relatively fast response and that this activation could subsequently be maintained throughout differentiation by one or more other mechanisms.
|
|
Rescue of Myogenesis by Wild-Type, But Not CaM-resistant, E12 after E12/E47 Depletion with siRNA
The inhibition of myogenesis by CaM-resistant, but not wild-type, E12 described above (Figures 2, B–E, 3D, and 6, B and C) was observed after overexpression experiments. To analyze whether Ca2+/CaM inhibition of E12 homodimers was important for myogenesis by MyoD–E12 heterodimers at low levels of E12 also, we used RNA interference in the NIH-3T3 fibroblasts to inhibit endogenous expression of the E2A gene products E12 and E47. As previously reported (Nie et al., 2003
), the cell line expressed E12/E47 (Figure 7A). Including siRNA against E12 and E47 in MyoD transfections reduced the expression of E12/E47 by an average of 86.3 ± 3.1% and resulted in a 90.1 ± 1.7% reduced expression of MyoD (Figure 7A), which is in line with the existence of a positive-feedback loop of MyoD to transcriptionally activate its own expression (Zingg et al., 1994
) and the previously reported need for heterodimerization with E12/E47 for MyoD function (Lassar et al., 1991
; Massari and Murre, 2000
). Restoring the amounts of wild-type E12 in the presence of E2A siRNA, by transfection of an E12 expression plasmid, restored the expression of MyoD (Figure 7A). In contrast, transfection of expression plasmid for m847 mutant of E12 did not restore expression of MyoD (20.3 ± 3.2% of wild-type level), and transfection of expression plasmid for the m8N47 mutant only partially restored the MyoD expression (Figure 7A). Thus, the positive-feedback loop of MyoD to activate its own expression does not function when the E12 that the cells express is CaM-resistant.
|
10% and the myogenesis index to
40% (Figure 7, B and C). Importantly, in contrast to restoring the amounts of wild-type E12 in the presence of E2A siRNA, which resulted in a nearly complete rescue of myogenesis in a dose-dependent manner, no amount of expression vector for CaM-resistant E12 mutant m847 or m8N47 rescued myogenesis (Figure 7, B and C). Comparison of myogenesis with corresponding doses of expression plasmids for the wild type and mutant showed that CaM-resistant E12 was also inhibitory to myogenesis at levels that (owing to the siRNA) were the same as or lower than normal E12/E47 levels (Figure 7, B and C). Furthermore, the CaM-resistant mutants even reduced the averages of the myogenic indices below the level seen without adding mutant (Figure 7C), probably reflecting the fact that the mutants can reduce myogenic indices approximately as much as the siRNA against E12/E47 (cf. Figures 2B and 7C). To analyze if only E12 could rescue myogenesis, we compared the effect of transfection of expression plasmid for another E-protein, SEF2-1 (E2-2). The SEF2-1 expression plasmid was approximately as efficient as the E12 expression plasmid both in restoring the number of myosin-positive cells and in restoring the myogenesis index (Figure 7, B and C), showing that E12 is not the only E-protein with the ability to participate in myogenesis. Furthermore, coexpression of SEF2-1 with the CaM-resistant E12 mutant m847 reduced the ability of SEF2-1 to rescue myogenesis (Figure 7, B and C), supporting that they compete for the same target, MyoD. In summary, CaM-resistant E12, the homodimers of which cannot be inhibited by Ca2+, does not function as a heterodimer partner in the myogenesis, which strongly suggests that inhibition of homodimerization of E12/E47 by Ca2+-loaded CaM is also essential for myogenesis at low or normal levels of E12/E47.
