![]() |
|
|
Vol. 19, Issue 7, 2777-2788, July 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,
,
,||

*Department of Cell Biology, University of Alberta, Edmonton, Alberta, T6G2H7, Canada; and
Vollum Institute, Oregon Health and Science University, Portland, OR 97239
Submitted October 3, 2007;
Revised March 28, 2008;
Accepted April 9, 2008
Monitoring Editor: Adam Linstedt
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Coat- and receptor-based retention and retrieval mechanisms ensure that ER folding chaperones and oxidoreductases localize to the ER (Teasdale and Jackson, 1996
; Duden, 2003
; Michelsen et al., 2005
). However, in addition to multiple domains of the ER, many ER chaperones such as BiP/GRP78, PDI, and CNX have also been found on the plasma membrane, suggesting that their intracellular retention and trafficking along the secretory pathway varies (Wiest et al., 1995
; Mezghrani et al., 2000
; Arap et al., 2004
; Misra et al., 2006
). For instance, high levels of CNX characterize the plasma membrane of immature thymocytes. Conversely, ER stress can reduce surface CNX (Wiest et al., 1995
; Okazaki et al., 2000
). Changing the amount of CNX on the plasma membrane could affect cell surface properties and might have implications on phagocytosis or cell–cell interactions (Gagnon et al., 2002
). Hence, the amount of CNX on the plasma membrane could depend on the cell type or cellular homeostasis, and it might be the result of regulated intracellular retention.
In addition to folding intermediates, ribosomes and SERCA2b, CNX also interacts with BAP31, an ER cargo receptor that mediates export of transmembrane proteins from the ER and shuttles them to the ER quality control compartment (Annaert et al., 1997
; Spiliotis et al., 2000
; Kamhi-Nesher et al., 2001
; Zuppini et al., 2002
; Frenkel et al., 2004
; Zen et al., 2004
; Groenendyk et al., 2006
; Wakana et al., 2008
). The only functional significance that has so far been attributed to this interaction is a regulation of caspase cleavage of BAP31 during the onset of apoptosis (Zuppini et al., 2002
; Breckenridge et al., 2003
; Groenendyk et al., 2006
). It is not known whether BAP31 can influence the intracellular targeting of CNX.
In summary, CNX can reach the plasma membrane and can also interact with numerous ER membrane proteins that are found on multiple domains of the ER such as the MAM. Although CNX and other ER chaperones clearly localize to multiple cellular membranes, it is currently not understood whether the cell has mechanisms in place that control the distribution of chaperones between these various locations.
Support for the hypothesis of a controlled distribution of ER proteins to specific membrane domains comes from pioneering studies on CNX (Chevet et al., 1999
; Roderick et al., 2000
). These articles showed that protein kinase C (PKC), extracellular-signal regulated kinase-1 (ERK-1) and protein kinase CK2 (CK2) can phosphorylate the CNX cytosolic domain. Phosphorylation by ERK-1 on serine 583 increases interaction of CNX with ribosomes, but also interaction with SERCA2b. In addition, CK2 phosphorylation of serines 554 and 564 by CK2 synergizes with ERK-1 phosphorylation of serine 583 to promote interaction with ribosomes (Chevet et al., 1999
). Hence, the CNX phosphorylation state could lead to enrichment on the MAM and the rER, where these CNX interactors are found. However, it is still unclear what happens to dephosphorylated CNX that has been demonstrated to exist in vivo (Wong et al., 1998
).
The CK2 site of CNX, but not the ERK-1 site, is embedded within an acidic cluster (see Figure 1A). Interestingly, CK2-phosphorylatable acidic clusters are hallmark interaction sequences for proteins of the PACS family, which includes PACS-1 and PACS-2 (Wan et al., 1998
; Kottgen et al., 2005
; Simmen et al., 2005
; Feliciangeli et al., 2006
; Scott et al., 2006
). The interaction of these acidic motifs with PACS proteins mediates a variety of intracellular targeting steps that include trafficking between the trans-Golgi (TGN) network and endosomes, localization to mitochondria and retention in the ER. Cargo proteins can usually interact with both PACS-1 and PACS-2 (Kottgen et al., 2005
; Feliciangeli et al., 2006
). The intracellular targeting that results from the cargo protein–PACS interaction is typically influenced by the formation of ternary complexes with additional proteins that include coatomer (COPI), adaptor proteins, and even CK2 itself (Crump et al., 2001
; Kottgen et al., 2005
; Scott et al., 2006
; Atkins et al., 2008
). Phosphorylation by CK2 on serines associated with the acidic motifs often serves as a switch that either promotes or blocks interaction with PACS proteins (Schermer et al., 2005
; Scott et al., 2006
).
The multifunctional cytosolic sorting protein PACS-2 interacts with COPI and controls the ER localization of transmembrane proteins such as polycystin-2 or profurin with a cytosolic CK2-phosphorylatable acidic cluster (Kottgen et al., 2005
; Feliciangeli et al., 2006
). PACS-2 also mediates the sorting of internalized cation-independent mannose 6-phosphate receptor (CI-MPR) from early endosomes to the TGN and interacts with HIV-1 Nef to assemble a multikinase cascade that triggers MHC-I down-regulation (Atkins et al., 2008
). Moreover, PACS-2 promotes MAM integrity and regulates its composition (Simmen et al., 2005
). Because the MAM harbors the machinery for calcium communication between the ER and mitochondria during the onset of apoptosis (Rizzuto et al., 1998
; Goetz et al., 2007
), knockdown of PACS-2 reduces both ER–mitochondria calcium exchange and apoptosis triggering (Simmen et al., 2005
).
