|
|
|
|
Vol. 19, Issue 8, 3192-3202, August 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Physiology, McGill University, Montréal, Québec H3G 1Y6, Canada
Submitted February 15, 2008;
Revised April 29, 2008;
Accepted May 19, 2008
Monitoring Editor: Kunxin Luo
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
B (NF-
B), c-Jun NH2-terminal kinase, and the canonical caspase cascade leading to apoptosis (Aggarwal, 2003
Molecular mechanisms of Fas-induced apoptosis are well defined (for review, see Peter and Krammer, 2003
). The cytoplasmic adaptor protein Fas-associated death domain (FADD) associates with the death domain of Fas, followed by recruitment and activation of caspases-8 and/or -10. Together, Fas, FADD and caspase-8/10 form the death-inducing signaling complex that triggers apoptosis. In contrast, the upstream molecular events regulating Fas-mediated neurite growth are unknown. The p42/44 extracellular signal-regulated kinase (ERK) cascade, an MAPK pathway, has been implicated in Fas-mediated neuritogenesis in sensory neurons (Desbarats et al., 2003
), but it is not required for Fas-induced neurite branching in hippocampal neurons (Zuliani et al., 2006
). The domain(s) of Fas and the Fas-interacting molecule(s) controlling neurite growth and branching have not previously been identified.
Here, we show that Fas directly regulates morphology, in the absence of apoptosis, in cell lines and in primary cortical neurons from embryonic mice. We demonstrate for the first time that Fas activates the small GTPase Rac1. We define a novel membrane-proximal domain (MPD) of Fas that recruits ezrin; is essential for Fas-induced Rac1 activation and process growth; and is distinct from the death domain. This newly defined MPD is shared with other members of the TNFR superfamily, including the low-affinity p75 nerve growth factor receptor (NGFR) and TNFR2. Our findings elucidate the membrane-proximal molecular mediators of Fas-induced process growth in developing neurons, thereby defining a new nonapoptotic pathway through which members of the TNFR superfamily can regulate process growth and branching.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Constructs
We amplified the full-length and death-domain deleted (
DD) human Fas sequences by polymerase chain reaction (PCR) amplification of Invitrogen cDNA clone ID 4514272 (accession no. BC012479) encoding human Fas isoform 1 (5' primer, GGAAGCGAATTCACTTCG; 3' primer for full length, GTTTTTCGAATTCGACCAAGCTTTGG; 3' primer for
DD, GGTGATATAGAATTCCAAGTC). We cloned the amplified sequences into the EcoR1 site of the pCMV-Tag4A vector (Stratagene, La Jolla, CA), to generate Fas-C'-terminal-FLAG–tagged proteins (Fas-FLAG and
DD-Fas-FLAG). We produced the Fas
191-204 construct by PCR amplification of pCMV-Fas (5' primer, CAATTCCACTAATTGTTTGGGTGGAAAACCAAGGTTCTCATGAATC; 3' primer, GATTCATGAGAACCTTGGTTTTCCACCCAAACAATTAGTGGAATTG). In all experiments, we used the pCMV-Tag4-luciferase control expression vector encoding luciferase-FLAG (Stratagene) as a transfection control.
Cell Death Assays
We plated 5 x 103 HEP1-6 or COS-7 cells or 104 Jurkat cells per well, in 96-well plates. HEP1-6 and COS-7 cells were transfected with 0.2 µg of Fas-FLAG or luc-FLAG control plasmids in 0.5 µl of Lipofectamine 2000. Twenty-four hours after transfection, we changed the media and added 50 ng/ml agonistic anti-human Fas antibody CH11 where indicated. Jurkat cells were not transfected and were treated with CH11 at the concentrations indicated. In Figure 8, Jurkat cells were pretreated for 30 min with SERLI or IETD (200 µM) before stimulation with CH11. After an additional 24-h incubation, we determined cell viability by the colorimetric 4-[3-(4-iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]-1,3-benzene disulfonate assay (Roche Diagnostics, Indianapolis, IN) according to the manufacturer's instructions. Jurkat cells were used as a positive control for CH11-mediated apoptosis in assays using HEP 1-6 or COS-7 cells, and in some experiments, agonistic anti-mouse Fas antibody (clone Jo2; 5 µg/ml) was included as a positive control for maximal killing through endogenous Fas.