Myogenesis by Tethered MyoD-E12 Dimers Is Insensitive to CaM-resistant E12 Mutants
The results above strongly suggest that the block of myogenesis by the CaM resistant mutants is due to Ca2+/calmodulin regulation of E-protein homodimers versus MyoD/E-protein heterodimers. However, persistent activity of homodimers of the CaM-resistant mutants could alternatively be hypothesized to block myogenesis through activation of nonmyogenic genes, provided the existence of genes activated by E12 homodimers and blocking myogenic differentiation in these cells. To challenge whether the effects were dependent on regulation by homodimers versus heterodimers or due to the hypothesized alternative, we analyzed whether myogenesis induced by the tethered MyoD-E12 protein was inhibited by the E12 mutants. Myogenesis by tethered MyoD-E12 protein should be resistant to the E12 mutants if alternative dimerizations are critical for the inhibitory effect of the CaM-resistant mutants, but it should be fully sensitive with the other hypothesis. To enable challenge with a large excess of expression vector for CaM-resistant mutants, the amount of transfected expression vector for tethered MyoD–E12 was reduced compared with the experiment in Figure 6, B and C, to a level where the number of myosin-positive cells was below that with transfection of MyoD expression plasmid (Figure 7D). Myogenesis by the tethered MyoD-E12 heterodimer was indeed resistant to the challenge of overexpression of E12 mutants. In contrast to cotransfection of MyoD with m847 mutant of E12, which reduced the number of myosin-positive cells by about fourfold at a 1:1 ratio (Figures 6B and 7D) and more than 10-fold at a 1:4 ratio (Figure 2D), the corresponding cotransfection of MyoD-E12 tether with m847 or m8N47 mutant did not significantly reduce the myosin-positive cells even when a fourfold excess of the mutant was added (Figure 7D). Furthermore, the myogenesis index did not decrease even with the fourfold excess of CaM-resistant mutant. The index was only varying between 71 and 81%, and there was no difference between overexpression of wild-type or CaM-resistant mutant of E12. These results show that myogenesis by the tethered heterodimer is indeed resistant to the challenge of overexpression of E12 mutants in agreement with Ca2+/calmodulin regulation of E-protein homodimers versus MyoD/E-protein heterodimers and in disagreement with interpretations not involving alternative dimers. Thus, alternative dimerizations are critical for the inhibitory effect of the CaM resistant mutants on the myogenesis.
| DISCUSSION |
|---|
|
|
|---|
The reduction in the ability of the E12 basic sequence mutants to activate the MyoD-responsive promoter in cooperation with MyoD was similar, but not identical, to their ability to interfere with MyoD in induction of myogenic conversion (cf. Figures 2B and 4A). Both MyoD-induced myogenic conversion of transfected cells and 4x(MEF1)-luciferase reporter activity rely on active MyoD in a heterodimer with E12. It should be noted, however, that the luciferase reporter activity is relatively high even 1 d after transfection in cells in growth medium, whereas myogenesis requires a period of several days of subsequent differentiation to be detectable. The data from the myogenesis and reporter assays should therefore be compared with caution, but they show that both myogenesis and synergistic transcriptional activation by MyoD are negatively affected by CaM-resistant E12 mutants (Figures 2B and 4A).
Reduction of intracellular Ca2+ concentration in C2C12 myoblast cells upon treatment with the L-type Ca2+ channel blockers nifedipine and verapamil has been shown to inhibit myogenic differentiation (Porter et al., 2002
). The Ca2+ blockers also inhibited the expression of a luciferase reporter driven by the skeletal
-actin promoter without affecting the expression level of the myogenic bHLH protein Myf5. In this article we have shown that the Ca2+ channel blockers inhibit transcriptional activation by MyoD and by coexpressed MyoD together with wild-type E12 from a MyoD-responsive reporter containing MyoD-binding E-boxes (Figure 4B). In contrast, transcriptional activation by MyoD coexpressed with a CaM-resistant mutant of E12 was not affected by the Ca2+ blockers (Figure 4B). At least some of the inhibitory effect of Ca2+ channel blockers on myogenesis observed by Porter et al. (2002)
could therefore be due to an increase in E-protein homodimers competing with the MyoD/E-protein heterodimers due to a reduction of Ca2+/CaM levels. Conversely, increases in intracellular Ca2+ concentration by treatment with either ionomycin or thapsigargin resulted in an increase in transcriptional activation of the MyoD reporter by MyoD coexpressed with wild-type E12, whereas transcriptional activation by MyoD together with a CaM-resistant mutant of E12 was slightly inhibited by the Ca2+ stimulators (Figure 5). This argues for the possibility that an increase in Ca2+ might have a negative effect on transcriptional activation by MyoD in the absence of the CaM regulation through interaction with the E-protein. Importantly, ionomycin stimulation did not induce transcriptional activation by MyoD–E12 or MyoD–m847 tethers (Figure 6A), showing that the effect of E12 mutation was dependent on alternative dimerization of E12.
We did not detect any increase in the reporter activity by stimuli that increase the Ca2+ concentration when stimulations were carried out in growth-promoting medium (data not shown). A possible explanation for this could be high levels of expression of the inhibitory Id proteins in cells cultured in growth medium (Iyer et al., 1999
). Id proteins may inhibit activation of transcription by bHLH proteins under these conditions and override the effects gained from Ca2+ stimulation.
