![]() |
|
|
Vol. 19, Issue 6, 2534-2543, June 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
k*
idalová-Hnilicová*
*
íková



*Institute of Molecular Genetics and
Institute of Experimental Medicine, Academy of Sciences of the Czech Republic, 142 20 Prague 4, Czech Republic;
Center for Craniofacial Molecular Biology, School of Dentistry, University of Southern California, Los Angeles, CA 90033; and
Max Planck Institute of Molecular Cell Biology and Genetics, 01307 Dresden, Germany
Submitted December 18, 2007;
Revised March 10, 2008;
Accepted March 13, 2008
Monitoring Editor: Wendy Bickmore
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Once back in the cell nucleus, snRNPs first accumulate in CBs before distributing throughout the nucleoplasm, where splicing occurs (Sleeman and Lamond, 1999
; Sleeman et al., 2001
; Neugebauer, 2002
). This suggests a role for CBs in nuclear steps of snRNP maturation, a prediction borne out by the following set of observations. First, posttranscriptional modifications of the snRNAs themselves occur in CBs after snRNP reimport from the cytoplasm (Darzacq et al., 2002
; Kiss, 2002
; Jady et al., 2003
). These modifications, including pseudouridinylation and 2'-O-methylation, are guided by small Cajal body-specific RNAs. Second, CBs are the site of complex assembly steps that involve RNA–RNA annealing and the sequential addition of proteins. For example, the U4/U6 snRNP is formed when the U4 and U6 snRNAs anneal, a step catalyzed by U6-specific LSm proteins and SART3 (also named hPrp24 or p110) (Ghetti et al., 1995
; Raghunathan and Guthrie, 1998
; Achsel et al., 1999
; Bell et al., 2002
). Subsequently, the U4/U6·U5 tri-snRNP assembles when U5 snRNP associates by protein–protein interactions with the U4/U6 snRNP (Makarova et al., 2002
; Schaffert et al., 2004
). Both U4/U6 and U4/U6·U5 tri-snRNP assembly occur in CBs (Schaffert et al., 2004
; Stanek and Neugebauer, 2004
). Recently, mathematical modeling of U4/U6 snRNP formation in the cell nucleus revealed that accumulation of U4 and U6 snRNPs in CBs should greatly increase the efficiency of U4/U6 assembly (Klingauf et al., 2006
). An additional role of CBs in U2 snRNP formation (Nesic et al., 2004
) further points to CBs as the key site of nuclear steps in snRNP assembly. The observation that depletion of coilin, a protein required for snRNP concentration in CBs, impairs cell proliferation (Lemm et al., 2006
) is consistent with the proposal that snRNP assembly is inefficient in the absence of CBs.
snRNPs must not only assemble de novo but also may regenerate after splicing to complete the so-called spliceosome cycle. During spliceosome assembly and activation, snRNPs undergo structural rearrangements, including U4/U6 snRNA unwinding and release of the U4 snRNP from the spliceosome (Staley and Guthrie, 1998
). After splicing, mRNA is released from the spliceosome by the DEAH-box helicase hPrp22/HRH1 and snRNPs remain associated with the excised intron lariat (Company et al., 1991
; Ohno and Shimura, 1996
). In Saccharomyces cerevisiae, a complex of three proteins (Prp43/Ntr1/Ntr2) was shown to be essential for release of individual snRNPs from the lariat (Arenas and Abelson, 1997
; Martin et al., 2002
; Tsai et al., 2005
; Boon et al., 2006
; Tanaka et al., 2007
; Tsai et al., 2007
). If these released snRNPs are to participate in subsequent rounds of splicing, they have to be reassembled into the active U4/U6·U5 tri-snRNP. Several studies provide genetic and biochemical evidence for snRNP reassembly (Raghunathan and Guthrie, 1998
; Bell et al., 2002
; Verdone et al., 2004
; Chen et al., 2006
). Although snRNPs are highly expressed, the long half-lives of snRNAs suggests that they likely recycle and function again (Yu et al., 1999
).
In the present study, we address the hypothesis that snRNPs cycle more than once through CBs. We show in living cells that CBs contain mostly mature snRNPs, which are capable of exchanging with nucleoplasm and visiting multiple CBs. Targeted knockdown of proteins involved in spliceosome recycling, hPrp22, and the human homologue of the recently identified yeast Ntr1, led to a dramatic accumulation of the U4/U6 snRNP in CBs. These data demonstrate that the CB is a vital way station in the spliceosomal cycle.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The following antibodies were used: rabbit anti-SART3/p110 antibodies (Stanek et al., 2003
); monoclonal antibody (mAb) anti-coilin (5P10) (Almeida et al., 1998
), kindly provided by M. Carmo-Fonseca (Institute of Molecular Medicine, Lisbon, Portugal); rabbit antibodies against LSm4 (Achsel et al., 1999
); hPrp31 (U4/U6–61K) (Makarova et al., 2002
); hPrp4 (U4/U6–60K) (Lauber et al., 1997
); and hSnu114 (U5–116K) (Fabrizio et al., 1997
), kindly provided by R. Lührmann (Max Planck Institute, Göttingen, Germany). Monoclonal antibodies against U2B" and U1-70K were purchased from Progen (Heidelberg, Germany). Rabbit anti-mouse Ntr1 was raised against a peptide, LQNEFNPNRQRHWQ (amino acids 32–45; Zymed Laboratories, South San Francisco, CA), and was provided by Michael Paine (University of Southern California, Los Angeles, CA).