GTPase Activation Assays
We used the Cdc42/Rac1-interactive binding (CRIB) domain of human p21 activated kinase 1 protein 1B (PAK1B) as a specific probe for activated Rac1 and Cdc42 and the Rho binding domain (RBD) of Rho-associated kinase (ROCK) as a specific probe for activated RhoA, in glutathione transferase (GST) pull-down assays (Manser et al., 1994
). We cotransfected COS-7 cells with Fas-FLAG or control luciferase (luc)-FLAG, and with myc-tagged Rac1, Cdc42, or RhoA, kindly provided by Dr. N. Lamarche-Vane (McGill University, Montreal, Canada). For detection of endogenous Rac1 activation, we transfected cells only with Fas-FLAG or control luc-FLAG vectors. We lysed the cells in GTPase assay buffer (25 mM HEPES, pH 7.5, 1% NP-40, 10 mM MgCl2, 100 mM NaCl, 5% glycerol, 1 mM phenylmethylsulfonyl fluoride [PMSF], 5 mM NaF, 5 mM sodium orthovanadate, and 1 µg/ml each aprotinin and leupeptin) 20 h after transfection, and incubated the cleared lysate with glutathione-Sepharose 4B beads (GE Healthcare, Little Chalfont, Buckinghamshire, United Kingdom) coupled to GST-CRIB or GST-RBD for 1 h at 4°C. We washed the beads four times, boiled them in 2x SDS sample buffer, and then subjected the eluted proteins to electrophoresis on 12% polyacrylamide gels. We transferred the proteins to nitrocellulose membranes and blotted them with anti-myc antibodies (Santa Cruz Biotechnology, Santa Cruz, CA) to detect transfected GTPases, or anti-Rac1 (Millipore, Billerica, MA) for endogenous Rac1. We quantified the ratio of activated GTPase (in the pull-down) to total GTPase (in the lysate) by densitometry, and calculated Fas-induced GTPase activity as follows: (activated/total GTPase in Fas-transfected cells)/(activated/total GTPase in luciferase-transfected cells).
Immunoblotting and Coimmunoprecipitation (coIP)
We lysed COS-7 cells grown to 90% confluence in 10-cm plates then transiently transfected with luc-FLAG or Fas-FLAG in 1.5 ml of modified radioimmunoprecipitation assay lysis buffer (50 mM Tris-HCl, pH 7.4; 1% NP-40; 0.25% sodium deoxycholate; 150 mM NaCl; 1 mM EDTA; 1 mM PMSF; 1 µg/ml each aprotinin, leupeptin, pepstatin; 1 mM NaF; and 1 mM sodium orthovanadate). We centrifuged and precleared the lysates, and then we immunoprecipitated precleared lysates with 4 µg/ml antibody (anti-FLAG M2 [Sigma-Aldrich], anti-ezrin clone 3C12 [Sigma-Aldrich], or mouse immunoglobulin G [IgG]1 isotype control [Santa Cruz Biotechnology]) for 2 h followed by a 1-h incubation with protein G beads at 4°C. We washed the beads four times, boiled them in 2x SDS sample buffer, and then subjected the proteins to electrophoresis on 10% polyacrylamide gels. We transferred the proteins to nitrocellulose membranes and blotted them with anti-FLAG polyclonal antibodies (Sigma-Aldrich) or ezrin antibodies (clone 3C12; Sigma-Aldrich), followed by secondary horseradish peroxidase-conjugated antibodies (Bio-Rad, Hercules, CA), and developed the bands with ECL kit reagents (GE Healthcare).
