|
|
|
|
Vol. 19, Issue 6, 2597-2608, June 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||


*Department of Molecular Biology, Graduate School of Medical Science, Kyushu University, Fukuoka 812-8582, Japan;
Section of Functional Morphology, Faculty of Pharmaceutical Science, Nagasaki International University, 859-3298 Nagasaki, Japan; and
Pathology Division, National Cancer Center Research Institute, 104-0045 Tokyo, Japan
Submitted December 5, 2007;
Revised March 26, 2008;
Accepted April 3, 2008
Monitoring Editor: Janet Shaw
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Mitochondria play a central role in the initial processes of apoptosis. The release of proapoptotic proteins from the mitochondria results in the processing and activation of downstream caspases, leading to the biochemical and morphological features of apoptosis (Green and Reed, 1998
; Wang, 2001
; Danial and Korsmeyer, 2004
; Jiang and Wang, 2004
). Among proapoptotic proteins, the efflux of cytochrome c is thought to be a key event in the subsequent apoptotic processes. A subclass of the Bcl-2 family proteins that includes Bax and Bak regulates the efflux by redistributing to the mitochondria, followed by outer membrane permeabilization (Sharpe et al., 2004
; Bouchier-Hayes et al., 2005
; Er et al., 2006
). The release of cytochrome c appears to involve two distinct pathways (Ott et al., 2002
; Scorrano et al., 2002
). One mediates the release depending on the outer membrane permeabilization by Bax, and the other additionally requires mobilization of cytochrome c in the cristae, which is induced by tBid. OPA1, a dynamin-related mitochondrial protein, controls mitochondrial membrane fusion through its proteolytic processing (Olichon et al., 2003
; Cipolat et al., 2004
; Ishihara et al., 2006
). In addition, OPA1 is involved in remodeling the cristae structure, leading to the efflux of cytochrome c during apoptosis (Frezza et al., 2006
).
In the present study, we characterized a new mitochondrial protein, MICS1, which localizes in the inner membrane. MICS1 is proposed to belong to the Bax inhibitor-1 (Bi-1) super family, which is comprised of at least four members, including the anti-apoptotic proteins Bi-1 and LFG (life guard; Somia et al., 1999
; Chae et al., 2003
, 2004
). MICS1 down-regulation induced a failure to maintain the normal mitochondrial network and disorganization of the cristae. Furthermore, the proapoptotic proteins were rapidly released from the mitochondria of MICS1 knockdown cells during apoptosis. In contrast, an increase in the MICS1 gene dosage stabilized cytochrome c in the inner membrane independently from Bax targeting and permeabilization of the outer membrane during apoptosis. In addition, the retention of cytochrome c on the inner membrane correlated with MICS1 up-regulation in the low-serum conditions. Our findings suggest that MICS1 plays distinct roles in mitochondrial morphology and cytochrome c release.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Construction of Plasmids
The 1.0-kb PCR product containing the entire open reading frame for MICS1 was obtained by amplification with the primers (5'ctggtgcaccgtcgacatgttggct3' and 5'gaagctgagtcctcgagtttctttctg3') using the human EST clone [IMAGE clone 25077 (accession number AF131820); Invitrogen, Carlsbad, CA) as a template and was cloned into pEF1-3HA, in which the inserted gene is expressed as a fusion protein tagged with three tandem HA by the EF1 promoter, to construct pEF1-MICS1-3HA. The same DNA fragment was also cloned into pNucScrIII, a vector containing humanized renilla green fluorescent protein (hrGFP) (Stratagene, La Jolla, CA) with three tandem SV40 nuclear localization signals the downstream of IRES (Internal Ribosomal Entry Site) sequence to simultaneously express both hrGFP and the inserted gene, to construct pNucScrIII-MICS1. The 1.2-kb DNA fragment including the coding region for MICS1-3HA from pEF1-MICS1-3HA was inserted into pcDNA3.1(–; Invitrogen) to construct pcDNA3.1-MICS1-3HA for in vitro translation. The DNA fragment coding for the carboxy-terminal region (amino acids 53-345) of MICS1 was cloned into pET28c (Novagen, Madison, WI) to construct pET28-MICS1 for preparation of recombinant protein as antigens. The human cytochrome c cDNA was amplified by reverse-transcriptase PCR using the primers (5'aggatccaatatgggtgatgttgagaaaggca3' and 5'cctcgagctcattagtagcttttttgagata3') and cloned into p3FLAG-CMV14 (Sigma-Aldrich, St. Louis, MO), and then the 0.5-kb PCR fragment of the coding region for cytochrome c-3FLAG generated from the resulting plasmid was inserted into pTREpur3 (Clontech, Palo Alto, CA) to construct pTRE-puro-hcytc-3FLAG.
Preparation of Antibody
The MICS1 recombinant protein was expressed in the Escherichia coli BL21 (DE3) cells carrying pET28-MICS1, purified by SDS gel electrophoresis, eluted from the gels, and used for raising antibodies in rabbits. The anti-MICS1 serum was subjected to precipitation with ammonium sulfate, followed by dialysis to phosphate-buffered saline (PBS). The resultant fraction was then affinity-purified by incubation with nitrocellulose membrane strips to which the same recombinant protein was bound, followed by elution with 0.1 M glycine (pH 2.0). After dialysis, the eluate was used for immunoblotting.