Protein Tagging
SART3-cyan fluorescent protein (CFP), coilin-CFP, and hPrp31-CFP were described previously (Stanek and Neugebauer, 2004
). SMN-yellow fluorescent protein (YFP) was kindly provided by M. Dundr (Chicago Medical School, North Chicago, IL; Dundr et al., 2004
) and SmB-YFP and SmD1-GFP by A. Lamond (University of Dundee, United Kingdom; Sleeman and Lamond, 1999
). SmB was subcloned into ECFP-C1 (Clontech, Mountain View, CA), photoactivatable (PA)-GFP-C1 (Patterson and Lippincott-Schwartz, 2004
) and E5-red fluorescent protein (RFP)-C1 by using HindIII/KpnI sites. SmD1 was recloned into ECFP-C1, PA-GFP-C1, and E5-RFP-C1 by using BamHI/PstI sites. E5-RFP-C1 vector was created by replacing GFP sequence in GFP-C1 plasmid (Clontech) with E5-RFP sequence from pTimer-1 plasmid (Clontech) by using AgeI/BglII restriction sites. SART3-HcDiRed construct was created by cloning SART3 sequence into the HcDiRed-N1 vector, which originated from the H2B-HcDiRed-N1 plasmid obtained from J. Ellenberg (European Molecular Biology Laboratory, Heidelberg, Germany; Gerlich et al., 2003
).
Live Cell Imaging
Cells were plated on glass bottomed Petri dishes (MatTek, Ashland, MA), and after 20–24 h, they were transfected with appropriate DNA constructs by using FuGENE 6 (Roche Diagnostics, Mannheim, Germany). The cells were imaged 22–24 h after transfection by using either a Zeiss 510 microscope equipped with water immersion objective (63x 1.2 numerical aperture [NA]) or a Leica SP2 confocal microscope equipped with water immersion objective (63x 1.2 NA) and an environmental chamber controlling CO2 level and temperature. PA-GFP was activated by short pulses of 405-nm laser line, and images of activated PA-GFP (excitation with 488-nm laser line) and either CFP (excitation with 458-nm laser line) or HcDiRed (excitation with 594-nm laser line) were acquired at 15-s intervals in activation of one CB or every 2 min in activation of the whole nucleus. The raw images were analyzed using ImageJ software (http://rsb.info.nih.gov/ij/). For publication, fluorescent levels were linearly adjusted using Adobe Photoshop (Adobe Systems, Mountain View, CA).
For E5-RFP experiments, cells were transfected with SmB-E5-RFP or SmD1-E5-RFP, fixed at different times after transfection with 4% paraformaldehyde/piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES) and embedded in glycerol containing 4',6-diamidino-2-phenylindole and 2.5% 1,4-diazabicyclo[2.2.2]octane (DABCO; Sigma Chemie, Deisenhofen, Germany) as an anti-fade reagent. Alternatively, cells were treated for 2 h before fixation with 30 ng/ml leptomycin B (LC Laboratories Woburn, MA). Images were collected using the DeltaVision microscope system (Applied Precision, Issaquah, WA) coupled with Olympus IX70 microscope equipped with oil immersion objective (60x 1.4 NA) by using the same settings for each sample. Stacks of 25 z-sections with 200-nm z-step were collected per sample and subjected to mathematical deconvolution by using measured point spread function (SoftWorx; Applied Precision). Mean intensities in green and red channel were quantified using SoftWorx.
Fluorescence Resonance Energy Transfer (FRET) Measurement
Cells were transfected with fluorescent protein-tagged constructs using FuGENE 6, grown for 24–26 h, and fixed in 4% paraformaldehyde/PIPES (Sigma-Aldrich) for 10 min at room temperature. After rinsing with Mg-phosphate-buffered saline (PBS) (PBS supplemented with 10 mM Mg2+) and water, cells were embedded in glycerol containing DABCO. FRET was measured by acceptor photobleaching method as described previously (Stanek and Neugebauer, 2004
) by using the Leica SP2 confocal microscope. Intensities of CFP (excited by 405-nm laser set to 5–10% of maximum power) and YFP (excited by 514-nm laser line set to 2% of maximum power) were measured. Then, YFP was bleached in a region of interest by three to five intensive (30% maximum power) pulses of 514-nm laser line and CFP and YFP fluorescence measured again. Apparent FRET efficiency calculated according to the equation FRETefficiency[%] = (CFPafter – CFPbefore) x 100/CFPafter. Unbleached regions of the same cell were used as a negative control. Ten cells were measured per each FRET pair, and average and SE were calculated.