CaM was detected both in the cytoplasm and the nucleus of NIH-3T3 fibroblasts cultured in a medium containing 10% fetal bovine serum that promotes cell proliferation. The change to differentiation medium resulted in an increase in the proportion of CaM in the nucleus. The nuclear localization of CaM in nonproliferating fibroblasts supports its role as a regulator of transcription under conditions permissive for myogenic differentiation. Nuclear localization of CaM has been shown in other cellular systems to be induced by an increase in the intracellular Ca2+ concentration (Deisseroth et al., 1998
; Teruel et al., 2000
), and spontaneous Ca2+ spikes and oscillations in intracellular Ca2+ concentration have been shown to occur in differentiating C2C12 myoblast cells (Lorenzon et al., 1997
). These observations suggest a possible relationship between conditions permissive for differentiation of myoblasts or MyoD-transfected fibroblasts and nuclear Ca2+/CaM, which can in turn modify the activity of nuclear transcription factors involved in regulation of muscle development. Several articles have demonstrated a positive role for Ca2+ and CaM in regulation of the activity of muscle-specific transcription factors, and myogenesis. MEF2 has been shown to be in a repressed state in myoblasts through interaction with the transcriptional corepressors HDAC4 and HDAC5 (Miska et al., 1999
; Lu et al., 2000
), and this repression of MEF2 was shown to be relieved by the Ca2+/CaM-dependent kinase I, which disrupts the MEF2-HDAC interaction through phosphorylation of HDAC (Lu et al., 2000
; McKinsey et al., 2000
). HDAC5 has also been shown to be a direct target of Ca2+/CaM (Berger et al., 2003
). A positive role in regulation of myogenesis has also been suggested for the Ca2+/CaM-dependent phosphatase calcineurin through activation of NFAT (Delling et al., 2000
), MEF2 and MyoD (Friday et al., 2003
). The Ca2+/CaM inhibition of DNA binding of CaM-sensitive E-protein homodimers and thus selective occupancy of myogenic bHLH protein/E-protein heterodimers on promoters of myogenic target genes, as reported here, is therefore not the only role of Ca2+/CaM in myogenesis.
Myogenic differentiation of NIH-3T3 cells by MyoD was dependent on E2A, because it was inhibited by E2A depletion (Figure 7). This inhibition of myogenesis was rescued by wild-type E12, but not by calmodulin-resistant E12 mutants, demonstrating that calmodulin-sensitive E2A protein is critical for myogenesis in this system. However, also SEF2-1 (E2-2) is calmodulin sensitive (Corneliussen et al., 1994
) and could rescue the myogenesis (Figure 7). Furthermore, the calmodulin-binding basic sequence is identical in SEF2-1 and in HEB. This argues that all three E-proteins have the potential to participate in calmodulin sensitivity–dependent promotion of myogenesis, and that their relative role as heterodimer partners in myogenic differentiation of a precursor cell will depend on other factors such as their abundance and functional activity in the cell.
The Ca2+ signaling through nuclear CaM in regulation of myogenesis by differential inhibition of bHLH transcription factors reported here can function as a trigger of differentiation. This activation of transcription by tissue-specific class II bHLH factors, such as MyoD, through inhibition of their competitor E-protein homodimers may function at an early stage of myogenic differentiation, thus resulting in increased transcriptional activity of MyoD. In support of this, Ca2+ stimulation for 1 d did not produce significantly less transcriptional activation by E12/MyoD than Ca2+ stimulation for all 4 d of the differentiation (Figure 5B). In addition, E47 has been suggested to be inactivated through phosphorylation in differentiating C2C12 myoblasts. The p38 kinase that is activated in differentiating myoblasts has been shown to phosphorylate E47, leading to improved heterodimerization with MyoD (Lluis et al., 2005
). Furthermore, casein kinase II can phosphorylate E47 with similar effects (Johnson et al., 1996
; Sloan et al., 1996
). Signaling from the CDO cell surface receptor in developing muscle has been proposed to results in a modification of E-proteins, promoting heterodimerization with MyoD (Cole et al., 2004
). Because expression of CDO was shown to be induced by MyoD, it was proposed that this signaling is involved in maintenance of the myogenic program (Cole et al., 2004
). However, before MyoD/E-protein heterodimers can maintain MyoD activity through CDO, establishment of the initial ability of the heterodimers to activate transcription, including expression of CDO, is required. The importance of Ca2+/CaM inhibition of CaM-sensitive E-protein homodimers in myogenesis at a step before the positive-feedback loop in MyoD expression is supported by the loss of the feedback loop in cells expressing CaM-resistant E12 mutants (Figures 2F and 7A). In summary, the results reported here suggest that differential Ca2+/CaM inhibition of bHLH proteins is an initiation step in the decision to differentiate to myocytes, preceding the maintenance of the myogenic program through the previously mentioned phosphorylation of E-proteins.