Here, we identify CNX as a novel PACS-2 cargo protein on the ER. CNX interacts with PACS-2 using its acidic CK2 motif. Although this sequence in its phosphorylated form increases interaction with ribosomes (Chevet et al., 1999
), our results show that the nonphosphorylated CK2 motif interacts with PACS-2, thus retaining CNX within the ER and promoting CNX localization to heavy membranes of the ER and to MAMs. This PACS-2 localization mechanism is specific, because the knockdown of PACS-2 does not significantly affect the membrane fractionation of ER proteins that lack the PACS-2 motif, such as BAP31, ribophorin-I, or PDI. It also does not lead to reduced ER retention of BAP31. Our results thus show how the phospho-regulated interaction of CNX with PACS-2 could result in its distribution between the plasma membrane, the rER, and the MAM. PACS-2 interaction thus determines the amounts of CNX available for interaction with ribosomes on the rER and with SERCA2b on the MAM.
| MATERIALS AND METHODS |
|---|
|
|
|---|
, (Affinity BioReagents, Golden, CO); ERGIC53 (Alexis, Lausen, Switzerland); mitochondrial complex II (MitoSciences, Eugene, OR); thioredoxin (Invitrogen, Carlsbad, CA); CNX (polyclonal: Stressgen, Victoria, BC; monoclonal: BD Biosciences, Mississauga, ON, Canada); BiP (BD Biosciences, Mississauga, ON, Canada); β-COP (MaD, GeneTex, San Antonio, TX); GM-130 and caspase-3 (Cell Signaling, Danvers, MA); the FLAG tag (Rockland, Gilbertsville, PA); and the hemagglutinin (HA) tag (Covance, Berkeley, CA). CNX wild-type and knockout mouse embryonic fibroblasts (MEFs) were from M. Michalak (Edmonton, AB, Canada). HeLa cells were from ECACC (Porton Down, United Kingdom). Human and mouse PACS-2 small interfering RNAs (siRNAs; HSS146279, MSS211622) were from Invitrogen. All other siRNAs were previously described.
Expression Vectors and Mutagenesis
PACS-2 plasmids were previously described (Simmen et al., 2005
). The dog CNX cDNA was provided by E. Chevet (Montréal, QC, Canada). For glutathione S-transferase (GST) constructs, specific primers (Sigma) were used to generate tail mutations by PCR as indicated in the text. PCR products were inserted into pGEX4T1 (GE Healthcare, Baie d'Urfé, QC, Canada) using the BamHI and XhoI restriction sites. For mutagenesis of serines 554 and 564, we used the following oligos: TS157: GCAGATGCTGAAGAAGATGGCGGCACCGCGGCACAAGAGGAGGACGAT; TS158: GGTGCCGCCATCTTCTTCAGCATCTGCTTTTTGCTTCTCTTCAAGTTT; TS173: GCTGAAGAAGATGGCGGCACAGCTGATCAAGAGGAGGACGATAGG; and TS174: CAGCTGTGCCGCCATCTTCTTCAGCATCATCTTTTTGCTTCTCTTC.
FLAG-tagged CNX was constructed as follows: first, a lumenal FLAG tag was inserted by PCR right after the signal sequence. We used the following staggered primers: TS262: TACAAGGACGACGATGACAAGGGACATGAAGGACATGATGATGATATG; TS263: ATGTTACTGGTCCTTGGAACTACTATTGTTCAGGCTGACTACAAGGACGACGATGAC; and TS264: TATGGTACCACCATGGAAGGGAAATGGCTGCTGTGTATGTTACTGGTCCTTGGAACTAC.
Next, the mutagenesis oligos were used to recreate the GST mutants.
Immunofluorescence Microscopy, Transfections, and Western Blotting
Processing for immunofluorescence microscopy was performed as follows. Briefly, HeLa cells were grown on coverslips for 24 h (untransfected cells) or 72 h (when siRNA-transfected). Cells were washed with PBS containing 1 mM CaCl2 and 0.5 mM MgCl2 (PBS2+) and fixed with 3% paraformaldehyde for 20 min. After washing with PBS2+, cells were permeabilized for 1 min with 0.1% Triton X-100, 0.2% BSA in PBS2+. Cells were then incubated with primary antibodies (1:100) and secondary antibodies in PBS2+, 0.2% BSA for 1 h each, interrupted with three washes using PBS2+. All secondary antibodies were AlexaFluor-conjugated 350, 488, or 546 (Invitrogen, Carlsbad, CA) used at 1:2000. After final washes, cells were mounted in ProLong Antifade (Invitrogen). Images were obtained with an Axiocam on an Axioobserver microscope (Carl Zeiss, Jena, Germany) using a 100x Plan-Apochromat lens. All images were iteratively deconvolved using the Axiovision 4 software. Stable transfections and Western blotting protocols were identical to Simmen et al. (1999
, 2005)
. Transient transfection with siRNAs was identical to Simmen et al. (2005)
, and silenced cells were analyzed on the second day after knockdown, when knockdown of PACS-2 is maximal. Identification of PACS-2–depleted cells for immunofluorescence took advantage of scoring for the characteristic fragmentation of mitochondria.
We performed radial profiling and analysis of exposures using the ImageJ software (http://rsb.info.nih.gov/ij/) and its Interactive 3D Surface Plot plug-in. Briefly, immunofluorescence images used for this article were split into RGB and transformed into a 3D heat map as seen on Supplemental Figure S2A and processed equally. Equal exposure corresponds to equal color profiles. The radial decrease of the immunofluorescence signals for CNX and BAP31 was measured as the percentage of the distance from the maximum signal to the minimum signal on a straight line (n = 8 images).
Membrane Fractionation, Protein–Protein Binding, and Biotinylation Assays
The membranes that constitute the ER and the Golgi were fractionated on a continuous Optiprep gradient (Axis-Shield, Dundee, Scotland) using 25, 20, 15, 10, and 5% Optiprep. HeLa cells, treated as indicated, were harvested in homogenization buffer (0.25 M sucrose, 10 mM HEPES-NaOH, pH 7.4, 1 mM EDTA) and passed 15 times through a ball-bearing homogenizer (Isobiotec, Heidelberg, Germany) with 18-µm clearance. Cell debris and nuclei were pelleted by centrifugation at 1000 x g for 10 min. The postnuclear supernatant was overlayed onto the continuous gradient and centrifuged at 32,700 rpm for 3 h at 4°C. Six equal fractions were collected from the top of the gradient and precipitated with acetone. Fractions were probed on a Western blot for CNX, β-COP, surface biotinylated proteins, mitochondrial complex II, and ribophorin I.
Heavy and light membranes were separated as follows: The cells were homogenized as above, and the resulting cell lysates were centrifuged for 10 min at 800 x g to remove unbroken cells and nuclei. Postnuclear lysates were centrifuged for 10 min at 10,000 x g to yield heavy membrane fractions (HM). The supernatants were then centrifuged for 60 min at 100,000 x g to separate cytosolic fraction (Cyt.) and light membrane fractions (LM). The in vitro–binding assay and surface biotinylations were performed as previously described (Simmen et al., 2005
). We determined the amount of surface CNX by comparing 5% of the total lysates to 100% of the biotinylated samples (see inset Figure 3D). The integrity of the ER was assayed with anti-ribophorin I antibodies (Affinity BioReagents).