Small Interfering RNA (siRNA) Transfection
Preannealed siRNA duplexes were obtained either from Ambion (Austin, TX) or QIAGEN (Hilden, Germany). Three independent siRNA duplexes were used against hNtr1, and five duplexes were used to target hPrp22. The sequences of sense siRNAs were as follows: from Ambion: hNtr1-27-5'-CCUGUUAAGCAGGACGACUtt, hNtr1-28-5'-GCAGGACGACUUUCCUAAGtt, hNtr1-29-5'-GGAUUAGCAAGAAGCUCACtt; hPrp22-55-5'-GCUUUAAUGCCCAGCGCAGtt; hPrp22-56-5'-GGAAUAAAGUGAAGUCUAGtt; and hPrp22-57-5'-CCCAAAUAGACGGCGAAAUtt; from Qiagen: hPrp22-3-5'-GGGACAGGACAAAGAAGAAtt and hPrp22-4-5'-CAGAGAAGUGGGAGAUCAAtt.
The negative control 1 siRNA from Ambion was used as a negative control. Oligofectamine (Invitrogen) was used for siRNA transfection. Cells were incubated 48 h before further treatment. Within this incubation period we did not observe any extensive cell death with respect to the treatment with the negative control siRNA.
Reverse Transcription (RT)-PCR
Total RNA was isolated 48 h after siRNA transfection by using TRIzol reagent (Invitrogen). cDNA was synthesized using a gene-specific reverse primer and SuperScript III (Invitrogen). Taq polymerase was used to amplify cDNA (25 cycles). Controls without RT reaction were performed to verify that there was no residual DNA contamination. The following primers were used for RT-PCR and quantitative PCR: hPrp22-For, CAAGAGGTGGGCTACACCAT; hPrp22-Rev, 5'-TGATCGCGTACTGAGTGAGG; hNtr1-For, 5'-TGTCTTCACTCCTGGCTCCT; hNtr1-Rev, 5'-AAGCCACTTGGGGAAGAAGT; 18S-For, 5'-TTGTTGGTTTTCGGAACTGAG; 18S-Rev, 5'-GCAAATGCTTCGGCTCTGGTC; c-myc-mRNA-For, 5'-GCGACTCTGAGGAGGAACAAGAAG; c-myc-mRNA-Rev, 5'-ACTCTGACCTTTTGCCAGGAGC; c-myc-pre-mRNA-For, 5'-TGCTCCCTTTATTCCCCCAC; c-myc-pre-mRNA-Rev, 5'-GGTCATAGTTCCTGTTGGTGAAGC; LDHA mRNA-For, 5'-AGAACACCAAAGATTGTCTCTGGC; LDHA mRNA-Rev, 5'-TTTCCCCCATCAGGTAACGG; LDHA pre-mRNA-For, 5'-CCTTTCAACTCTCTTTTGGCAACC; LDHA pre-mRNA-Rev, 5'-AATCTTATTCTGGGGGGTCTGTTC; Tubulin mRNA-For, 5'-GCTGCTTTGTGGAGTGGATTCC; Tubulin mRNA-Rev, 5'-CCGTGTTGTTGCCAATGAAGG; Tubulin pre-mRNA-For, 5'-GACCTTCCTCCTGCTTTCAGTTC; and Tubulin pre-mRNA-Rev, 5'-TCTGCTTGTGTTCCCAGTTGC.
Quantitative PCR was done as described previously (Listerman et al., 2006
), and ratio of pre-mRNA to mRNA was calculated for each siRNA treatment according to RsiRNA = 2(Ctpre-mRNA – CtmRNA), normalized to NC siRNA treated cells (Rn = RsiRNA/RncsiRNA), and plotted.
Glycerol Gradient Ultracentrifugation
Nuclear extracts were prepared according to Dignam et al. (1983)
, diluted in gradient buffer (20 mM HEPES/KOH, pH 8.0, 150 mM NaCl, 1.5 mM MgCl2, and 0.5 mM dithiothreitol), and fractionated in a linear 10–30% glycerol gradient by centrifugation at 32,000 rpm for 17 h by using the SW-41 rotor (Beckman Coulter, Fullerton, CA). Individual fractions (700 µl) were collected, and RNA was extracted from each fraction with phenol:chloroform:isoamylalcohol, separated on 10% urea-polyacrylamide gel electrophoresis (PAGE), and silver stained. In parallel, proteins were precipitated from the phenol phase by acetone, dissolved in SDS-PAGE sample buffer, and analyzed by immunoblotting.
Indirect Immunofluorescence
Forty-eight hours after the siRNA transfection the cells were fixed in 4% paraformaldehyde/PIPES for 10 min, permeabilized for 5 min with 0.2% Triton X-100 (Sigma Chemie), and incubated with appropriate primary antibodies. Secondary anti-rabbit antibodies conjugated with fluorescein isothiocyanate (FITC) and anti-mouse antibodies conjugated with tetramethylrhodamine B isothiocyanate (TRITC) (Jackson ImmunoResearch Laboratories, West Grove, PA) were used. Images were collected using a DeltaVision microscope system and subjected to mathematical deconvolution as described above. Mean fluorescence intensities in CBs and the nucleoplasm were determined in individual optical sections by using ImageJ as described previously (Stanek and Neugebauer, 2004
).