We report here an activating effect of Ca2+/calmodulin regulation of E-proteins in myogenesis, in contrast to the inhibitory effect of this regulatory system that we recently reported in B lymphocytes (Hauser et al., 2008
). Ca2+/calmodulin regulation of E-proteins was found to inhibit transcription of activation-induced cytidine deaminase (AID), the key mutagenic antibody diversification enzyme that enables highly specific and potent antibody responses, after successful antibody gene mutagenesis in B lymphocytes (Hauser et al., 2008
). We have found transcriptional inhibition through Ca2+/calmodulin inhibition of E proteins also for other genes in this cell lineage (Hauser, Sveshnikova, Saarikettu, and Grundström, unpublished observations). The activation of transcription reported here in myogenesis, in contrast to this inhibitory effect, is consistent with Ca2+/CaM-resistant heterodimers between E-proteins and other types of bHLH proteins playing a key role in myogenesis, and not E-protein homodimers as in B-lymphocytes (Massari and Murre, 2000
).
The number of mammalian genes encoding bHLH transcription factors is very high. The mouse genome has been estimated to have 116 genes for potential bHLH transcription factors (Gray et al., 2004
). Because the ubiquitously expressed CaM-sensitive E-proteins are believed to be obligate heterodimer partners for many tissue-specific bHLH proteins in many differentiation processes apart from myogenesis (Massari and Murre, 2000
), Ca2+/CaM may play a more universal role in regulation of differentiation through differential inhibition of bHLH proteins. For example, this regulation may also be found in neurogenesis, where bHLH proteins have important roles (Lee, 1997
; Farah et al., 2000
; Ik Tsen Heng and Tan, 2003
) and spontaneous Ca2+ transients have been demonstrated to be required for differentiation (Gu and Spitzer, 1997
).
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Address correspondence to: Thomas Grundström (Thomas.Grundstrom{at}molbiol.umu.se).
| REFERENCES |
|---|
|
|
|---|
Berger, I., Bieniossek, C., Schaffitzel, C., Hassler, M., Santelli, E., and Richmond, T. J. (2003). Direct interaction of Ca2+/calmodulin inhibits histone deacetylase 5 repressor core binding to myocyte enhancer factor 2. J. Biol. Chem 278, 17625–17635.
Berkes, C. A., and Tapscott, S. J. (2005). MyoD and the transcriptional control of myogenesis. Semin. Cell. Dev. Biol 16, 585–595.[CrossRef][Medline]
Cole, F., Zhang, W., Geyra, A., Kang, J. S., and Krauss, R. S. (2004). Positive regulation of myogenic bHLH factors and skeletal muscle development by the cell surface receptor CDO. Dev. Cell 7, 843–854.[CrossRef][Medline]
Conway, K., Pin, C., Kiernan, J. A., and Merrifield, P. (2004). The E protein HEB is preferentially expressed in developing muscle. Differentiation 72, 327–340.[CrossRef][Medline]
Corneliussen, B., Holm, M., Waltersson, Y., Onions, J., Hallberg, B., Thornell, A., and Grundström, T. (1994). Calcium/calmodulin inhibition of basic-helix-loop-helix transcription factor domains. Nature 368, 760–764.[CrossRef][Medline]
Davis, R. L., and Weintraub, H. (1992). Acquisition of myogenic specificity by replacement of three amino acid residues from MyoD into E12. Science 256, 1027–1030.
Deisseroth, K., Heist, E. K., and Tsien, R. W. (1998). Translocation of calmodulin to the nucleus supports CREB phosphorylation in hippocampal neurons. Nature 392, 198–202.[CrossRef][Medline]
Delling, U., Tureckova, J., Lim, H. W., De Windt, L. J., Rotwein, P., and Molkentin, J. D. (2000). A calcineurin-NFATc3-dependent pathway regulates skeletal muscle differentiation and slow myosin heavy-chain expression. Mol. Cell. Biol 20, 6600–6611.