Coimmunoprecipitation
For the CNX/HA-PACS-2 coimmunoprecipitation, plasmid transfected HeLa cells were harvested in m-RIPA (1% NP40, 1% deoxycholine, 150 mM NaCl, 50 mM Tris, pH 8.0, Complete protease inhibitors; Roche, Basel, Switzerland). HA-tagged PACS-2 was immunoprecipitated with anti-HA mAb HA.11. All antibodies were precipitated with protein A Sepharose (GE Healthcare, Baie d'Urfé, QC, Canada). Western blots were probed with an anti-HA and anti-CNX antibody.
| RESULTS |
|---|
|
|
|---|
|
|
Taken together our results show that a portion of PACS-2 and CNX colocalized in the vicinity of mitochondria and that PACS-2/CNX interaction can be observed in vitro and in vivo.
PACS-2 Controls the Intracellular Localization of CNX
Given the involvement of PACS-2 in ER localization, we asked if the CNX-PACS-2 interaction targets CNX to the ER and whether PACS-2 affects preferentially its interactor CNX or the entire ER. Thus, we first reexamined the intracellular localization of CNX in HeLa cells by immunofluorescence. In control cells transfected with a scrambled siRNA oligo, CNX showed a typical ER staining pattern that partially overlapped with mitochondria as shown in Figure 1B (see green arrowheads in Figure 3, A and B). Next, we silenced the PACS-2 gene by 2-d transient siRNA transfection and tested if this condition resulted in an altered staining for CNX. As previously reported, PACS-2 knockdown resulted in the formation of fragmented, often ring-shaped mitochondria (Supplemental Figure S1A, inset of Figure 3F; Simmen et al., 2005
). Concomitant with the alteration of the mitochondrial structure, the overlap between CNX and mitochondria disappeared almost completely in the cell periphery (Figure 3, E and F). Interestingly, CNX appeared collapsed in a juxtanuclear pattern, where interaction with mitochondria could in principle still happen, as most mitochondria are found there.
|
Because PACS-2 knockdown could potentially affect other organelles aside from mitochondria and from ER-localized CNX, we also examined the influence of PACS-2 knockdown on the Golgi complex and found that it had no significant effect, as previously reported (Supplemental Figure S1B and Kottgen et al., 2005
). Moreover, depletion of more than 90% of PACS-2 did not cause toxicity, as assayed with active caspase-3, indicating that PACS-2 silenced cells are viable (Supplemental Figure S1C).
We next aimed to further characterize the CNX relocation upon PACS-2 knockdown. We asked whether the restriction of CNX to a juxtanuclear area originated from a reduction of CNX ER retention and a shift to downstream compartments such as the ER-Golgi intermediate compartment (ERGIC) or whether PACS-2 simply altered the intra-ER targeting of CNX. By answering this question we intended to elucidate the significance of PACS-2 for ER targeting and could provide evidence for the existence of a domain-specific ER targeting mechanism.
Our immunofluorescence approach could not unequivocally distinguish between these two possibilities and was unable to quantify the association of CNX with multiple membrane domains in the same cell. Therefore, we switched to biochemical analysis of the CNX/PACS-2 targeting mechanism that allowed us to quantify the amounts of CNX associated with various membranes of the secretory pathway simultaneously. We first examined whether CNX is enriched on any domain of the ER.
For this purpose, we developed a protocol that separates the ER from later secretory compartments and the rER from the MAM on a continuous Optiprep gradient. We fractionated HeLa cellular membranes on this gradient and found surface-biotinylated proteins in fractions 1 and 2 with a peak in fraction 1 (Figure 4A). β-COP, which cosediments with the Golgi complex peaked in fraction 2, whereas the ERGIC marker ERGIC53 peaked in fraction 3. A transmembrane rER marker, ribophorin I, peaked in fraction 4 (Figure 4A). The majority of mitochondrial complex II fractionated into the lowest two fractions of the gradient, as did the ubiquitous MAM marker acyl-CoA: cholesterol acyltransferase 1 (ACAT1, Rusinol et al., 1994
; Lee et al., 2000
). Using our gradient, we found that CNX sedimented into fractions 3–6, with the majority in fraction 6 under control conditions, thus significantly cofractionating with a MAM marker (Figure 4A). Our results show that PACS-2 knockdown decreased CNX in the MAM fractions from 66 to 42%, but increased its signal in fraction 4, which overlaps best with ribophorin I. The decrease on MAM fractions was statistically significant (p < 0.05 for both fractions). Overall, the amount of CNX associated with ER markers decreased from 83 to 69%. This decrease was compensated by a redistribution of CNX to fractions that are enriched for ERGIC53, β-COP, and surface biotinylated proteins (fractions 1–3). The patterns of PDI, ERGIC53, β-COP, and mitochondrial complex II were not altered by PACS-2 silencing (data not shown). Together with our immunofluorescence analysis (Figure 3), our results thus indicate that PACS-2 knockdown had two effects: First, it caused a reduction of CNX on the MAM, but an increase of CNX on the rER. Second, it caused increased recovery of CNX in ERGIC, Golgi and surface fractions, where the CNX signal roughly doubled.
|
) and MAM markers (ACAT1) fractionate mostly into the heavy membrane pellet, but show some signal in the light membrane pellet. Conversely, markers of the ERGIC and the Golgi (ERGIC-53 and β-COP) fractionate almost exclusively into the light membrane pellet. CNX showed a fractionation pattern that corresponded to rough ER and MAM markers.
Using this fractionation assay, we analyzed homogenates of control HeLa cells and HeLa cells depleted of PACS-1 or PACS-2, respectively. Our results show that PACS-2 knockdown causes a shift of
25% of the total CNX signal from heavy to light membranes and results in a 50:50 distribution between heavy and light membranes. However, even after PACS-2 knockdown, the CNX fractionation pattern did not resemble the one of a Golgi or ERGIC marker that fractionate mostly into light membranes. Instead, consistent with our Optiprep gradient, PACS-2 knockdown led to an even distribution between heavy and light membranes that is clearly distinct from the ERGIC and coatomer distribution patterns (Figure 4, B and C).