GST-Fusion Proteins and Binding Assays
We designed a series of GST-Fas constructs composed of the transmembrane and cytoplasmic regions of Fas, either full length or with the deletions described above (
DD and
191-204). We excised appropriate Fas fragments from the respective Fas-pCMV-Tag4A constructs using BamHI (restriction site 10 amino acids extracellular to the transmembrane domain) and EcoR1, ligated the fragments into pGEX4T-1 (Clonetech, Mountain View, CA), and expressed the fusion proteins in DH5
induced with 0.5 mM isopropyl-β-D-thiogalactopyranoside at 30°C for 1 h. We purified the GST-fusion proteins according to the protocol provided by GE Healthcare. We prepared lysates from COS-7 cells (4 x 106) in lysis buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 5 mM MgCl2, 1% Triton X-100, 1 mM dithiothreitol, 1 mM PMSF, 1 mM sodium orthovanadate, and Complete protease inhibitor tablets) and precleared the lysates with glutathione-Sepharose 4B beads (GE Healthcare). We incubated 10 µg of GST-fusion protein bound to glutathione-Sepharose beads with equal volume of COS-7 cell lysate for 1 h at 4°C. Where indicated, we added the inhibitory peptide SERLI at 50–200 µM. We washed the beads four times, boiled them in 2x SDS sample buffer, and immunoblotted the resulting proteins for ezrin as described above. Immunoblots were stripped and reprobed for GST.
Primary E15 Cortical Neurons
We obtained embryonic day E15 embryos from timed pregnancies of C57BL/6 mice bred in our animal facility. We removed the frontal cortices, minced the tissue, and dissociated the cells by sequential trituration in 0.25% trypsin/0.2% DNAse in S-MEM and then in Neurobasal medium/10% FCS. We plated the cells onto PDL-coated 16-well chamber slides (6 x 104 cells/well) or PDL-coated glass coverslips in 24-well plates (3 x 105 cells/well) in Neurobasal medium supplemented with N2 and B27 (Invitrogen), and we maintained the cultures in 5% CO2 at 37°C. Where indicated, we transfected the cells with the full-length human Fas coding sequence or the luciferase control vector (0.8 µg of DNA) with 0.5 µl of Lipofectamine 2000 in Opti-MEM. Transfections were performed after 1 d in vitro.
Inhibitors and Antibody Treatments
Six hours after transfection, we changed the media and added agonistic anti-human Fas antibody CH11 (50 ng/ml; Millipore). For untransfected mouse cells, we added agonistic anti-mouse Fas antibody Jo2 (2 µg/ml; BD Biosciences, San Jose, CA) to stimulate endogenous Fas. Inhibitors of mitogen-activated protein kinase kinase (MEK)/ERK (PD98059, 30 µM; Calbiochem, San Diego, CA), of Fas/ezrin interaction (SERLI peptide, 200 µM; GenScript, Piscataway, NJ), or dimethyl sulfoxide vehicle control, were added with the antibodies where indicated. Cells were cultured with the antibodies and/or inhibitors for a further 18 h before fixation. For SH-SY5Y cells analyzed in Figure 8, cells were transfected in six-well plates and then replated onto coverslips 16–20 h after transfection in media already containing SERLI peptide (200 µM) and/or CH11 (50 ng/ml). Fresh inhibitor was added after 6 h, and cells were incubated for a total of 10 h with the inhibitor and/or CH11 before fixation.
Immunofluorescence and Confocal Microscopy
We fixed cells with 4% paraformaldehyde in phosphate-buffered saline (PBS) 18 h after transfection and then permeabilized the cells in 0.25% Triton X-100, blocked them in 10% normal goat serum, and incubated them with anti-FLAG polyclonal antibodies (Sigma-Aldrich) followed by anti-rabbit-Alexa 488 secondary antibodies (Invitrogen), anti-ezrin antibodies (3C12) followed by Cy3-conjugated secondary antibodies (Jackson ImmunoResearch Laboratories, West Grove, PA), and phalloidin conjugated with Texas Red or Alexa Fluor 647 (Invitrogen) to detect F-actin. We counterstained the nuclei with 4,6-diamidino-2-phenylindole and mounted the slides in Aqua-Poly/Mount (Polysciences, Warrington, PA). Images for analysis of process outgrowth were acquired on a fluorescence microscope (DM IRE2; Leica, Wetzlar, Germany) at 40x magnification by using MetaMorph software (Molecular Devices, Sunnyvale, CA). Images for colocalization were obtained by laser-scanning microscopy (LSM3 PASCAL; Carl Zeiss, Jena, Germany) using LSM 3 PASCAL software version 3.2 for acquisition and image analysis.