Small Interference RNA Transfection
A small interference RNA (siRNA) duplex for MICS1 (sense, uagcaaccaagcaagaugcuuuggg; antisense, cccaaagcaucuugcuugguugcua; Invitrogen) or for OPA1 (Ishihara et al., 2006
) was transfected into HeLa cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. After incubation for 48–72 h, cells were harvested and used for cell fractionation and immunoblotting. For morphological analyses, cells were transfected twice in a 48-h interval.
Subcellular Localization Analysis
Subcellular fractionation was performed as described previously (Nakamura et al., 2004
) with minor modifications. HeLa cells was washed with PBS, scraped off, and suspended in the homogenization buffer (10 mM HEPES-KOH, pH 7.4, 70 mM sucrose, and 0.22 M mannitol) containing protease inhibitor cocktail Complete EDTA-free (Roche Diagnostics). The cell suspension was passed 30 times through 27-gauge needle and then homogenized in Dounce homogenizer. After brief centrifugation (600 x g, 5 min), the supernatant was homogenized and then centrifuged at 5000 x g for 10 min to obtain the mitochondria fraction. The resultant supernatant was further centrifuged at 100,000 x g for 60 min to separate the microsomal and cytosolic fractions.
To examine submitochondrial localization, the isolated mitochondria fraction (30 µg) was treated with 50 µg/ml trypsin at 4°C for 30 min under either isotonic or hypotonic condition. After termination by addition of 10% TCA, proteins was precipitated and analyzed by SDS-PAGE and immunoblotting.
In Vitro Protein Import into Isolated Mitochondria
Cell-free protein synthesis was carried out using pcDNA3.1-MICS1-3HA as a template and TNT Quick Coupled Transcription/Translation System (Promega, Madison, WI) as described previously (Setoguchi et al., 2006
). Import of MICS1 into mitochondria was performed essentially as described previously (Kanaji et al., 2000
). In vitro–synthesized MICS1 was incubated at 30°C for 30 min in the buffer (50 mM sodium succinate, 5 mM Mg(OAc)2, 1 mM ATP, and 0.5 mM NADH) with the mitochondria fraction (50 µg) prepared from HeLa cells in the presence of protease inhibitor cocktail Complete EDTA-free (Roche Diagnostics). If necessary, 0.1% Triton X-100 (Tx-100) was added to disrupt membranes after import reaction. After being treated at 4°C for 20 min with 50 µg/ml proteinase K, the reaction mixtures were subjected to analysis by SDS-PAGE and immunoblotting.
Cell Fractionation
To induce apoptosis, HeLa cells were incubated with 20 µM actinomycin D (Sigma-Aldrich) or 1 µM staurosporine (Sigma-Aldrich) in the presence or absence of 100 µM zVAD-fmk (Peptide Institute, Osaka, Japan). After incubation, cells were analyzed by immunofluorescence microscopy or cell fractionation. Cell fractionation using 0.2 mg/ml digitonin was carried out as described previously (Otera et al., 2005
).
Immunoblotting and Immunofluorescence Microscopic Analysis
Immunoblotting was performed as described previously (Oka et al., 2004
).
Immunofluorescence microscopy was carried out essentially as described previously (Ungar et al., 2002
) with minor modification as follows: cells grown on glass coverslips were treated for 8 h with 20 µM actinomycin D (Sigma-Aldrich) in the presence or absence of 100 µM zVAD-fmk (Peptide Institute) if necessary. Cells were fixed with 4% paraformaldehyde, permeabilized by incubation with 0.1% Tx-100 for 10 min, and incubated with primary antibodies. After incubation with Alexa-conjugated secondary antibodies (Invitrogen), images were acquired using a confocal microscope (Radiance 2000; Bio-Rad, Richmond, CA). Values (average ± SEM) of the efflux of cytochrome c and Smac and changes in mitochondrial morphology were calculated from data of at least three independent experiments, and 100–200 individual cells were counted in each experiment.
Antibodies used for immunoblotting and immunofluorescence microscopy were as follows: rabbit polyclonal antibodies: anti-Tim17 (Ishihara and Mihara, 1998
), anti-Tim23 (Ishihara and Mihara, 1998
), anti-Tim44 (Ishihara and Mihara, 1998
), anti-Sec61β (Upstate Biotechnology, Lake Placid, NY), anti-Bax, NT (Upstate Biotechnology), anti-H450 (Ishihara et al., 1990
), anti-Tom20 (Iwahashi et al., 1997
), anti-HtrA2 (R&D Systems, Minneapolis, MN), anti-mitofilin (Eura et al., 2006
); mouse monoclonal antibodies: anti-cytochrome c (BD Biosciences, San Jose, CA), anti-Smac (BD Biosciences), anti-OPA1 (BD Biosciences), anti-Dlp1/Drp1 (BD Biosciences), anti-Tom20 (Santa Cruz Biotechnology, Santa Cruz, CA), anti-GAPDH (Ambion, Austin, TX), anti-mtHSP70 (Stressgen, San Diego, CA), anti-HA (16B12; Covance Laboratories, Madison, WI), anti-FLAG (M2; Sigma); and anti-HA rat mAb (Roche Diagnostics).