We next sought to confirm if depleting PACS-2 resulted in the appearance of some CNX on the plasma membrane, as suggested by our Optiprep gradient (Figure 4A). Therefore, we analyzed surface targeting of CNX after PACS-1 and PACS-2 siRNA transfection with a surface biotinylation protocol. Total CNX amounts on the surface were calculated using a 10% total lysate loading control and were determined to amount to
2% of total under steady-state conditions (inset, Figure 4D). Depleting PACS-2, but not PACS-1 led to a sixfold increase of surface CNX (Figure 4D). However, consistent with our fractionation and immunofluorescence results, the surface CNX in the PACS-2–depleted cells amounted to only 12% of total CNX. Together, these results demonstrate how altering PACS-2 expression levels could provide a mechanism for modulating CNX surface amounts.
To examine whether the observed shift to later compartments of the secretory pathway and the plasma membrane was restricted to the PACS-2 interactor CNX, we examined the targeting of three ER markers that overlap to various extents with CNX biochemically. Before PACS-2 knockdown, these marker proteins (BAP31, PDI, and Ribophorin I) showed a similar membrane distribution to CNX. However, none of these markers exhibited a significant shift to lighter membranes (<5% of the total protein for PDI and as little as 1% for Ribophorin I, Figure 4C). Actin, a cytosolic protein also remained unaffected in its membrane association and distribution (Figure 4C). Similar to PDI and as expected from Figure 3, BAP31 showed a minor shift with this fractionation protocol. We also examined surface targeting for BAP31. The BAP31 biotinylation signal was unaffected by either PACS-1 or PACS-2 knockdown (Figure 4D), thus confirming the unresponsiveness of BAP31 to PACS-2 knockdown seen in Figures 3 and 4C.
The fact that BAP31 did not redistribute upon PACS-2 knockdown was surprising, given the fact that this is a demonstrated interactor of CNX (Zuppini et al., 2002
). BAP31 is an apoptosis regulatory protein that gives rise to a caspase-generated fragment called BAP31p20 during apoptosis onset, which leads to mitochondria fragmentation (Breckenridge et al., 2003
). Full-length BAP31 has a KKEE C-terminal motif that is a COPI-binding consensus motif, whereas BAP31p20 lacks this motif. We thus next examined, whether contrary to full-length BAP31, BAP31p20 showed altered membrane distribution upon PACS-2 knockdown. As shown previously (Simmen et al., 2005
), PACS-2 knockdown caused caspase-mediated BAP31p20 formation under resting conditions (Figure 4E), but did not alter the localization of BAP31 significantly (Figure 3). We next examined whether BAP31p20, which lacks most of the cytosolic domain and the COPI motif, remains restricted to heavy membranes of the ER upon PACS-2 knockdown, as full-length BAP31 does. This was indeed the case, regardless of the presence or absence of the apoptosis-inducer thapsigargin (Figure 4E). Therefore, neither cleaved nor full-length BAP31 significantly relocalize after PACS-2 knockdown.
Mutation of the CNX CK2 Sites Modulates PACS-2 Interaction and Amounts on Heavy Membranes
CNX serine phosphorylation by CK2 abrogates efficient binding to PACS-2 (Figure 2B). We thus decided to further test if CNX intracellular targeting depends on PACS-2 with CNX phospho-defective and phospho-mimic mutants. We first assayed binding of these mutants to the thioredoxin-tagged cargo-binding domain of PACS-2 (TRX-PACS-2) and found that GST-CNX does not bind efficiently to the cargo-binding domain of PACS-2, when serines 554 and 564 are mutated to aspartic acids (SSDD, Figure 5A). Conversely, when these serines are mutated to alanines, the binding of the CNX cytosolic domain to PACS-2 was just slightly increased (SSAA in Supplemental Figure S3A and Figure 5A). From these results we would expect SSAA to efficiently reproduce PACS-2–dependent wild-type CNX targeting, whereas SSDD should show reduced retention in the ER and impaired targeting to the MAM.
|
We next wanted to determine whether the CNX-FLAG mutants can also reliably reproduce the overlap of endogenous CNX with mitochondria (Figures 1 and 3). For that purpose, we examined the extent of colocalization of their FLAG signal with mitochondria. We found that CNX-FLAG SSAA, like endogenous CNX, showed significant overlap with mitochondria. The localization of this mutant was very similar to endogenous CNX (Figure 5E, top row; compare to Figure 3A). As observed for wild-type endogenous CNX, we observed numerous areas of overlap between the FLAG, the PDI and mitochondrial staining (indicated by red arrowheads). In contrast, it was unclear whether the phospho-mimic CNX-FLAG SSDD mutant showed reduced overlap with mitochondria (Figure 5E, bottom row). Its reticular staining was evenly distributed throughout the cytosol. Interestingly, while giving a biochemical distribution that resembled wild-type CNX after PACS-2 knockdown, this phospho-mimic mutant did not reproduce the juxtanuclear staining pattern (Figure 3E). We address this discrepancy in the discussion.
PACS-2 Connects CNX to Coatomer
PACS proteins connect cytosolic acidic motifs of cargo proteins to sorting coats; for example, PACS-1 connects furin to AP-1, and PACS-2 connects polycystin-2 to coatomer (COPI; Crump et al., 2001
; Kottgen et al., 2005
). Together, PACS proteins form a characteristic ternary complex with their cargo proteins and coat complexes. We therefore tested whether CNX, PACS-2 and coatomer can also form such a ternary complex. We incubated COPI with thioredoxin-tagged PACS-2 or GST-tagged CNX, or the two together. Because GST-tagged CNX was able to capture four times more COPI in the presence of PACS-2, CNX, PACS-2 and COPI are indeed able to form a ternary complex (Figure 6A). We next wanted to compare the influence of COPI on intracellular routing of CNX and BAP31 to the one exerted by PACS-2. Similar to PACS-2 knockdown, COPI knockdown caused an increase of CNX on the cell surface, when cells were analyzed after 2 d of siRNA transfection. Interestingly and consistent with the presence of a COPI-binding motif on the C-terminus of BAP31, we also observed a minor increase of cell surface BAP31 (Figure 6B). However, COPI knockdown, but not PACS-2 knockdown caused some cell death that we detected with the appearance of active caspase-3 (Supplemental Figure S1B), thus potentially allowing some intracellular proteins to be biotinylated. We were able to confirm the COPI-dependent effects using the LDLf cell line, which degrades
-COP in a temperature-sensitive way (Guo et al., 1994
). When this mutant CHO cell line was shifted from 34 to 40°C for 6 h, we observed an increase of the cell surface amounts of both CNX and BAP31 (Figure 6C). Their amounts on the plasma membrane increased more in this experiment, likely due to incomplete knockdown of β-COP using siRNA (Figure 6B).