Process Outgrowth and Morphometric Analysis
We quantified process growth in transfected cells using phalloidin labeling to define processes on cells staining positive for FLAG, to provide an unbiased comparison between Fas-FLAG and control luc-FLAG-transfected cells. We traced and quantified all actin-positive processes on transfected cells by using MetaMorph software. We defined neurites or primary processes as any processes emerging from the cell body, and branches as any processes emerging from a neurite primary process. For multiple branches, the primary process was defined as the longest continuous path emerging from the cell body. We controlled for general neurotrophic or inhibitory effects of Fas, Fas agonists, and pharmacologic inhibitors by determining cell body area, and we found no significant differences for any treatment.
Statistical Analyses
We compared Fas-transfected and control-transfected or treated and untreated cells using two-tailed unpaired Student's t test for parametric data and Mann–Whitney tests for nonparametric data, and the effect of a series of treatments by one-way analysis of variance. Statistical analyses were performed using Instat GraphPad software (GraphPad Software, San Diego, CA). All figures show mean ± SE.
| RESULTS |
|---|
|
|
|---|
|
We have previously found that the ERK pathway is involved in Fas-mediated neurite growth (Desbarats et al., 2003
). We inhibited ERK activation using the pharmacological MEK inhibitor PD98059. Inhibition of the ERK pathway did not change the frequency of COS-7 cells extending processes in response to Fas expression (Figure 1E). However, PD98059 prevented ligand-dependent morphological changes induced by Fas ligation in SH-SY5Y cells (Figure 1C). These data suggested that new processes arising from Fas expression alone, without receptor activation, did not require ERK activation. In contrast, ligand-dependent fine-tuning of process morphology required MEK/ERK function (Figure 1, C and E).
These results showed that Fas could initiate the growth of new processes through an ERK-independent pathway. We next sought to determine the mechanism underlying Fas-induced process growth.
Fas-induced Process Outgrowth Does Not Require the Fas Death Domain
The death domain of Fas is essential for recruitment of FADD and subsequent activation of the proapoptotic caspase cascade (Peter and Krammer, 2003
; Zuliani et al., 2006
). The death domain consists of six antiparallel
-helices. Amino acids 234, 238, 240, and 244, located in helices 2 and 3, are contact residues required for FADD binding (Huang et al., 1996
). We produced a truncated FLAG-tagged Fas construct missing helices 2–6 of the death domain. This construct,
DD-Fas, consists of residues 1-229 of wild-type human Fas and is lacking all FADD binding residues. We found that
DD-Fas was able to induce process growth in COS-7 cells as efficiently as wild-type Fas: 23 ± 1.4% of cells transfected with Fas-FLAG grew processes, compared with 23 ± 0.8% of cells transfected with
DD-Fas-FLAG. These results demonstrate that the death domain is not required for Fas to initiate process growth (Figure 2A).
|
DD-Fas-FLAG into Fas apoptosis-sensitive HEP1-6 mouse hepatocyte cells. Mouse HEP1-6 cells transfected with human Fas-FLAG underwent significant cell death in response to agonistic anti-human Fas antibodies (clone CH11, as used to induce process growth described above), whereas hepatocytes transfected with
DD-Fas-FLAG remained viable (Figure 2B). COS-7 cells were not susceptible to Fas-induced death (Figure 2B). We have shown previously that Fas-positive SH-SY5Y cells are resistant to Fas-induced apoptosis, as are many types of primary neurons (Raoul et al., 2002
DD-Fas-FLAG has lost its proapoptotic function. In contrast, both constructs stimulated process growth in cells resistant to Fas-induced apoptosis. Interestingly, apoptosis induced by Fas-FLAG was ligand dependent (Figure 2B), whereas process growth initiated by Fas expression did not require ligand (Figure 1), further suggesting that these two Fas functions are autonomous and mediated through different mechanisms.