Analysis of Cytochrome c Release in Semi-intact Cells
The preparation of semi-intact cells was performed essentially as described previously (Setoguchi et al., 2006
). After treatment for 8 h with dimethylsulfoxide (DMSO) or actinomycin D, MICS1-3HA–transfected cells on glass coverslips were washed, incubated at room temperature (RT) for 5 min with buffer A (20 mM HEPES-KOH, pH 7.4, 25 mM KCl, 2.5 mM Mg(OAc)2, 0.25 M sucrose, and 1 µM Taxol) containing 25 µg/ml digitonin, and gently washed three times with the same buffer. If necessary, cells were incubated for 20 min at RT with 30 nM recombinant tBid (R&D Systems) in buffer A to induce cytochrome c release. The samples were washed and divided for two different purposes: 1) to confirm the induction of cytochrome c release, cells were fixed with 4% paraformaldehyde, completely permeabilized by incubating for 10 min with 0.1% Tx-100, and subjected to immunofluorescence analysis with antibodies to HA tag, cytochrome c, and Tim17, and 2) cells were incubated at RT for 60 min with both anti-mitofilin and anti-Tom20 antibodies in buffer A, washed, and fixed. After complete permeabilization, cells were incubated with anti-HA tag antibody and analyzed by immunofluorescence microscopy.
Chemical Cross-Linking and Immunoprecipitation
Cells were harvested, washed with PBS, and incubated with 0, 0.1, 0.25, or 0.5 mg/ml dithiobis (succinimidyl propionate) (DSP; Pierce, Rockford, IL) at 4 or 25°C for 15–30 min. After termination by addition of 50 mM Tris-HCl (pH 8.0), cells were solubilized at 4°C for 30 min in the buffer (50 mM Tris-HCl, pH 8.0, 0.1% SDS, 1% Tx-100, and 150 mM NaCl) and then centrifuged to remove insoluble materials. The resultant supernatant was incubated with anti-FLAG (M2) agarose (Sigma-Aldrich) for 3 h at 4°C, washed twice with PBS containing 1% Tx-100, and then washed once with PBS alone. The precipitates were analyzed by SDS-PAGE and immunoblotting.
Electron Microscopy
Electron microscopy immunoelectron microscopy were carried out as described previously (Eura et al., 2003
).
| RESULTS |
|---|
|
|
|---|
1000 proteins for which information was available, one membrane protein with multiple transmembrane segments (UniGene Hs.352656) was selected. Because the protein was involved in maintaining the mitochondrial network and inner membranes (see below), it was named MICS1 (for mitochondrial morphology and cristae structure). To confirm the intracellular localization of MICS1, a carboxy-terminally HA-tagged MICS1 (MICS1-3HA) was introduced into HeLa cells. Immunofluorescence analysis revealed that MICS1 was found in the intracellular tubular network structures and colocalized with Tim17, a mitochondrial protein (Figure 1A). In subcellular fractionation, MICS1 was recovered in the mitochondrial fraction and was undetectable in the microsomal and cytosolic fractions (Figure 1C). These results indicate that MICS1 localizes in the mitochondria.
|
1- 44) comigrated with the protein expressed in HeLa cells (Figure 1D, lanes 8 and 9), indicating that MICS1 has a cleavable presequence of 44 amino acid residues. To examine the submitochondrial compartments in which MICS1 localizes, the mitochondrial fraction prepared from cells expressing carboxy-terminally 3FLAG-tagged MICS1 (MICS1-3FLAG) was treated with trypsin under isotonic and hypotonic conditions (Figure 1E). In both conditions, an outer membrane protein, Tom20, was sensitive to trypsin treatment, whereas a matrix protein, mtHSP70, was resistant. The inner membrane protein Tim17 was degraded only under hypotonic conditions that disrupt the outer membrane. Similarly, endogenous MICS1 was digested only under hypotonic conditions and converted to a 16-kDa protein. Under the same conditions, MICS1-3FLAG disappeared and smaller bands were not detected. These results indicate that MICS1 localizes in the inner membrane and its carboxy-terminal region faces the intermembrane space. In addition, alkaline extraction analysis indicated that MICS1 is an integral membrane protein (Figure 1F). Based on the deduced amino acid sequence, MICS1 is comprised mainly of seven hydrophobic segments and a carboxy-terminal hydrophilic domain with 50 amino acid residues. These findings led us to propose the topology for MICS1 shown in Figure 1G.