|
| DISCUSSION |
|---|
|
|
|---|
The knockdown of PACS-2 interferes with correct CNX targeting in multiple ways. First, it shifts CNX from peripheral ER tubules overlapping with mitochondria to a sharp juxtanuclear localization (Figure 3). This shift also corresponds to a reduction of overlap between CNX and mitochondria, as shown by immunofluorescence and fractionation (Figures 3 and 4A). Second, PACS-2 knockdown causes limited CNX redistribution from ER membrane fractions to membrane fractions enriched with markers of the ERGIC and Golgi complex, as suggested by our fractionation and differential centrifugation assays (Figures 4, A and C). Third, PACS-2 knockdown increases CNX levels on the cell surface as observed by a biotinylation assay and our Optiprep fractionation, although both methods show that the majority of CNX remains intracellular (Figure 4, A and D). Taken together, PACS-2 regulates the amounts of CNX on the MAM and on the rER. PACS-2 also retains CNX within the ER and prevents appearance of CNX in biochemical fractions that contain the ERGIC, the Golgi, and on the plasma membrane. The regulatable interaction between PACS-2 and CNX could therefore account for increased amounts of CNX on the plasma membrane of certain cell types (Wiest et al., 1995
).
Several models can explain our observations: PACS-2 could be directly regulating the amounts of CNX on the MAM (see also below for further discussion). In this case, the loss of intra-ER targeting would initially lead to a nonrestricted distribution within the ER, which could overwhelm the ER retention mechanism somewhat, leading to a relative enrichment at ER exit sites. Alternatively, PACS-2 could simply regulate CNX ER retention at or after ER exit sites. Loss of PACS-2 would then cause CNX to leak from the ER, which would eventually also cause a loss of MAM-localized CNX. In agreement with this model, PACS-2 also interacts with COPI, suggesting that COPI and PACS-2 cooperate to retain CNX within the ER. The mechanism that the two proteins utilize for this retention could very well be retrieval, as shown previously for COPI itself (Letourneur et al., 1994
). An unexplored possibility is that PACS-2 also interacts with other components of the ER sorting and trafficking machinery, such as COPII.
To shed some more light on the PACS-2 mediated trafficking of CNX, we examined CNX phosphomimic mutants. Whereas the constitutively PACS-2-binding SSAA mutant nicely reproduced the staining and membrane fractionation of wild-type CNX, the SSDD mutant showed reduced binding to PACS-2, but was not as mislocalized as might be expected. Our data shows that this mutant showed some leakage into Optiprep fractions that are enriched for markers of the cell surface and the ERGIC (Figure 5, B and D). This mutant also showed significantly reduced sedimentation into the very bottom fraction of the ER that contains the MAM marker ACAT1 (Figure 5C). When examined by immunofluorescence staining, this mutant did, however, not reproduce the sharp gradient around the nucleus that is seen with PACS-2 knockdown (compare Figure 3E with 5E). Several reasons can lead to this behavior: First, the SSDD mutant shows significantly reduced, but not abolished, binding to PACS-2 (Figure 5A). Second, phospho-mimic CNX is still able to interact with ribosomes, an interaction that leads to ER retention (Chevet et al., 1999
). Third, PACS-2 knockdown is expected to lead to reduced, but not abolished binding of CNX to COPI (Figure 6A), and could hence result in a partial rescue of retrieval by COPI.
Hence, it appears that although the phosphorylation by CK2 promotes CNX's association with ribosomes (Chevet et al., 1999
), its dephosphorylation promotes interaction of CNX with PACS-2 and targeting to heavy ER membranes, including the MAM, as shown here. Both studies together suggest an equilibrium of phosphorylated and nonphosphorylated CNX inside the ER that establishes wild-type CNX steady-state distribution between the rER and the MAM.
Both CNX and BAP31 show COPI dependence for their ER retention. Interestingly, neither the interference with COPI, nor the interference with PACS-2, nor the combination of the two (data not shown) leads to a complete release of either protein from the ER. These observations suggest that CNX is retained within the ER by multiple mechanisms. They also demonstrate that while PACS-2 contributes to CNX ER retention, PACS-2 is not the sole factor for CNX ER retention. What additional mechanisms could retain CNX in the ER? It is likely that the lumenal domain of CNX contributes to its intracellular retention. One possibility could be thiol-mediated retention, because CNX has two disulfide bonds: Cys161-Cys195 in its globular domain and Cys361-Cys367 in the arm (Schrag et al., 2001
; Anelli et al., 2003
). However, β-mercaptoethanol, typically used to release proteins retained in the ER by this mechanism has no effect on the amount of CNX on the cell surface (Supplemental Figure S3B). Another possible ER retention mechanism could be the association of CNX with newly synthesized proteins in the rough ER, also mediated by the CNX luminal domain. However, tunicamycin treatment for 10 h, which abolishes interaction of CNX with these substrates actually decreases the amount of CNX on the cell surface (Okazaki et al., 2000
). Together, this suggests that other, yet unknown mechanisms additionally retain CNX inside the ER.
Although the localization of CNX to the vicinity of ribosomes stems from its role in protein folding, it is less obvious why CNX might be found in the vicinity of mitochondria and on the MAM (Figures 1, 3, 4, and 5). Two functions of CNX have been reported that suggest an important role for this chaperone on the MAM. On the one hand, CNX acts as a chaperone for the IP3R that is found on the MAM (Joseph et al., 1999
). Furthermore, CNX interacts with the SERCA2b calcium pump that is also found on the MAM (Roderick et al., 2000
; Szabadkai et al., 2006
). This interaction regulates intracellular calcium oscillation, dependent on CNX phosphorylation. In principle, this finding could implicate the interaction of CNX with PACS-2 in this mechanism. However, serine 583 on CNX, which regulates the calcium oscillations, is distinct from the PACS-2-binding acidic cluster (Roderick et al., 2000
). Our results therefore rather suggest a role for PACS-2 in shuttling CNX between ER domains or in providing adequate ER retention that would result in the steady-state enrichment of CNX on the MAM (Figure 4A).