In Situ Hybridization
Digoxigenin-labeled DNA probes directed against human U2, U4, and U5 snRNAs were obtained by PCR as described previously (Bell et al., 2002
) by using pSP65U2H, pSPU4b, pSP64U5 (Black and Pinto, 1989
) as templates. Forty-eight hours after siRNA transfection cells were fixed in 4% paraformaldehyde/PIPES for 10 min, permeabilized with 0.5% Triton X-100 for 5 min, and incubated with anti-SART3 antibodies as a marker of CBs followed by incubation with secondary antibody conjugated with FITC (Jackson ImmunoResearch Laboratories). Cells were again fixed in 4% paraformaldehyde/PIPES for 5 min, quenched for 5 min in 0.1 M glycine/0.2 M Tris, pH 7.4, and incubated with digoxigenin-labeled probe in 2x SSC/50% formamide/10% dextran sulfate/1% BSA for 60 min at 37°C. After washing in 2x SSC/50% formamide, 2x SSC and 1x SSC, the probe was detected by mouse anti-digoxigenin antibody (Roche Diagnostics) followed by incubation with goat anti-mouse antibody coupled with TRITC (Jackson ImmunoResearch Laboratories). Images were collected using a DeltaVision microscope system, and fluorescence intensities in CBs and the nucleoplasm were determined as describe above.
| RESULTS |
|---|
|
|
|---|
2 times in the nucleoplasm and 3 times in CBs. If CBs selectively recruited only newly imported snRNPs, we would have expected the red-to-green ratio to remain the same or even decrease in CBs, despite the fact that more of the red variant accumulates in the nucleus.
|
A complementary experiment was suggested by the fact that, although they are highly concentrated in CBs, snRNPs exchange rapidly with the surrounding nucleoplasm and only reside in CBs for few seconds on average (Dundr et al., 2004
; Sleeman, 2007
). We tagged Sm proteins with PA-GFP to determine whether the snRNPs that exit CBs at any given moment are replaced by new or old snRNPs. SmB- or SmD1-PA-GFP was expressed and the entire nucleus was photoactivated (Figure 2). If CBs contain exclusively new (nonactivated) snRNPs imported from the cytoplasm, fluorescence would be lost from these CBs over time. On the contrary, SmB-GFP fluorescence CBs remained high 20 min after photoactivation (Figure 2), 100 times longer than the residence time of snRNPs in CBs. Measurement of fluorescence intensities in CBs and nucleoplasm revealed a 0–25% decrease (average 6%) in fluorescence intensity in CBs relative to nucleoplasm. These data show that the exchanging population of snRNPs in CBs consists largely of "older" nuclear snRNPs.
|
|
|
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Experiments establishing the relative maturity of snRNPs in CBs relied on three different fluorescence microscopy techniques. The E5-RFP fluorescent protein tag, which changes emission spectra from green to red as it matures, and PA-GFP were both used to tag Sm proteins (B and D1; see Figures 1 and 2) and to monitor snRNP movements. Both approaches proved that the snRNP pool in CBs largely consists of mature snRNPs that have visited CBs already multiple times. In agreement with these data, snRNP movements between CBs were observed, in which snRNPs photoactivated in one CB reappeared within a time course of minutes in another distant CB. A similar movement of snRNPs between CBs was described recently (Sleeman, 2007
).
In the third approach, we sought to compare snRNPs in CBs and in the cytoplasm by measuring FRET signals between Sm proteins and SMN, which plays a role in the cytoplasmic phase of snRNP biogenesis. SMN is coimported with new snRNPs to the nucleus, and it is highly concentrated in CBs; because SMN binds coilin, it has been proposed that SMN delivers the newly imported snRNPs to CBs (Stanek and Neugebauer, 2006
). However, although we detected SMN-snRNP interactions in the cytoplasm, we did not observe any significant interaction in CBs. This indicates that either 1) the SMN–snRNP complex falls apart immediately after the import of snRNPs, 2) that a conformational change occurs within the CB that is unfavorable for FRET, or 3) newly imported snRNP–SMN complexes form only a small fraction of snRNPs and SMN in CBs, and these are below the detection limit of the FRET assay. At present, we cannot distinguish among these possibilities; if snRNP–SMN complexes are present in CBs, they must differ at least conformationally from the complexes found in the cytoplasm. Perhaps SMN protein accumulates in the CB as a result of binding coilin after snRNP import and dissociation in the CB. Presumably, SMN eventually returns to the cytoplasm for further rounds of Sm ring assembly.
The conclusion that CBs contain not only new snRNPs imported from the cytoplasm but also mature snRNPs agrees with findings that the concentration of snRNPs in CBs is transcription dependent (Carmo-Fonseca et al., 1992
; Blencowe et al., 1993
; Stanek et al., 2003
); in the absence of new intron-containing transcripts (i.e., under conditions of transcriptional blockade), the splicing process provides fewer "used" snRNPs for recycling. This highlights a paradox emerging in the field, because it has been proposed that snRNP biogenesis and import from the cytoplasm is required for snRNP accumulation in CBs and for integrity of CBs themselves (Carvalho et al., 1999
; Shpargel and Matera, 2005
; Girard et al., 2006
; Lemm et al., 2006
). If only a small proportion of snRNPs in CBs are newly imported, how can this fraction be required for CB integrity? The simplest explanation is that experimental reduction of snRNP biogenesis at various stages has long-term effects on the overall concentration of snRNPs in the nucleus, not just an acute effect on import. A reasonable proposal stemming from our present study and consistent with prior work of others is that CB integrity depends on the cellular level of splicing activity and the absolute concentration of nuclear snRNPs (Carmo-Fonseca et al., 1992
; Blencowe et al., 1993
; Sleeman et al., 2001
; Stanek et al., 2003
).