Farah, M. H., Olson, J. M., Sucic, H. B., Hume, R. I., Tapscott, S. J., and Turner, D. L. (2000). Generation of neurons by transient expression of neural bHLH proteins in mammalian cells. Development 127, 693–702.[Abstract]
Friday, B. B., Mitchell, P. O., Kegley, K. M., and Pavlath, G. K. (2003). Calcineurin initiates skeletal muscle differentiation by activating MEF2 and MyoD. Differentiation 71, 217–227.[CrossRef][Medline]
Gray, P. A. et al. (2004). Mouse brain organization revealed through direct genome-scale TF expression analysis. Science 306, 2255–2257.
Gu, X., and Spitzer, N. C. (1997). Breaking the code: regulation of neuronal differentiation by spontaneous calcium transients. Dev. Neurosci 19, 33–41.[Medline]
Hauser, J., Sveshnikova, N., Wallenius, A., Baradaran, S., Saarikettu, J., and Grundström, T. (2008). B-cell receptor activation inhibits AID expression through calmodulin inhibition of E-proteins. Proc. Natl. Acad. Sci. USA 105, 1267–1272.
Hughes, K., Edin, S., Antonsson, A., and Grundström, T. (2001). Calmodulin-dependent kinase II mediates T cell receptor/CD3- and phorbol ester-induced activation of IkappaB kinase. J. Biol. Chem 276, 36008–36013.
Hughes, K., Saarikettu, J., and Grundström, T. (2002). Gene expression in transfected cells. Methods Mol. Biol 173, 355–363.[Medline]
Ik Tsen Heng, J., and Tan, S. S. (2003). The role of class I HLH genes in neural development—have they been overlooked? Bioessays 25, 709–716.[CrossRef][Medline]
Iyer, V. R. et al. (1999). The transcriptional program in the response of human fibroblasts to serum. Science 283, 83–87.
Johnson, S. E., Wang, X., Hardy, S., Taparowsky, E. J., and Konieczny, S. F. (1996). Casein kinase II increases the transcriptional activities of MRF4 and MyoD independently of their direct phosphorylation. Mol. Cell. Biol 16, 1604–1613.[Abstract]
Lassar, A. B., Davis, R. L., Wright, W. E., Kadesch, T., Murre, C., Voronova, A., Baltimore, D., and Weintraub, H. (1991). Functional activity of myogenic HLH proteins requires hetero-oligomerization with E12/E47-like proteins in vivo. Cell 66, 305–315.[CrossRef][Medline]
Lee, J. E. (1997). Basic helix-loop-helix genes in neural development. Curr. Opin. Neurobiol 7, 13–20.[CrossRef][Medline]
Lluis, F., Ballestar, E., Suelves, M., Esteller, M., and Munoz-Canoves, P. (2005). E47 phosphorylation by p38 MAPK promotes MyoD/E47 association and muscle-specific gene transcription. EMBO J 24, 974–984.[CrossRef][Medline]
Lorenzon, P., Giovannelli, A., Ragozzino, D., Eusebi, F., and Ruzzier, F. (1997). Spontaneous and repetitive calcium transients in C2C12 mouse myotubes during in vitro myogenesis. Eur. J. Neurosci 9, 800–808.[CrossRef][Medline]
Lu, J., McKinsey, T. A., Nicol, R. L., and Olson, E. N. (2000). Signal-dependent activation of the MEF2 transcription factor by dissociation from histone deacetylases. Proc. Natl. Acad. Sci. USA 97, 4070–4075.
Massari, M. E., and Murre, C. (2000). Helix-loop-helix proteins: regulators of transcription in eucaryotic organisms. Mol. Cell. Biol 20, 429–440.