PACS-2 is found on or in the vicinity of mitochondria (Figure 1; Simmen et al., 2005
). PACS-2 not only influences the amounts of CNX on the MAM, but also of some lipid transfer proteins (Simmen et al., 2005
). Because the proteins in this latter group do not exhibit any obvious acidic cluster motifs, PACS-2 might influence the formation of and targeting to MAMs by localizing a "master" MAM protein. However, contradicting this idea are our findings that BAP31 does not leave the ER and maintains a heavy membrane association (Figures 3 and 4, C and D). Furthermore, even BAP31p20 that lacks a COPI binding motif remains associated with the MAM upon PACS-2 knockdown (Figure 4F). Together, our data suggest that PACS-2 influences targeting to MAMs in a more complex way than initially thought.
Clearly, however, our results demonstrate the specificity of PACS-2–mediated sorting of CNX along the secretory pathway, which depends on an acidic, phosphorylatable cluster. They also agree with recent studies that report a role of PACS-2 in the early endosome-to-TGN sorting of the CI-MPR and in the ability of HIV-1 Nef to down-regulate cell surface MHC I, because both depend on similar consensus sequences (Atkins et al., 2008
). Our findings are thus at odds with the data presented in Lubben et al. (2007)
, which led to the conclusion that PACS proteins are "... dispensable for the sorting of cargo proteins with acidic cluster motifs."
As with the binding of furin to PACS-1 and PACS-2, protein kinase CK2 regulates binding of CNX to PACS-2. When analyzing all known interactors of PACS proteins, PACS-2 appears to exhibit a preference, but not a requirement for dephosphorylated cargo proteins, as exemplified by Bid and CNX (this study and Simmen et al., 2005
). Interestingly, this characteristic of the PACS-2/cargo binding resembles the regulation of ER forward transport by 14-3-3 proteins, which is also regulated by the phosphorylation state of cargo proteins (Mrowiec and Schwappach, 2006
). PACS-2 and the 14-3-3 proteins have opposing roles for ER retention: whereas PACS-2 promotes ER retention by forming a ternary cargo/COPI complex, the 14-3-3 proteins compete with COPI for cargo binding and allow their exit from the ER upon interaction (O'Kelly et al., 2002
; Vivithanaporn et al., 2006
). It will be interesting to determine whether PACS-2 and 14-3-3 proteins interact functionally and/or physically to regulate ER retention, together with COPI. Also, it will be of interest to determine an involvement of 14-3-3 proteins in the intra-ER localization of CNX, besides the known involvement of COPI (Rajagopalan et al., 1994
).
One of our most intriguing findings concerns the cleavage of BAP31 upon PACS-2 knockdown. What could be the explanation for this phenomenon? Because zVAD-fmk inhibits this cleavage, caspases are presumably involved in the formation of BAP31p20 upon PACS-2 knockdown. Therefore, insufficient PACS-2 on the ER might trigger the activation of caspases. This effect could be originating from the observed ER stress upon PACS-2 knockdown (Simmen et al., 2005
) or from the missorting of CNX away from the ER (this study). However, because PACS-2 knockdown eventually blocks the onset of apoptosis and does not lead to the activation of downstream caspases, our results exclude the possibility that the knockdown of PACS-2 is simply toxic.
BAP31p20 has been proposed to have proapoptotic activity through activation of Drp-1, which causes the fragmentation of mitochondria. The consequence of the activation of Drp1 is so far unclear, as this may either promote or inhibit apoptosis induction (Breckenridge et al., 2003
; Szabadkai et al., 2004
). Our results now suggest that BAP31p20 formation is indeed not sufficient to trigger apoptosis, but that this molecule requires PACS-2 to do so. This contrasts with the localization of BAP31 and BAP31p20, which does not depend significantly on PACS-2.
Together, our results propose two distinct roles of PACS-2 for the correct functioning of the ER: on the one hand, it retains in collaboration with coatomer a subset of ER proteins with acidic cytosolic clusters on domains of the ER, including the MAM, but on the other hand, PACS-2 is also required for the induction of apoptosis. Whether this latter function is limited to the sorting of dephosphorylated Bid onto mitochondria, as shown previously (Simmen et al., 2005
) remains to be tested.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present addresses: ||Department of Biochemistry, University of Alberta, Edmonton, AB, T6G 2H7, Canada; ![]()
Department of Psychiatry and Biobehavioral Sciences, The David Geffen School of Medicine at UCLA, Los Angeles, CA 90095; ![]()
Department of Medicine, Division of Nephrology and Hypertension, Oregon Health and Science University, Portland, OR 97239. ![]()
Address correspondence to: Thomas Simmen (Thomas.Simmen{at}ualberta.ca)
Abbreviations used: BAP31, B-cell receptor associated protein of 31 kDa; CI-MPR, cation-independent mannose 6-phosphate receptor; CK2, protein kinase CK2; CNX, calnexin; COPI, coatomer; ER, endoplasmic reticulum; ERK, extracellular signal regulated kinase; MAM, mitochondria-associated membrane; PACS-2, phosphofurin acidic cluster sorting protein 2; PDI, protein disulfide isomerase; rER, rough endoplasmic reticulum
| REFERENCES |
|---|
|
|
|---|
Annaert, W. G., Becker, B., Kistner, U., Reth, M., and Jahn, R. (1997). Export of cellubrevin from the endoplasmic reticulum is controlled by BAP31. J. Cell Biol 139, 1397–1410.
Arap, M. A., Lahdenranta, J., Mintz, P. J., Hajitou, A., Sarkis, A. S., Arap, W., and Pasqualini, R. (2004). Cell surface expression of the stress response chaperone GRP78 enables tumor targeting by circulating ligands. Cancer Cell 6, 275–284.[CrossRef][Medline]
Atkins, K. M., Thomas, L., Youker, R. T., Harriff, M. J., Pissani, F., You, H., and Thomas, G. (2008). HIV-1 NEF binds PACS-2 to assemble a multi-kinase cascade that triggers MHC-I downregulation: analysis using siRNA and knockout mice. J. Biol. Chem 283, 11772–11784.
Borgese, N., Francolini, M., and Snapp, E. (2006). Endoplasmic reticulum architecture: structures in flux. Curr. Opin. Cell Biol 18, 358–364.[CrossRef][Medline]
Breckenridge, D. G., Stojanovic, M., Marcellus, R. C., and Shore, G. C. (2003). Caspase cleavage product of BAP31 induces mitochondrial fission through endoplasmic reticulum calcium signals, enhancing cytochrome c release to the cytosol. J. Cell Biol 160, 1115–1127.
Chen, W., and Helenius, A. (2000). Role of ribosome and translocon complex during folding of influenza hemagglutinin in the endoplasmic reticulum of living cells. Mol. Biol. Cell 11, 765–772.