Our data show that mature snRNPs repeatedly visit CBs. To test whether this cycling through CBs correlates with snRNP regeneration after splicing, proteins involved in spliceosome disassembly were depleted, and localization of distinct snRNPs in CBs was examined. Surprisingly, depletion of two tested proteins involved in spliceosome disassembly resulted in accumulation of U4/U6 snRNPs in CBs. Because transcription/splicing inhibition by
-amanitin leads to opposite effects—the snRNPs and SART3 leave CBs (Carmo-Fonseca et al., 1992
; Blencowe et al., 1993
; Sleeman et al., 2001
; Stanek et al., 2003
)—it seems unlikely that U4/U6 snRNP accumulates in CBs as a result of splicing inhibition. In addition, splicing of c-fos and c-myc pre-mRNAs was only slightly reduced after siRNA treatment (Supplemental Figure 3). Instead, the phenotype more closely resembles the situation after inhibition of U4/U6·U5 snRNP formation, when accumulation of U4/U6 snRNPs in CBs was also observed (Schaffert et al., 2004
). Why does inhibition of spliceosome disassembly and inhibition of tri-snRNP assembly have the same phenotype? According to current models of spliceosome recycling, inhibition of this process should trap U5 and U6 snRNPs in the late spliceosome (Will and Luhrmann, 2006
) and thus decrease levels of free U5 and U6 snRNPs in the nucleoplasm. In contrast, the U4 snRNP leaves the spliceosome at an earlier step, just as the tri-snRNP joins the assembling spliceosome (Makarov et al., 2002
; Chan et al., 2003
). Thus, the level of free U4 mono-snRNP in the nucleoplasm should be unaffected by Prp22 or Ntr1 depletion. Early studies showed that there is two- to threefold excess of the U6 snRNP over the U5 and U4 snRNPs (Tycowski et al., 2006
), making it unlikely that U6 snRNP levels are limiting. In contrast to U4 and U6; however, levels of free U5 snRNP are likely decreased and formation of the U4/U6·U5 tri-snRNP inhibited, as was shown after Ntr1 depletion in yeast (Boon et al., 2006
). Consistent with this, we observed a decrease in U5 snRNP levels both in CBs and nuclear extracts after knockdown. Thus, inhibition of spliceosome disassembly leads to a similar situation as inhibition of tri-snRNP assembly—accumulation of the U4/U6 snRNPs in CBs. Apparently, the supply of new U5 snRNPs from the cytoplasm is not sufficient to keep up with tri-snRNP assembly, underscoring the importance of the recycled U5 snRNP for assembly and regeneration of tri-snRNPs.
Together, these observations suggest that snRNP reassembly after splicing may obey similar rules to de novo snRNP assembly, even though the assembly of new snRNPs includes additional steps that need not be repeated (e.g., posttranscriptional RNA modification). This implies that snRNP assembly in CBs at any stage of their life cycle must be independent of snRNA posttranscriptional modifications or any other steps in snRNP biogenesis. Finally, it has been shown by mathematical modeling that CBs increase the rate of U4/U6 snRNP assembly, by providing a local environment with elevated snRNP concentrations (Klingauf et al., 2006
). Thus, the localization of snRNPs to CBs likely promotes the assembly of new as well as regenerating snRNPs by the same mechanism, because snRNPs from either source will meet elevated concentrations of their potential partners in the CB.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Address correspondence to: David Stan
k (stanek{at}img.cas.cz).
Abbreviations used: CB, Cajal body; snRNA, small nuclear RNA; snRNP, small nuclear ribonucleoprotein particle.
| REFERENCES |
|---|
|
|
|---|
Almeida, F., Saffrich, R., Ansorge, W., and Carmo-Fonseca, M. (1998). Microinjection of anti-coilin antibodies affects the structure of coiled bodies. J. Cell Biol 142, 899–912.
Arenas, J. E., and Abelson, J. N. (1997). Prp 43: an RNA helicase-like factor involved in spliceosome disassembly. Proc. Natl. Acad. Sci. USA 94, 11798–11802.
Bell, M., Schreiner, S., Damianov, A., Reddy, R., and Bindereif, A. (2002). p110, a novel human U6 snRNP protein and U4/U6 snRNP recycling factor. EMBO J 21, 2724–2735.[CrossRef][Medline]
Black, D. L., and Pinto, A. L. (1989). U5 small nuclear ribonucleoprotein: RNA structure analysis and ATP-dependent interaction with U4/U6. Mol. Cell. Biol 9, 3350–3359.
Blencowe, B. J., Carmo-Fonseca, M., Behrens, S. E., Luhrmann, R., and Lamond, A. I. (1993). Interaction of the human autoantigen p150 with splicing snRNPs. J. Cell Sci 105, 685–697.[Abstract]
Boon, K. L., Auchynnikava, T., Edwalds-Gilbert, G., Barrass, J. D., Droop, A. P., Dez, C., and Beggs, J. D. (2006). Yeast ntr1/spp382 mediates prp43 function in postspliceosomes. Mol. Cell. Biol 26, 6016–6023.