McKinsey, T. A., Zhang, C. L., Lu, J., and Olson, E. N. (2000). Signal-dependent nuclear export of a histone deacetylase regulates muscle differentiation. Nature 408, 106–111.[CrossRef][Medline]
McKinsey, T. A., Zhang, C. L., and Olson, E. N. (2002). MEF 2, a calcium-dependent regulator of cell division, differentiation and death. Trends Biochem. Sci 27, 40–47.[CrossRef][Medline]
Miska, E. A., Karlsson, C., Langley, E., Nielsen, S. J., Pines, J., and Kouzarides, T. (1999). HDAC4 deacetylase associates with and represses the MEF2 transcription factor. EMBO J 18, 5099–5107.[CrossRef][Medline]
Neuhold, L. A., and Wold, B. (1993). HLH forced dimers: tethering MyoD to E47 generates a dominant positive myogenic factor insulated from negative regulation by Id. Cell 74, 1033–1042.[CrossRef][Medline]
Nie, L., Xu, M., Vladimirova, A., and Sun, X. H. (2003). Notch-induced E2A ubiquitination and degradation are controlled by MAP kinase activities. EMBO J 22, 5780–5792.[CrossRef][Medline]
Onions, J., Hermann, S., and Grundström, T. (1997). Basic helix-loop-helix protein sequences determining differential inhibition by calmodulin and S-100 proteins. J. Biol. Chem 272, 23930–23937.
Parker, M. H., Perry, R. L., Fauteux, M. C., Berkes, C. A., and Rudnicki, M. A. (2006). MyoD synergizes with the E-protein HEB beta to induce myogenic differentiation. Mol. Cell. Biol 26, 5771–5783.
Porter, G. A., Jr, Makuck, R. F., and Rivkees, S. A. (2002). Reduction in intracellular calcium levels inhibits myoblast differentiation. J. Biol. Chem 277, 28942–28947.
Puri, P. L., and Sartorelli, V. (2000). Regulation of muscle regulatory factors by DNA-binding, interacting proteins, and post-transcriptional modifications. J. Cell. Physiol 185, 155–173.[CrossRef][Medline]
Rutherford, M. N., and LeBrun, D. P. (1998). Restricted expression of E2A protein in primary human tissues correlates with proliferation and differentiation. Am. J. Pathol 153, 165–173.
Ruzinova, M. B., and Benezra, R. (2003). Id proteins in development, cell cycle and cancer. Trends. Cell Biol 13, 410–418.[CrossRef][Medline]
Saarikettu, J., Sveshnikova, N., and Grundström, T. (2004). Calcium/calmodulin inhibition of transcriptional activity of E-proteins by prevention of their binding to DNA. J. Biol. Chem 279, 41004–41011.
Sabourin, L. A., and Rudnicki, M. A. (2000). The molecular regulation of myogenesis. Clin. Genet 57, 16–25.[CrossRef][Medline]
Sloan, S. R., Shen, C. P., McCarrick-Walmsley, R., and Kadesch, T. (1996). Phosphorylation of E47 as a potential determinant of B-cell-specific activity. Mol. Cell. Biol 16, 6900–6908.[Abstract]
Sun, L., Trausch-Azar, J. S., Ciechanover, A., and Schwartz, A. L. (2007). E2A protein degradation by the ubiquitin-proteasome system is stage-dependent during muscle differentiation. Oncogene 26, 441–448.[CrossRef][Medline]
Teruel, M. N., Chen, W., Persechini, A., and Meyer, T. (2000). Differential codes for free Ca(2+)-calmodulin signals in nucleus and cytosol. Curr. Biol 10, 86–94.[Medline]
Yun, K., and Wold, B. (1996). Skeletal muscle determination and differentiation: story of a core regulatory network and its context. Curr. Opin. Cell Biol 8, 877–889.[CrossRef][Medline]
Zhuang, Y., Cheng, P., and Weintraub, H. (1996). B-lymphocyte development is regulated by the combined dosage of three basic helix-loop-helix genes, E2A, E2-2, and HEB. Mol. Cell. Biol 16, 2898–2905.[Abstract]
Zhuang, Y., Soriano, P., and Weintraub, H. (1994). The helix-loop-helix gene E2A is required for B cell formation. Cell 79, 875–884.[CrossRef][Medline]
Zingg, J. M., Pedraza-Alva, G., and Jost, J. P. (1994). MyoD1 promoter autoregulation is mediated by two proximal E-boxes. Nucleic Acids Res 22, 2234–2241.
This article has been cited by other articles:
![]() |
J. A. Hanover, D. C. Love, and W. A. Prinz Calmodulin-driven Nuclear Entry: Trigger for Sex Determination and Terminal Differentiation J. Biol. Chem., May 8, 2009; 284(19): 12593 - 12597. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lai, M. Wan, J. Wu, P. Preston-Hurlburt, R. Kushwaha, T. Grundstrom, A. N. Imbalzano, and T. Chi Induction of TLR4-target genes entails calcium/calmodulin-dependent regulation of chromatin remodeling PNAS, January 27, 2009; 106(4): 1169 - 1174. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||