MICS1 Is Required for the Mitochondrial Tubular Network and Cristae Organization
Mitochondria are morphologically dynamic organelles that undergo continuous fission and fusion for maintenance of the tubular network structures (Yaffe, 1999
; Griparic and van der Bliek, 2001
). To examine the role of MICS1 in mitochondrial morphology, gene expression was repressed using RNA interference (RNAi). More than 80% of MICS1 was reduced by 48-h incubation with siRNA specific to MICS1 (Figure 2A). Because the mitochondrial tubular network is fragile, we used HeLa cells stably expressing Su9-DsRed, a mitochondria-targeted DsRed, to visualize the morphology without requiring cell fixation (Taguchi et al., 2007
). As shown in Figure 2B, MICS1 RNAi induced the appearance of moderately fragmented mitochondria (panel b, arrowhead) and lump-like structures near winding mitochondrial tubules (panel c). The siRNA for green fluorescent protein (GFP) did not induce these effects on the mitochondrial morphology (panel a). Furthermore, to examine the intramitochondrial ultrastructure, MICS1-knockdown cells were analyzed by conventional electron microscopy. The number of invaginations of the inner membranes, namely cristae, were clearly reduced in the MICS1-siRNA-transfected cells compared with control cells (Figure 2C). In addition, the cristae became curved and ring like structures of the inner membranes were commonly found in the MICS1-knockdown cells. Thus, MICS1 is crucial for mitochondrial networks and cristae organization.
|
MICS1 Down-Regulation Stimulates the Release of Cytochrome c during Apoptosis
MICS1 is predicted to belong to the Bi-1 super family, which includes Bi-1 and LFG (Chae et al., 2003
). The Bi-1 knockout cells are sensitive to reagents that induce ER stress, suggesting that Bi-1 controls ER stress-induced apoptosis (Chae et al., 2004
). Overexpression of LFG protects cells from Fas-mediated apoptosis (Somia et al., 1999
). To assess the roles of MICS1 in apoptosis, the MICS1 siRNA-transfected cells were treated with apoptosis-inducing reagents. In the MICS1 knockdown cells, most of the cytochrome c was maintained in the mitochondria when treated with DMSO (Figure 3Ag), indicating that MICS1 down-regulation alone does not influence the targeting and localization of cytochrome c. When treated with actinomycin D in the presence of zVAD-fmk, a pan-caspase inhibitor, the release of cytochrome c into the cytoplasm was clearly enhanced by MICS1 RNAi (Figure 3A, compared with j). A similar effect was observed with staurosporine treatment (Figure 3B, left panel). The stimulatory effect of MICS1 RNAi on cytochrome c release was blocked by the exogenous expression of MICS1, but not that of Tim23 (Figure 3B, right panel), indicating that the increased release of cytochrome c is due to MICS1 down-regulation. The remarkable effect of MICS1 RNAi on cytochrome c release was observed in an early phase (Figure 3C). With 4-h actinomycin D incubation, 40.3% of the MICS1-knockdown cells exhibited cytoplasmic localization of cytochrome c, whereas 6.3% of the control cells exhibited this localization. In addition to the microscopic analyses, cellular fractionation showed that MICS1 knockdown increased the amount of cytochrome c recovered from the supernatant fraction when incubated for 4 h with actinomycin D (Figure 3D). These results demonstrate that MICS1 down-regulation stimulates the apoptotic release of cytochrome c from the mitochondria.
|
MICS1 down-regulation caused abnormal mitochondrial morphology and rapid apoptotic release of cytochrome c. To distinguish contribution of MICS1 to mitochondrial morphology from its role in apoptotic pathways, HeLa cells stably expressing an anti-apoptotic protein Bcl-XL (Otera et al., 2005
) were used. In the Bcl-XL stable cell lines, most of the cytochrome c (more than 85%) was retained in the mitochondria during apoptosis even when the siRNA for MICS1 was transfected (Figure 3F, left panel), indicating that the increased expression of Bcl-XL suppresses the apoptotic processes. In contrast, MICS1 knockdown clearly induced mitochondrial fragmentation (Figure 3F, right panel). It should be noted that mitochondria in the Bcl-XL stable cell lines seemed to be easily fragmented even when the GFP siRNA was transfected, presumably because of exogenous expression of the carboxy terminal tail-anchored protein, which induces changes in mitochondrial morphology (Horie et al., 2002
). Thus, MICS1 regulates mitochondrial morphology independently of the apoptotic processes.
MICS1 Overexpression Partially Inhibits Cytochrome c Release during Apoptosis
To examine the effects of MICS1 overexpression on cytochrome c release, cells transfected with the plasmid carrying MICS1-3HA were treated with actinomycin D. Even when incubated with actinomycin D, most cytochrome c in the MICS1-3HA-expressing cells was still retained in a perinuclear compartment (Figure 4A, arrowhead), overlapping with the localization of Tim17, which is consistent with the observation that mitochondria in the MICS1-transfected cells aggregated around the nucleus (Figure 2D). Only 15.6% of MICS-3HA–transfected cells exhibited obvious cytoplasmic staining of cytochrome c after 8-h treatment with actinomycin D (Figure 4B), whereas there were no significant effects in vector or Tim23 expression plasmid-transfected cells (45.3 or 45.2% of cells with cytochrome c release, respectively). These results indicate that cytochrome c is retained in the mitochondria of MICS1-overproducing cells. Similar results were obtained when MICS1 lacking the carboxy-terminal hydrophilic domain was overexpressed, indicating that the flanking region extruding into the intermembrane space is not necessary for the retention of cytochrome c. Likewise, the number of abnormal nuclei induced during apoptosis was reduced in the MICS1-overexpressing cells compared with control cells (Figure 4C). There were no significant differences in the numbers of surviving cells, however, between the control and MICS1-tranfected cell populations during apoptosis. These findings suggest that MICS1 overexpression delays cytochrome c release and subsequent processes, including nuclear fragmentation, but fails to protect cells from apoptotic death. To biochemically analyze cytochrome c release in the MICS1-overexpressing cells, we attempted to isolate cell lines stably expressing MICS1-3HA because the transfection efficiency of the MICS1 plasmid was low. Despite several efforts using three different expression plasmids with strong promoters, we did not obtain cell lines that overproduced MICS-3HA. All cell lines we isolated expressed MICS1-3HA levels
10-fold lower than the endogenous protein, suggesting that continuous overproduction of MICS1 is cytotoxic.