Carmo-Fonseca, M., Pepperkok, R., Carvalho, M. T., and Lamond, A. I. (1992). Transcription-dependent colocalization of the U1, U2, U4/U6, and U5 snRNPs in coiled bodies. J. Cell Biol 117, 1–14.
Carvalho, T., Almeida, F., Calapez, A., Lafarga, M., Berciano, M. T., and Carmo-Fonseca, M. (1999). The spinal muscular atrophy disease gene product, SMN: a link between snRNP biogenesis and the Cajal (coiled) body. J. Cell Biol 147, 715–728.
Chan, S. P., Kao, D. I., Tsai, W. Y., and Cheng, S. C. (2003). The Prp19p-associated complex in spliceosome activation. Science 302, 279–282.
Chen, C. H., Kao, D. I., Chan, S. P., Kao, T. C., Lin, J. Y., and Cheng, S. C. (2006). Functional links between the Prp19-associated complex, U4/U6 biogenesis, and spliceosome recycling. RNA 12, 765–774.
Company, M., Arenas, J., and Abelson, J. (1991). Requirement of the RNA helicase-like protein PRP22 for release of messenger RNA from spliceosomes. Nature 349, 487–493.[CrossRef][Medline]
Darzacq, X., Jady, B. E., Verheggen, C., Kiss, A. M., Bertrand, E., and Kiss, T. (2002). Cajal body-specific small nuclear RNAs: a novel class of 2'-O-methylation and pseudouridylation guide RNAs. EMBO J 21, 2746–2756.[CrossRef][Medline]
Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983). Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11, 1475–1489.
Dundr, M., Hebert, M. D., Karpova, T. S., Stanek, D., Xu, H., Shpargel, K. B., Meier, U. T., Neugebauer, K. M., Matera, A. G., and Misteli, T. (2004). In vivo kinetics of Cajal body components. J. Cell Biol 164, 831–842.
Fabrizio, P., Laggerbauer, B., Lauber, J., Lane, W. S., and Luhrmann, R. (1997). An evolutionarily conserved U5 snRNP-specific protein is a GTP-binding factor closely related to the ribosomal translocase EF-2. EMBO J 16, 4092–4106.[CrossRef][Medline]
Gerlich, D., Beaudouin, J., Kalbfuss, B., Daigle, N., Eils, R., and Ellenberg, J. (2003). Global chromosome positions are transmitted through mitosis in mammalian cells. Cell 112, 751–764.[CrossRef][Medline]
Ghetti, A., Company, M., and Abelson, J. (1995). Specificity of Prp24 binding to RNA: a role for Prp24 in the dynamic interaction of U4 and U6 snRNAs. RNA 1, 132–145.[Abstract]
Girard, C., Neel, H., Bertrand, E., and Bordonne, R. (2006). Depletion of SMN by RNA interference in HeLa cells induces defects in Cajal body formation. Nucleic Acids Res 34, 2925–2932.
Jady, B. E., Darzacq, X., Tucker, K. E., Matera, A. G., Bertrand, E., and Kiss, T. (2003). Modification of Sm small nuclear RNAs occurs in the nucleoplasmic Cajal body following import from the cytoplasm. EMBO J 22, 1878–1888.[CrossRef][Medline]
Jurica, M. S., and Moore, M. J. (2003). Pre-mRNA splicing: awash in a sea of proteins. Mol Cell 12, 5–14.[CrossRef][Medline]
Kambach, C., Walke, S., Young, R., Avis, J. M., de la Fortelle, E., Raker, V. A., Luhrmann, R., Li, J., and Nagai, K. (1999). Crystal structures of two Sm protein complexes and their implications for the assembly of the spliceosomal snRNPs. Cell 96, 375–387.[CrossRef][Medline]
Kiss, T. (2002). Small nucleolar RNAs: an abundant group of noncoding RNAs with diverse cellular functions. Cell 109, 145–148.[CrossRef][Medline]
Kiss, T. (2004). Biogenesis of small nuclear RNPs. J. Cell Sci 117, 5949–5951.
Klingauf, M., Stanek, D., and Neugebauer, K. M. (2006). Enhancement of U4/U6 small nuclear ribonucleoprotein particle association in Cajal bodies predicted by mathematical modeling. Mol. Biol. Cell 17, 4972–4981.
Lauber, J., Plessel, G., Prehn, S., Will, C. L., Fabrizio, P., Groning, K., Lane, W. S., and Luhrmann, R. (1997). The human U4/U6 snRNP contains 60 and 90kD proteins that are structurally homologous to the yeast splicing factors Prp4p and Prp3p. RNA 3, 926–941.[Abstract]
Lemm, I., Girard, C., Kuhn, A. N., Watkins, N. J., Schneider, M., Bordonne, R., and Luhrmann, R. (2006). Ongoing U snRNP Biogenesis Is Required for the Integrity of Cajal Bodies. Mol. Biol. Cell 17, 3221–3231.