Fas Expression Induces Rac1 Activation
Fas can initiate process growth without using its death domain and without activating ERK. In searching for an alternative molecular mechanism, we reasoned that process growth must involve cytoskeletal rearrangement (Meyer and Feldman, 2002
), and it was therefore likely to involve members of the Rho GTPase family, which are essential for process extension and cell motility. These small GTPases consists of the RhoA, Rac1, and Cdc42 families, with RhoA principally responsible for stress fibers formation and cytokinesis, whereas Rac1 and Cdc42 tend to regulate neurite growth (Nikolic, 2002
). We asked whether Fas expression in COS-7 cells would activate RhoA, Rac1, or Cdc42 (Figure 3). We used the CRIB domain of human PAK1B as a specific probe for activated Rac1 and Cdc42 in a GST pull-down assay (Manser et al., 1994
). This assay specifically detects the activated (GTP-bound forms) of Rac1 and Cdc42. In parallel, we used GST fused to the RBD of ROCK as a probe for activated RhoA. We cotransfected COS-7 cells with luciferase control or Fas, and with myc-tagged Cdc42, Rac1, or RhoA. We found that Fas expression specifically increased the activation of transfected Rac1, but it did not alter the amounts of activated Cdc42 and RhoA in the cell (Figure 3A). To determine whether Fas expression could also activate endogenous Rac1, we transfected COS-7 cells with luciferase control or Fas and then measured endogenous Rac1 activation using GST-CRIB assays. We found that Fas expression induced activation of endogenous Rac1 (Figure 3, B and C). These findings demonstrate a new functional interaction between Fas and Rac1 that may facilitate actin cytoskeletal remodeling.
|
|
A Novel Domain of Fas Controls Interaction with ezrin and Is Required for Fas-induced Process Growth
We investigated whether the Fas-ezrin interaction was required for Fas-induced process formation. Ezrin tends to associate with juxtamembrane clusters of basic amino acids (Bretscher, 1999
; Tsukita and Yonemura, 1999
). The 14 amino acid stretch cytoplasmic to the transmembrane domain of Fas contains a large number of basic residues, KRK (191-193) and RKHRK (200–204), defining a putative ezrin binding region that we have called the Fas MPD. We produced a construct containing a deletion of this region (
191-204Fas) (Figure 5A). To determine whether Fas-induced process growth correlated with Fas binding to ezrin, we produced GST fusion proteins of the intracellular domains of full-length Fas (ICD-Fas), ICD-
DDFas, and ICD-
191-204Fas, and examined their ability to bind ezrin. We found that the intracellular domains of full-length Fas and of
DD-Fas associated with ezrin from COS-7 lysates in a GST pull-down assay (Figure 5B). However, the deletion of residues 191-204 abolished the interaction with ezrin (Figure 5B), indicating that Fas 191-204 is essential for association with ezrin. We transfected
191-204Fas-FLAG into COS-7 cells in parallel with Fas-FLAG and
DD-Fas-FLAG, and found that
191-204Fas-FLAG was unable to induce process growth (Figure 5, C and D), demonstrating that residues 191-204 of Fas are essential for Fas-induced process growth in these cells. As a control, we also produced a Fas construct lacking the entire intracellular domain (
ICD-Fas). This construct was poorly expressed and did not induce process growth (Figure 5C).
|
191-204-Fas-FLAG did not induce significant apoptosis in HEP1-6 mouse hepatocyte cells, unlike wild-type Fas-FLAG, that mediated significant cell death in response to agonistic anti-human Fas antibodies (clone CH11) (Figure 5E). This result is consistent with previous findings implicating ezrin and Rac in Fas-mediated apoptosis (Luciani et al., 2004Our data define a new domain of Fas, the Fas MPD, and they show that the Fas MPD, but not the death domain, is required for Fas-induced process outgrowth.