Chevet, E., Wong, H. N., Gerber, D., Cochet, C., Fazel, A., Cameron, P. H., Gushue, J. N., Thomas, D. Y., and Bergeron, J. J. (1999). Phosphorylation by CK2 and MAPK enhances calnexin association with ribosomes. EMBO J 18, 3655–3666.[CrossRef][Medline]
Crump, C. M., Xiang, Y., Thomas, L., Gu, F., Austin, C., Tooze, S. A., and Thomas, G. (2001). PACS-1 binding to adaptors is required for acidic cluster motif-mediated protein traffic. EMBO J 20, 2191–2201.[CrossRef][Medline]
Duden, R. (2003). ER-to-Golgi transport: COP I and COP II function (Review). Mol. Membr. Biol 20, 197–207.[CrossRef][Medline]
Feliciangeli, S. F., Thomas, L., Scott, G. K., Subbian, E., Hung, C. H., Molloy, S. S., Jean, F., Shinde, U., and Thomas, G. (2006). Identification of a pH sensor in the furin propeptide that regulates enzyme activation. J. Biol. Chem 281, 16108–16116.
Frenkel, Z., Shenkman, M., Kondratyev, M., and Lederkremer, G. Z. (2004). Separate roles and different routing of calnexin and ERp57 in endoplasmic reticulum quality control revealed by interactions with asialoglycoprotein receptor chains. Mol. Biol. Cell 15, 2133–2142.
Gagnon, E., Duclos, S., Rondeau, C., Chevet, E., Cameron, P. H., Steele-Mortimer, O., Paiement, J., Bergeron, J. J., and Desjardins, M. (2002). Endoplasmic reticulum-mediated phagocytosis is a mechanism of entry into macrophages. Cell 110, 119–131.[CrossRef][Medline]
Goetz, J. G., Genty, H., St-Pierre, P., Dang, T., Joshi, B., Sauve, R., Vogl, W., and Nabi, I. R. (2007). Reversible interactions between smooth domains of the endoplasmic reticulum and mitochondria are regulated by physiological cytosolic Ca2+ levels. J. Cell Sci 120, 3553–3564.
Groenendyk, J., Zuppini, A., Shore, G., Opas, M., Bleackley, R. C., and Michalak, M. (2006). Caspase 12 in calnexin-deficient cells. Biochemistry 45, 13219–13226.[CrossRef][Medline]
Guo, Q., Vasile, E., and Krieger, M. (1994). Disruptions in Golgi structure and membrane traffic in a conditional lethal mammalian cell mutant are corrected by epsilon-COP. J. Cell Biol 125, 1213–1224.
Hayashi, T., and Su, T. P. (2007). Sigma-1 receptor chaperones at the ER-mitochondrion interface regulate Ca(2+) signaling and cell survival. Cell 131, 596–610.[Medline]
Higo, T., Hattori, M., Nakamura, T., Natsume, T., Michikawa, T., and Mikoshiba, K. (2005). Subtype-specific and ER lumenal environment-dependent regulation of inositol 1,4,5-trisphosphate receptor type 1 by ERp44. Cell 120, 85–98.[CrossRef][Medline]
John, L. M., Lechleiter, J. D., and Camacho, P. (1998). Differential modulation of SERCA2 isoforms by calreticulin. J. Cell Biol 142, 963–973.
Joseph, S. K., Boehning, D., Bokkala, S., Watkins, R., and Widjaja, J. (1999). Biosynthesis of inositol trisphosphate receptors: selective association with the molecular chaperone calnexin. Biochem. J 342, (Pt 1), 153–161.[CrossRef][Medline]
Kamhi-Nesher, S., Shenkman, M., Tolchinsky, S., Fromm, S. V., Ehrlich, R., and Lederkremer, G. Z. (2001). A novel quality control compartment derived from the endoplasmic reticulum. Mol. Biol. Cell 12, 1711–1723.
Kottgen, M. et al. (2005). Trafficking of TRPP2 by PACS proteins represents a novel mechanism of ion channel regulation. EMBO J 24, 705–716.[CrossRef][Medline]
Lee, R. G., Willingham, M. C., Davis, M. A., Skinner, K. A., and Rudel, L. L. (2000). Differential expression of ACAT1 and ACAT2 among cells within liver, intestine, kidney, and adrenal of nonhuman primates. J. Lipid Res 41, 1991–2001.
Letourneur, F., Gaynor, E. C., Hennecke, S., Demolliere, C., Duden, R., Emr, S. D., Riezman, H., and Cosson, P. (1994). Coatomer is essential for retrieval of dilysine-tagged proteins to the endoplasmic reticulum. Cell 79, 1199–1207.[CrossRef][Medline]
Levine, T., and Loewen, C. (2006). Inter-organelle membrane contact sites: through a glass, darkly. Curr. Opin. Cell Biol 18, 371–378.[CrossRef][Medline]
Lubben, N. B., Sahlender, D. A., Motley, A. M., Lehner, P. J., Benaroch, P., and Robinson, M. S. (2007). HIV-1 Nef-induced down-regulation of MHC class I requires AP-1 and clathrin but not PACS-1, and is impeded by AP-2. Mol. Biol. Cell 18, 3351–3365.
Mezghrani, A., Courageot, J., Mani, J. C., Pugniere, M., Bastiani, P., and Miquelis, R. (2000). Protein-disulfide isomerase (PDI) in FRTL5 cells. pH-dependent thyroglobulin/PDI interactions determine a novel PDI function in the post-endoplasmic reticulum of thyrocytes. J. Biol. Chem 275, 1920–1929.
Michelsen, K., Yuan, H., and Schwappach, B. (2005). Hide and run. EMBO Rep 6, 717–722.[CrossRef][Medline]
Misra, U. K., Deedwania, R., and Pizzo, S. V. (2006). Activation and cross-talk between Akt, NF-kappaB, and unfolded protein response signaling in 1-LN prostate cancer cells consequent to ligation of cell surface-associated GRP78. J. Biol. Chem 281, 13694–13707.
Mrowiec, T., and Schwappach, B. (2006). 14-3-3 proteins in membrane protein transport. Biol. Chem 387, 1227–1236.[CrossRef][Medline]
O'Kelly, I., Butler, M. H., Zilberberg, N., and Goldstein, S. A. (2002). Forward transport. 14-3-3 binding overcomes retention in endoplasmic reticulum by dibasic signals. Cell 111, 577–588.[CrossRef][Medline]
Okazaki, Y., Ohno, H., Takase, K., Ochiai, T., and Saito, T. (2000). Cell surface expression of calnexin, a molecular chaperone in the endoplasmic reticulum. J. Biol. Chem 275, 35751–35758.