Listerman, I., Bledau, A. S., Grishina, I., and Neugebauer, K. M. (2007). Extragenic accumulation of RNA polymerase II enhances transcription by RNA polymerase III. PLoS Genet 3, e212.[CrossRef][Medline]
Listerman, I., Sapra, A. K., and Neugebauer, K. M. (2006). Cotranscriptional coupling of splicing factor recruitment and precursor messenger RNA splicing in mammalian cells. Nat. Struct. Mol. Biol 13, 815–822.[CrossRef][Medline]
Liu, J. L., and Gall, J. G. (2007). U bodies are cytoplasmic structures that contain uridine-rich small nuclear ribonucleoproteins and associate with P bodies. Proc. Natl. Acad. Sci. USA 104, 11655–11659.
Makarov, E. M., Makarova, O. V., Urlaub, H., Gentzel, M., Will, C. L., Wilm, M., and Luhrmann, R. (2002). Small nuclear ribonucleoprotein remodeling during catalytic activation of the spliceosome. Science 298, 2205–2208.
Makarova, O. V., Makarov, E. M., Liu, S., Vornlocher, H. P., and Luhrmann, R. (2002). Protein 61K, encoded by a gene (PRPF31) linked to autosomal dominant retinitis pigmentosa, is required for U4/U6center dotU5 tri-snRNP formation and pre-mRNA splicing. EMBO J 21, 1148–1157.[CrossRef][Medline]
Martin, A., Schneider, S., and Schwer, B. (2002). Prp43 is an essential RNA-dependent ATPase required for release of lariat-intron from the spliceosome. J. Biol. Chem 277, 17743–17750.
Matera, A. G., and Shpargel, K. B. (2006). Pumping RNA: nuclear bodybuilding along the RNP pipeline. Curr. Opin. Cell Biol 18, 317–324.[CrossRef][Medline]
Mayes, A. E., Verdone, L., Legrain, P., and Beggs, J. D. (1999). Characterization of Sm-like proteins in yeast and their association with U6 snRNA. EMBO J 18, 4321–4331.[CrossRef][Medline]
Meister, G., Eggert, C., and Fischer, U. (2002). SMN-mediated assembly of RNPs: a complex story. Trends Cell Biol 12, 472–478.[CrossRef][Medline]
Narayanan, U., Achsel, T., Luhrmann, R., and Matera, A. G. (2004). Coupled in vitro import of U snRNPs and SMN, the spinal muscular atrophy protein. Mol. Cell 16, 223–234.[CrossRef][Medline]
Narayanan, U., Ospina, J. K., Frey, M. R., Hebert, M. D., and Matera, A. G. (2002). SMN, the spinal muscular atrophy protein, forms a pre-import snRNP complex with snurportin1 and importin beta. Hum. Mol. Genet 11, 1785–1795.
Nesic, D., Tanackovic, G., and Kramer, A. (2004). A role for Cajal bodies in the final steps of U2 snRNP biogenesis. J. Cell Sci 117, 4423–4433.
Neugebauer, K. M. (2002). On the importance of being co-transcriptional. J. Cell Sci 115, 3865–3871.
Ohno, M., and Shimura, Y. (1996). A human RNA helicase-like protein, HRH1, facilitates nuclear export of spliced mRNA by releasing the RNA from the spliceosome. Genes Dev 10, 997–1007.
Patterson, G. H., and Lippincott-Schwartz, J. (2004). Selective photolabeling of proteins using photoactivatable GFP. Methods 32, 445–450.[CrossRef][Medline]
Paushkin, S., Gubitz, A. K., Massenet, S., and Dreyfuss, G. (2002). The SMN complex, an assemblyosome of ribonucleoproteins. Curr. Opin. Cell Biol 14, 305–312.[CrossRef][Medline]
Raghunathan, P. L., and Guthrie, C. (1998). A spliceosomal recycling factor that reanneals U4 and U6 small nuclear ribonucleoprotein particles. Science 279, 857–860.
Raker, V. A., Plessel, G., and Luhrmann, R. (1996). The snRNP core assembly pathway: identification of stable core protein heteromeric complexes and an snRNP subcore particle in vitro. EMBO J 15, 2256–2269.[Medline]
Schaffert, N., Hossbach, M., Heintzmann, R., Achsel, T., and Luhrmann, R. (2004). RNAi knockdown of hPrp31 leads to an accumulation of U4/U6 di-snRNPs in Cajal bodies. EMBO J 23, 3000–3009.[CrossRef][Medline]
Shpargel, K. B., and Matera, A. G. (2005). Gemin proteins are required for efficient assembly of Sm-class ribonucleoproteins. Proc. Natl. Acad. Sci. USA 102, 17372–17377.
Shpargel, K. B., Ospina, J. K., Tucker, K. E., Matera, A. G., and Hebert, M. D. (2003). Control of Cajal body number is mediated by the coilin C-terminus. J. Cell Sci 116, 303–312.
Sleeman, J. (2007). A regulatory role for CRM1 in the multi-directional trafficking of splicing snRNPs in the mammalian nucleus. J. Cell Sci 120, 1540–1550.