|
Similar to cytochrome c, proapoptotic proteins, including Smac and HtrA2, were rapidly released into the cytoplasm in the MICS1-knockdown cells (Figure 3E). We therefore examined the effects of MICS1 overexpression on the release of proapoptotic proteins. Surprisingly, both Smac and HtrA2 were normally released into the cytoplasm, regardless of the expression of MICS1-3HA (Figure 4E). There were no significant differences in the release efficiencies of Smac and HtrA2 between untransfected and MICS1-transfected cells, indicating that the release of Smac and HtrA2 is not affected by MICS1 overproduction.
OPA1 is thought to be involved in cristae remodeling and its inactivation stimulates apoptosis-induced release of cytochrome c (Olichon et al., 2003
; Lee et al., 2004
; Frezza et al., 2006
). To examine whether OPA1 is required for the inhibition of cytochrome c release induced by MICS1 overexpression, OPA1 was knocked down in the MICS1-overexpressing cells. In control cells, apoptotic release of cytochrome c was stimulated by OPA1 RNAi as reported previously (Olichon et al., 2003
; Lee et al., 2004
). OPA1 knockdown enhanced cytochrome c release even when MICS1 was overexpressed (Figure 4F), indicating that OPA1 contributes to MICS1-mediated retention of cytochrome c in the mitochondria during apoptosis. It should be noted that OPA1 down-regulation did not completely cancel the effect of MICS1 overexpression on cytochrome c release, suggesting that MICS1 play a distinct role in the apoptotic release of cytochrome c.
MICS1 Does Not Influence Bax Targeting and Mitochondrial Outer Membrane Permeabilization during Apoptosis
Bax, a cytoplasmic protein under healthy conditions, translocates to the mitochondria after proapoptotic stimulation and then oligomerizes on the outer membrane. The oligomerized form is considered to be crucial for mitochondrial outer membrane permeabilization to facilitate the efflux of proapoptotic proteins (Sharpe et al., 2004
; Er et al., 2006
). Therefore, mitochondrial targeting of Bax was examined in the MICS1-3HA–transfected cells. Immunofluorescence analysis revealed Bax as dot-like staining on the mitochondria after treatment with actinomycin D, whereas the signal was undetectable when incubated with DMSO (Figure 5A, a and e). In the MICS1-transfected cells in which cytochrome c was retained, Bax clearly targeted the mitochondria (Figure 5Ae, arrowheads). The ratio of Bax-positive cells was similar between control and MICS1-transfected cells (22.8 ± 1.2 and 23.7 ± 1.6%, respectively). Bax was not easily detected because of its dot-like staining and mitochondrial fragmentation in apoptotic cells, likely resulting in underestimation of the number of Bax-positive cells. These results indicate that although Bax targeted the mitochondria normally, cytochrome c was still retained in the MICS1-transfected cells.
|
After targeting the mitochondria, Bax conformationally changes and oligomerizes on the outer membrane, thereby inducing outer membrane permeabilization (Antonsson et al., 2000
). To examine whether outer membrane permeabilization was induced in the MICS1-transfected cells, we assessed the accessibility of an antibody to an inner membrane protein in semi-intact cells. Treatment with a low concentration of digitonin disrupts the plasma membrane without affecting the integrity of the mitochondrial outer membrane (Setoguchi et al., 2006
). After transfecting the cells with an MICS1-3HA expression plasmid, cells were treated with either DMSO or actinomycin D, permeabilized with digitonin, and incubated with antibodies to an outer membrane protein, Tom20, and an inner membrane protein, mitofilin, exposing a large hydrophilic domain to the intermembrane space (John et al., 2005
). When incubated with DMSO, mitochondria were immunostained by the anti-Tom20 antibody, but not the anti-mitofilin antibody (Figure 5B, a and b), indicating that treatment with digitonin induces perforation of only the plasma membrane; the outer membrane remains intact. After actinomycin D treatment, the mitochondria were clearly immunostained by the anti-mitofilin antibody, and the staining overlapped with staining by the anti-Tom20 antibody (Figure 5B, e–h). Thus, the anti-mitofilin antibody could access the inner membrane if the outer membrane was permeabilized. In the MICS1-transfected cells, mitochondrial staining by the anti-mitofilin antibody was observed only when incubated with actinomycin D (Figure 5Be, arrowhead), indicating that outer membrane permeabilization occurs in MICS1-overproducing cells. In addition to the apoptosis-inducing reagent, we attempted tBid-mediated cytochrome c release using the semi-intact cells. The MICS1-transfected cells were digitonin-permeabilized, incubated with a recombinant tBid, and subjected to immunofluorescence analysis. On treatment with tBid, cytochrome c was released into the cytoplasm of the untransfected cells, whereas cytochrome c was retained in the mitochondria of MICS1-overexpressing cells (Figure 5Ce, arrowheads). Under the same conditions, as well as under treatment with actinomycin D, the anti-mitofilin antibody recognized the inner membrane of the semi-intact cells in which MICS1 was overproduced (Figure 5Cm, arrowheads). These results demonstrate that MICS1 overexpression does not influence Bax targeting and outer membrane permeabilization during apoptosis.