Rajagopalan, S., Xu, Y., and Brenner, M. B. (1994). Retention of unassembled components of integral membrane proteins by calnexin. Science 263, 387–390.
Rizzuto, R., Pinton, P., Carrington, W., Fay, F. S., Fogarty, K. E., Lifshitz, L. M., Tuft, R. A., and Pozzan, T. (1998). Close contacts with the endoplasmic reticulum as determinants of mitochondrial Ca2+ responses. Science 280, 1763–1766.
Roderick, H. L., Lechleiter, J. D., and Camacho, P. (2000). Cytosolic phosphorylation of calnexin controls intracellular Ca(2+) oscillations via an interaction with SERCA2b. J. Cell Biol 149, 1235–1248.
Rusinol, A. E., Cui, Z., Chen, M. H., and Vance, J. E. (1994). A unique mitochondria-associated membrane fraction from rat liver has a high capacity for lipid synthesis and contains pre-Golgi secretory proteins including nascent lipoproteins. J. Biol. Chem 269, 27494–27502.
Schermer, B. et al. (2005). Phosphorylation by casein kinase 2 induces PACS-1 binding of nephrocystin and targeting to cilia. EMBO J 24, 4415–4424.[CrossRef][Medline]
Schrag, J. D., Bergeron, J. J., Li, Y., Borisova, S., Hahn, M., Thomas, D. Y., and Cygler, M. (2001). The structure of calnexin, an ER chaperone involved in quality control of protein folding. Mol. Cell 8, 633–644.[CrossRef][Medline]
Scott, G. K., Fei, H., Thomas, L., Medigeshi, G. R., and Thomas, G. (2006). A PACS-1, GGA3 and CK2 complex regulates CI-MPR trafficking. EMBO J 25, 4423–4435.[CrossRef][Medline]
Simmen, T. et al. (2005). PACS-2 controls endoplasmic reticulum-mitochondria communication and Bid-mediated apoptosis. EMBO J 24, 717–729.[CrossRef][Medline]
Simmen, T., Nobile, M., Bonifacino, J. S., and Hunziker, W. (1999). Basolateral sorting of furin in MDCK cells requires a phenylalanine-isoleucine motif together with an acidic amino acid cluster. Mol. Cell Biol 19, 3136–3144.
Spiliotis, E. T., Manley, H., Osorio, M., Zuniga, M. C., and Edidin, M. (2000). Selective export of MHC class I molecules from the ER after their dissociation from TAP. Immunity 13, 841–851.[CrossRef][Medline]
Szabadkai, G., Bianchi, K., Varnai, P., De Stefani, D., Wieckowski, M. R., Cavagna, D., Nagy, A. I., Balla, T., and Rizzuto, R. (2006). Chaperone-mediated coupling of endoplasmic reticulum and mitochondrial Ca2+ channels. J. Cell Biol 175, 901–911.
Szabadkai, G., Simoni, A. M., Chami, M., Wieckowski, M. R., Youle, R. J., and Rizzuto, R. (2004). Drp-1-dependent division of the mitochondrial network blocks intraorganellar Ca2+ waves and protects against Ca2+-mediated apoptosis. Mol. Cell 16, 59–68.[CrossRef][Medline]
Teasdale, R. D., and Jackson, M. R. (1996). Signal-mediated sorting of membrane proteins between the endoplasmic reticulum and the golgi apparatus. Annu. Rev. Cell Dev. Biol 12, 27–54.[CrossRef][Medline]
Vance, J. E. (1990). Phospholipid synthesis in a membrane fraction associated with mitochondria. J. Biol. Chem 265, 7248–7256.
Vivithanaporn, P., Yan, S., and Swanson, G. T. (2006). Intracellular trafficking of KA2 kainate receptors mediated by interactions with coatomer protein complex I (COPI) and 14-3-3 chaperone systems. J. Biol. Chem 281, 15475–15484.
Wakana, Y., Takai, S., Nakajima, K. I., Tani, K., Yamamoto, A., Watson, P., Stephens, D. J., Hauri, H. P., and Tagaya, M. (2008). Bap31 is an itinerant protein that moves between the peripheral ER and a juxtanuclear compartment related to ER-associated degradation. Mol. Biol. Cell 19, 1825–1836.
Wan, L., Molloy, S. S., Thomas, L., Liu, G., Xiang, Y., Rybak, S. L., and Thomas, G. (1998). PACS-1 defines a novel gene family of cytosolic sorting proteins required for trans-Golgi network localization. Cell 94, 205–216.[CrossRef][Medline]
Wiest, D. L., Burgess, W. H., McKean, D., Kearse, K. P., and Singer, A. (1995). The molecular chaperone calnexin is expressed on the surface of immature thymocytes in association with clonotype-independent CD3 complexes. EMBO J 14, 3425–3433.[Medline]
Wong, H. N., Ward, M. A., Bell, A. W., Chevet, E., Bains, S., Blackstock, W. P., Solari, R., Thomas, D. Y., and Bergeron, J. J. (1998). Conserved in vivo phosphorylation of calnexin at casein kinase II sites as well as a protein kinase C/proline-directed kinase site. J. Biol. Chem 273, 17227–17235.
Zen, K., Utech, M., Liu, Y., Soto, I., Nusrat, A., and Parkos, C. A. (2004). Association of BAP31 with CD11b/CD18. Potential role in intracellular trafficking of CD11b/CD18 in neutrophils. J. Biol. Chem 279, 44924–44930.
Zuppini, A., Groenendyk, J., Cormack, L. A., Shore, G., Opas, M., Bleackley, R. C., and Michalak, M. (2002). Calnexin deficiency and endoplasmic reticulum stress-induced apoptosis. Biochemistry 41, 2850–2858.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
S. J. Stone, M. C. Levin, P. Zhou, J. Han, T. C. Walther, and R. V. Farese Jr. The Endoplasmic Reticulum Enzyme DGAT2 Is Found in Mitochondria-associated Membranes and Has a Mitochondrial Targeting Signal That Promotes Its Association with Mitochondria J. Biol. Chem., February 20, 2009; 284(8): 5352 - 5361. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||