The Fas MPD Is Required for Fas-induced Rac1 Activation
To examine the mechanistic link between recruitment of ezrin and Rac1 activation, we examined whether the Fas MPD was necessary for Fas-induced Rac1 activation. We transfected COS-7 cells with full-length Fas-FLAG,
DD-Fas-FLAG, or
191-204Fas-FLAG. We found that full-length Fas and
DD-Fas induced activation of cotransfected myc-tagged Rac1, but that
191-204Fas, which lacks the MPD, did not activate Rac1 (Figure 6, A and B). These data show that Fas-induced Rac1 activation is independent of the death domain, and conversely, that the MPD is required for Fas-induced Rac1 activation.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Ezrin has previously been shown to associate with Fas during apoptosis, resulting in Fas polarization to membrane rafts and uropods, thus promoting efficient apoptosis in activated lymphocytes, CD4+ T cells during human immunodeficiency virus infection, and hepatocytes (Luciani et al., 2004
; Fais et al., 2005
; Haouzi et al., 2005
; Charrin and Alcover, 2006
). Rac has also been implicated in the death of activated T cells (Ramaswamy et al., 2007
). Consistent with this, we found that deletion of the ezrin binding MPD of Fas prevents Fas-induced killing of Fas-sensitive hepatocytes and that blocking the interaction between Fas and ezrin with the SERLI peptide inhibits Fas-dependent apoptosis in Jurkat T cells. However, our findings also reveal that an interaction between Fas and ezrin does not necessarily result in apoptosis but that the outcome of Fas activation is likely context dependent, resulting in apoptosis in activated immune cells and the damaged adult brain, and in neuritogenesis in the developing brain. Ezrin is a member of the ezrin/moesin/radixin (ERM) family of proteins, well characterized molecules that cross-link the cortical actin cytoskeleton with membrane proteins and regulate downstream signaling through a number of mediators, including the Rho GTPases (Bretscher, 1999
; Tsukita and Yonemura, 1999
). The ERM proteins are essential for the formation of morphological structures such as microvilli, leading edge, and cleavage furrows. Furthermore, ezrin has been implicated in neurite branching and in neurite regeneration after injury, by linking the neural cell adhesion molecule L1 to F-actin in growth cones (Haas et al., 2004
; Cheng et al., 2005
). Fas and ezrin are both present in neurons in the developing brain, and persists postnatally in neuroproliferative areas (Gimeno et al., 2004
).
We have shown that the Fas MPD consists of a stretch of 14 membrane-proximal amino acids. This region, rich in basic amino acids, resembles the ezrin-binding domains of other ezrin-interacting molecules, including L1, β-dystroglycan, CD44, CD43, and intercellular adhesion molecule-2 (Bretscher, 1999
; Tsukita and Yonemura, 1999
; Cheng et al., 2005
). Ezrin has been reported to activate the small GTPases by freeing them from their inhibitor, Rho-GDP dissociation inhibitor (Takahashi et al., 1997
). Here, we showed that recruitment of ezrin by Fas allowed Rac1 activation and process growth, suggesting that Fas can remodel cell morphology through posttranscriptional mechanisms, independently of new gene transcription. We and others have reported previously that Fas ligation can activate the ERK pathway (Shinohara et al., 2000
; Ahn et al., 2001
; O'Brien et al., 2002
; Desbarats et al., 2003
; Tamm et al., 2004
), and Fas-induced ERK activation has been implicated in neurite growth through induction of p35 expression and subsequent activation of the neuron-specific cyclin-dependent kinase 5 (cdk5) (Desbarats et al., 2003
). Interestingly, cdk5 phosphorylates ezrin, thereby promoting the association of ezrin with membrane proteins (Yang and Hinds, 2006
). Here, we have shown that inhibition of MEK/ERK signaling does not prevent Fas-induced process formation, but rather it reduces the length and branching of processes. Together, these data suggest a model in which Fas binding to ezrin is sufficient to initiate process growth independently of new gene expression, whereas ligation of Fas by FasL can trigger ERK activation, leading to new gene expression that further promotes process elongation and branching via cdk5. Moreover, phosphorylation of ezrin by cdk5 may further promote Fas–ezrin interactions and Fas-mediated process growth.
The physiological function of Fas in the nervous system is being reevaluated in light of recent evidence demonstrating that it is far more than a death receptor (Desbarats et al., 2003
; Lambert et al., 2003
; Landau et al., 2005
; Zuliani et al., 2006
; Peter et al., 2007
). Fas was initially considered to be exclusively proapoptotic in the nervous system, by analogy with the immune system, where Fas was first described as a "death receptor" (Becher et al., 1998
). However, mice with little or no Fas expression (lpr mice) have normal numbers of neurons, despite massively increased numbers of lymphocytes (Watanabe-Fukunaga et al., 1992
), suggesting that Fas is not a regulator of physiological neuron death during development (Landau et al., 2005
; Zuliani et al., 2006
; Peter et al., 2007
). In contrast, axon and dendrite branching is reduced in hippocampal and cortical neurons in Fas-deficient lpr mice in vivo, consistent with a role for Fas in promoting neurite branching (Zuliani et al., 2006
). Lpr-cg mice, which express Fas that bears a point mutation that inactivates the death domain, also show impaired Fas-mediated neuronal branching (Zuliani et al., 2006
), suggesting that the mutation in lpr-cg Fas may affect its binding to ezrin. In vitro, Fas ligation by FasL or agonistic antibodies stimulates neurite growth (Desbarats et al., 2003
) and branching (Zuliani et al., 2006
) in primary neurons from embryonic and neonatal mice. FasL expression has been reported in neurons, and it may therefore induce autocrine neuritogenesis in neurons in the developing brain. Our data provide insight into the initial molecular steps of Fas-mediated process formation, and they illustrate, for the first time, a new domain of Fas linking Fas to a nonapoptotic pathway.