Sleeman, J. E., Ajuh, P., and Lamond, A. I. (2001). snRNP protein expression enhances the formation of Cajal bodies containing p80-coilin and SMN. J. Cell Sci 114, 4407–4419.[Medline]
Sleeman, J. E., and Lamond, A. I. (1999). Newly assembled snRNPs associate with coiled bodies before speckles, suggesting a nuclear snRNP maturation pathway. Curr. Biol 9, 1065–1074.[CrossRef][Medline]
Staley, J. P., and Guthrie, C. (1998). Mechanical devices of the spliceosome: motors, clocks, springs, and things. Cell 92, 315–326.[CrossRef][Medline]
Stanek, D., and Neugebauer, K. M. (2004). Detection of snRNP assembly intermediates in Cajal bodies by fluorescence resonance energy transfer. J. Cell Biol 166, 1015–1025.
Stanek, D., and Neugebauer, K. M. (2006). The Cajal body: a meeting place for spliceosomal snRNPs in the nuclear maze. Chromosoma 115, 343–354.[CrossRef][Medline]
Stanek, D., Rader, S. D., Klingauf, M., and Neugebauer, K. M. (2003). Targeting of U4/U6 small nuclear RNP assembly factor SART3/p110 to Cajal bodies. J. Cell Biol 160, 505–516.
Tanaka, N., Aronova, A., and Schwer, B. (2007). Ntr1 activates the Prp43 helicase to trigger release of lariat-intron from the spliceosome. Genes Dev 21, 2312–2325.
Terns, M. P., and Terns, R. M. (2001). Macromolecular complexes: SMN–the master assembler. Curr. Biol 11, R862–R864.[CrossRef][Medline]
Terskikh, A. et al. (2000). "Fluorescent timer": protein that changes color with time. Science 290, 1585–1588.
Tsai, R. T., Fu, R. H., Yeh, F. L., Tseng, C. K., Lin, Y. C., Huang, Y. H., and Cheng, S. C. (2005). Spliceosome disassembly catalyzed by Prp43 and its associated components Ntr1 and Ntr2. Genes Dev 19, 2991–3003.
Tsai, R. T., Tseng, C. K., Lee, P. J., Chen, H. C., Fu, R. H., Chang, K. J., Yeh, F. L., and Cheng, S. C. (2007). Dynamic interactions of Ntr1-Ntr2 with Prp43 and with U5 govern the recruitment of Prp43 to mediate spliceosome disassembly. Mol. Cell. Biol 27, 8027–8037.
Tycowski, K. T., Kolev, N. G., Conrad, N. K., Fok, V., and Steitz, J. A. (2006). The ever-growing world of small nuclear ribonucleoproteins. In: The RNA world, R. F. Gesteland, T. R. Cech, and J. F. Atkins, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 327–368.
Verdone, L., Galardi, S., Page, D., and Beggs, J. D. (2004). Lsm proteins promote regeneration of pre-mRNA splicing activity. Curr. Biol 14, 1487–1491.[CrossRef][Medline]
Wang, C., and Meier, U. T. (2004). Architecture and assembly of mammalian H/ACA small nucleolar and telomerase ribonucleoproteins. EMBO J 23, 1857–1867.[CrossRef][Medline]
Wen, X., Lei, Y. P., Zhou, Y. L., Okamoto, C. T., Snead, M. L., and Paine, M. L. (2005). Structural organization and cellular localization of tuftelin-interacting protein 11 (TFIP11). Cell Mol. Life Sci 62, 1038–1046.[CrossRef][Medline]
Will, C. L., and Luhrmann, R. (2001). Spliceosomal UsnRNP biogenesis, structure and function. Curr. Opin. Cell Biol 13, 290–301.[CrossRef][Medline]
Will, C. L., and Luhrmann, R. (2006). Spliceosome structure and function. In: The RNA world, R. F. Gesteland, T. R. Cech, and J. F. Atkins, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 369–400.
Yu, Y. T., Sharl, E. C., Smith, C. M., and Steitz, J. A. (1999). The growing world of small nuclear ribonucleoproteins. In: The RNA world, C. Gesteland and Atkins, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 487–524.
Zhang, Y., Muyrers, J. P., Testa, G., and Stewart, A. F. (2000). DNA cloning by homologous recombination in Escherichia coli. Nat. Biotechnol 18, 1314–1317.[CrossRef][Medline]
Related articles in Mol. Biol. Cell:
This article has been cited by other articles:
![]() |
Z. Nizami, S. Deryusheva, and J. G. Gall The Cajal Body and Histone Locus Body Cold Spring Harb Perspect Biol, July 1, 2010; 2(7): a000653 - a000653. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Huranova, J. Hnilicova, B. Fleischer, Z. Cvackova, and D. Stanek A mutation linked to retinitis pigmentosa in HPRP31 causes protein instability and impairs its interactions with spliceosomal snRNPs Hum. Mol. Genet., June 1, 2009; 18(11): 2014 - 2023. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Hearst, A. S. Gilder, S. S. Negi, M. D. Davis, E. M. George, A. A. Whittom, C. G. Toyota, A. Husedzinovic, O. J. Gruss, and M. D. Hebert Cajal-body formation correlates with differential coilin phosphorylation in primary and transformed cell lines J. Cell Sci., June 1, 2009; 122(11): 1872 - 1881. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. Kaiser, R. V. Intine, and M. Dundr De Novo Formation of a Subnuclear Body Science, December 12, 2008; 322(5908): 1713 - 1717. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||