MICS1 Coprecipitates with Cytochrome c
Despite permeabilization of the outer membrane, cytochrome c was retained in the mitochondria of MICS1-overproducing cells. To examine the possibility that MICS1 interacts with cytochrome c in the inner membrane, immunoprecipitation with cytochrome c was examined. Because commercially available anti-cytochrome c antibodies were not to sufficiently specific for efficient immunoprecipitation, a carboxy-terminally three FLAG-tagged cytochrome c (cytochrome c-3FLAG) was stably expressed in HeLa cells and confirmed to have the same behavior as an endogenous protein with regard to the MICS1-mediated inhibition of release from the mitochondria. Without cross-linkers, MICS1 was not coprecipitated by pulldown of cytochrome c-3FLAG. Therefore, the membrane-permeable, thiol-cleavable cross-linker DSP was used before membrane solubilization. Cells were harvested, incubated with DSP, solubilized with detergents, and subjected to immunoprecipitation with an anti-FLAG antibody. MICS1 was clearly coprecipitated with cytochrome c-3FLAG and the amount was DSP concentration-dependent (Figure 6A). The inner membrane proteins Tim23 and Tim44, however, were not detected, indicating that MICS1 specifically interacts with cytochrome c. The interaction of exogenously expressed MICS1 with cytochrome c was examined. After transfection with the plasmid for either MICS1-3HA, Bi-1-3HA, or LFG-3HA, cells were incubated with DSP, solubilized, and immunoprecipitated with anti-FLAG antibody. MICS1-3HA, but not Bi-1-3HA and LFG-3HA, was significantly coprecipitated with cytochrome c-3FLAG in a DSP-dependent manner (Figure 6B). Thus, cytochrome c interacts with both endogenous and exogenous MICS1, but not with Bi-1 and LFG.
|
|
| DISCUSSION |
|---|
|
|
|---|
MICS1 down-regulation induced abnormal mitochondrial morphology; that is, mild fragmentation, lump-like structures, and short curved tubules. Such changes in mitochondrial morphology were also observed in the Bcl-XL–expressing cells when MICS1 was repressed, indicating that MICS1 is involved in maintaining mitochondrial tubular networks separately from the role in apoptotic pathways. A similar mitochondrial morphology was observed in the body wall muscle cells of nematode when the Caenorhabditis elegans homologue (K11H12.8) of MICS1 was knocked down by RNAi (R. Ichishita, T. Oka, and K. Mihara, unpublished data), suggesting that the roles of MICS1 in mitochondrial morphology are conserved. Loss of Drp1, Fis1, OPA1, or Mfn1/2 governing membrane fusion and fission induces drastic changes in mitochondrial morphology; completely fragmented and elongated mitochondria result from the down-regulation of proteins required for fusion and fission machineries, respectively (Chen et al., 2003
; Ishihara et al., 2003
; Olichon et al., 2003
; Lee et al., 2004
; Jofuku et al., 2005
). MICS1 RNAi induced clear changes in mitochondrial morphology, but the effect was moderate compared with the phenotypes induced by the down-regulation of Drp1, Fis1, OPA1, or Mfn1/2, suggesting that MICS1 is dispensable directly for machineries controlling membrane fusion and/or fission. Nonetheless, MICS1 down-regulation induced cristae disorganization. It is possible that abnormal mitochondrial morphology results in a failure to maintain cristae integrity. Although the loss of OPA1 can be due to cristae disorganization, mitochondria in the MICS1-knockdown cells did not exhibit expanded cristae, which are a characteristic feature of cells lacking OPA1 (Olichon et al., 2003
; Frezza et al., 2006
). These findings, together with the lack of evidence for a physical interaction between MICS1 and OPA1, suggest that MICS1 has a distinct role in cristae organization, which is presumably separate from that of OPA1.
The release of proapoptotic proteins, including cytochrome c, Smac, and HtrA2, was enhanced by MICS1 knockdown. Increasing the MICS1 gene dosage, however, did not influence the apoptotic release of Smac and HtrA2. Only cytochrome c was retained in the mitochondria by MICS1 overproduction. Stimulation of the apoptotic release of Samc and HtrA2 might be due to disorganized cristae structures. Bax targeting and subsequent outer membrane permeabilization occurred normally in MICS1-overexpressing cells, indicating that cytochrome c release is inhibited downstream of outer membrane perforation. Cytochrome c is thought to be present in pools loosely and tightly bound to the inner membrane. Although outer membrane permeabilization is sufficient to trigger the release of a certain population of cytochrome c, detachment of a major pool that is tightly bound to the inner membrane is proposed to require the remodeling of cristae structures (Ott et al., 2002
; Scorrano et al., 2002
). Although tBid induces a striking remodeling of cristae structures (Scorrano et al., 2002
), cytochrome c was clearly retained in the mitochondria of the cells overexpressing MICS1 after incubation with tBid. Furthermore, the retention of cytochrome c mediated by MICS1 overexpression was not completely canceled by OPA1 RNAi, which induces the remodeling of cristae structures (Frezza et al., 2006
). These results suggest that the inhibition of cytochrome c release by MICS1 is mediated by protein-protein interactions, but not membrane organization. Indeed, MICS1 coprecipitated with cytochrome c. Nonetheless, the possibility that other proteins and/or lipids facilitated the association of cytochrome c with MICS1 could not be ruled out because of inefficient cross-linking with MICS1.
Recently, Drp1 down-regulation was reported to partially inhibit the apoptotic release of cytochrome c, but not other proapoptotic proteins, including Smac and HtrA2 (Parone et al., 2006
; Estaquier and Arnoult, 2007
). This inhibition is thought to account for alterations of the OPA1 processing by Drp1 RNAi. Neither MICS1 overproduction nor knockdown influenced the total amount of Drp1 (unpublished data). The OPA1 processing and Drp1 amount did not change under the low-serum condition. Furthermore, MICS1 overexpression induced mitochondrial aggregation, whereas Drp1 down-regulation induced mitochondrial elongation. It is unlikely that MICS1 contributes to the inhibition of cytochrome c release induced by Drp1 down-regulation.
Our studies suggest that MICS1 has the two individual functions as follows: First, MICS1 is necessary for maintenance of mitochondrial morphology in specific cristae structures. MICS1 down-regulation decreased the number of invaginated inner membranes. So far, mitofilin and OPA1 are reported to be responsible for cristae morphology (Olichon et al., 2003
; John et al., 2005
). Different from the effects of RNAi for mitofilin or OPA1, there were no mitochondria with expanded cristae or with onion-like inner membrane structures in the MICS1 knockdown cells, suggesting that MICS1 has a distinct function in controlling the invagination of inner membranes. In addition, MICS1 overexpression caused mitochondrial aggregation and vacuolation, eventually inducing cytotoxicity. Vacuoles found in mitochondria of the MICS1-overexpressing cells were low electron dense, suggesting that the intermembrane space or cristae structure, but not matrix, was expanded. Although it is still unclear why MICS1 overexpression is cytotoxic, MICS1 may contribute to an association between the invaginated membranes. Second, MICS1 facilitates the tight association of cytochrome c with the inner membranes. In the low-serum condition, the delayed apoptotic release of cytochrome c correlated with MICS1 up-regulation. Serum depletion causes a decrease in the mitochondrial membrane potential, triggering cytochrome c release in Rat-1 cells (Annis et al., 2001
). Under the low-serum condition, an increase in MICS1 may counteract this effect, thereby preventing the easy entry into the apoptotic pathway. Conversely, in the normal serum condition MICS1 gradually decreased in response to the progress of apoptosis (Figure 7D), which may facilitate rapid release of cytochrome c. In contrast to Bi-1 and LFG, MICS1 overproduction could not completely protect cells from apoptotic death. Thus, MICS1 may temporarily interrupt an apoptotic pathway via the mitochondria to allow cells to survive under unhealthy conditions.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Address correspondence to: Toshihiko Oka (okat{at}cell.med.kyushu-u.ac.jp) or Katsuyoshi Mihara (mihara{at}cell.med.kyushu-u.ac.jp)
Abbreviations used: Bi-1, Bax inhibitor-1; DSP, dithiobis (succinimidyl propionate); GFP, green fluorescent protein; LFG, life guard; OPA1, optic atrophy 1; RNAi, RNA interference.
| REFERENCES |
|---|
|
|
|---|
Antonsson, B., Montessuit, S., Lauper, S., Eskes, R., and Martinou, J. C. (2000). Bax oligomerization is required for channel-forming activity in liposomes and to trigger cytochrome c release from mitochondria. Biochem. J 345, 271–278.[CrossRef][Medline]
Bouchier-Hayes, L., Lartigue, L., and Newmeyer, D. D. (2005). Mitochondria: pharmacological manipulation of cell death. J. Clin. Invest 115, 2640–2647.[CrossRef][Medline]
Chae, H. J., Ke, N., Kim, H. R., Chen, S., Godzik, A., Dickman, M., and Reed, J. C. (2003). Evolutionarily conserved cytoprotection provided by Bax Inhibitor-1 homologs from animals, plants, and yeast. Gene 323, 101–113.[CrossRef][Medline]
Chae, H. J. et al. (2004). BI-1 regulates an apoptosis pathway linked to endoplasmic reticulum stress. Mol. Cell 15, 355–366.[CrossRef][Medline]
Chan, D. C. (2006). Dissecting mitochondrial fusion. Dev. Cell 11, 592–594.[CrossRef][Medline]
Chen, H., Detmer, S. A., Ewald, A. J., Griffin, E. E., Fraser, S. E., and Chan, D. C. (2003). Mitofusins Mfn1 and Mfn2 coordinately regulate mitochondrial fusion and are essential for embryonic development. J. Cell Biol 160, 189–200.
Cipolat, S., Martins de Brito, O., Dal Zilio, B., and Scorrano, L. (2004). OPA1 requires mitofusin 1 to promote mitochondrial fusion. Proc. Natl. Acad. Sci. USA 101, 15927–15932.
Danial, N. N., and Korsmeyer, S. J. (2004). Cell death: critical control points. Cell 116, 205–219.[CrossRef][Medline]
Duvezin-Caubet, S. et al. (2007). OPA1 processing reconstituted in yeast depends on the subunit composition of the m-AAA Protease in mitochondria. Mol. Biol. Cell 18, 3582–3590.
Er, E., Oliver, L., Cartron, P. F., Juin, P., Manon, S., and Vallette, F. M. (2006). Mitochondria as the target of the pro-apoptotic protein Bax. Biochim. Biophys. Acta 1757, 1301–1311.[Medline]
Estaquier, J., and Arnoult, D. (2007). Inhibiting Drp1-mediated mitochondrial fission selectively prevents the release of cytochrome c during apoptosis. Cell Death. Differ 14, 1086–1094.[CrossRef][Medline]
Eura, Y., Ishihara, N., Yokota, S., and Mihara, K. (2003). Two mitofusin proteins, mammalian homologues of FZO, with distinct functions are both required for mitochondrial fusion. J. Biochem. (Tokyo) 134, 333–344.
Eura, Y., Ishihara, N., Oka, T., and Mihara, K. (2006). Identification of a novel protein that regulates mitochondrial fusion by modulating mitofusin (Mfn) protein function. J. Cell Sci 119, 4913–4925.
Frezza, C. et al. (2006). OPA1 controls apoptotic cristae remodeling independently from mitochondrial fusion. Cell 126, 177–189.[CrossRef][Medline]
Green, D. R., and Reed, J. C. (1998). Mitochondria and apoptosis. Science 281, 1309–1312.
Griparic, L., and van der Bliek, A. M. (2001). The many shapes of mitochondrial membranes. Traffic 2, 235–244.[CrossRef][Medline]
Horie, C., Suzuki, H., Sakaguchi, M., and Mihara, K. (2002). Characterization of signal that directs C-tail-anchored proteins to mammalian mitochondrial outer membrane. Mol. Biol. Cell 13, 1615–1625.
Ishihara, N., and Mihara, K. (1998). Identification of the protein import components of the rat mitochondrial inner membrane, rTIM17, rTIM23, and rTIM44. J. Biochem 123, 722–732.
Ishihara, N., Fujita, Y., Oka, T., and Mihara, K. (2006). Regulation of mitochondrial morphology through proteolytic cleavage of OPA1. EMBO J 25, 2966–2977.[CrossRef][Medline]
Ishihara, S., Morohashi, M., Sadano, H., Kawabata, S., Gotoh, O., and Omura, T. (1990). Molecular cloning and sequence analysis of cDNA coding for rat liver hemoprotein H-450. J. Biochem 108, 899–902.
Ishihara, N., Jofuku, A., Eura, Y., and Mihara, K. (2003). Regulation of mitochondrial morphology by membrane potential, and DRP1-dependent division and FZ01-dependent fusion reaction in mammalian cells. Biochem. Biophys. Res. Commun 301, 891–898.[CrossRef][Medline]
Iwahashi, J., Yamazaki, S., Komiya, T., Nomura, N., Nishikawa, S., Endo, T., and Mihara, K. (1997). Analysis of the functional domain of the rat liver mitochondrial import receptor Tom20. J. Biol. Chem 272, 18467–18472.
Jensen, R. E., Hobbs, A. E., Cerveny, K. L., and Sesaki, H. (2000). Yeast mitochondrial dynamics: fusion, division, segregation, and shape. Microsc. Res. Tech 51, 573–583.[CrossRef][Medline]
Jiang, X., and Wang, X. (2004). Cytochrome c-mediated apoptosis. Annu. Rev. Biochem 73, 87–106.[CrossRef][Medline]
Jofuku, A., Ishihara, N., and Mihara, K. (2005). Analysis of functional domains of rat mitochondrial Fis1, the mitochondrial fission-stimulating protein. Biochem. Biophys. Res. Commun 333, 650–659.[CrossRef][Medline]
John, G. B., Shang, Y., Li, L., Renken, C., Mannella, C. A., Selker, J. M., Rangell, L., Bennett, M. J., and Zha, J. (2005). The mitochondrial inner membrane protein mitofilin controls cristae morphology. Mol. Biol. Cell 16, 1543–1554.
Kanaji, S., Iwahashi, J., Kida, Y., Sakaguchi, M., and Mihara, K. (2000). Characterization of the signal that directs Tom20 to the mitochondrial outer membrane. J. Cell Biol 151, 277–288.
Karbowski, M, Jeong, S. Y., and Youle, R. J. (2004). Endophilin B1 is required for the maintenance of mitochondrial morphology. J. Cell Biol 166, 1027–1039.