Fas-induced process growth is likely to have consequences beyond nervous system development. Ezrin-mediated remodeling of cellular morphology has been implicated in tumor motility and metastasis (Curto and McClatchey, 2004
; Fais, 2004
); interestingly, Fas has also been implicated in tumor progression and invasiveness through activation of NF-
B and other nonapoptotic pathways (Barnhart et al., 2004
; Peter et al., 2005
). Our findings show that Fas–ezrin interactions do not invariably result in cell death, and suggest that this pathway may provide a new mechanism for Fas-mediated cancer progression and metastasis in apoptosis-resistant tumor cells.
Finally, the MPD that we describe here for Fas is homologous with a similar sequence of juxtamembrane basic amino acids found in the Drosophila protein Wengen, the sole Drosophila TNFR superfamily homologue (Kauppila et al., 2003
). There is no death domain in Wengen, suggesting that MPD-mediated cytoskeletal remodeling may evolutionarily predate caspase-mediated apoptosis in TNFR superfamily members. Several other members of the TNFR superfamily, including p75 NGFR and TNFR2, also share regions homologous with the Fas MPD. Interestingly, TNFR2 has been preferentially associated with proliferation, whereas TNFR1 has been predominantly implicated in cell death (Aggarwal, 2003
).
In summary, we have described a new domain in Fas, shared by several other TNFR superfamily members, that regulates recruitment of ezrin, Rac1 activation, and process growth. The Fas MPD controls a newly defined molecular pathway of morphological differentiation in developing neurons.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
* Present address: Tosteson Medical Education Center, Harvard Medical School, Boston, MA 02115. ![]()
Address correspondence to: Julie Desbarats (julie.desbarats{at}mcgill.ca)
Abbreviations used: CRIB, Cdc42/Rac1-interactive binding; DD, death domain; ERK, p42/44 extracellular signal-regulated kinase; FADD, Fas-associated death domain; FasL, Fas ligand; ICD, intracellular domain; luc, luciferase; MPD, membrane proximal domain; NGFR, low-affinity p75 nerve growth factor receptor; PAK1B, p21-activated kinase 1 protein 1B; RBD, Rho binding domain; ROCK, Rho-associated kinase; TNFR, tumor necrosis factor receptor.
| REFERENCES |
|---|
|
|
|---|
Ahn, J. H., Park, S. M., Cho, H. S., Lee, M. S., Yoon, J. B., Vilcek, J., and Lee, T. H. (2001). Non-apoptotic signaling pathways activated by soluble Fas ligand in serum-starved human fibroblasts. Mitogen-activated protein kinases and NF-kappaB-dependent gene expression. J. Biol. Chem 276, 47100–47106.
Alderson, M. R., Armitage, R. J., Maraskovsky, E., Tough, T. W., Roux, E., Schooley, K., Ramsdell, F., and Lynch, D. H. (1993). Fas transduces activation signals in normal human T lymphocytes. J. Exp. Med 178, 2231–2235.
Alderson, M. R., Tough, T. W., Braddy, S., Davis-Smith, T., Roux, E., Schooley, K., Miller, R. E., and Lynch, D. H. (1994). Regulation of apoptosis and T cell activation by Fas-specific mAb. Int. Immunol 6, 1799–1806.
Barcena, A., Muench, M. O., Song, K. S., Ohkubo, T., and Harrison, M. R. (1999). Role of CD95/Fas and its ligand in the regulation of the growth of human CD34(++)CD38(–) fetal liver cells. Exp. Hematol 27, 1428–1439.[CrossRef][Medline]
Barnhart, B. C., Legembre, P., Pietras, E., Bubici, C., Franzoso, G., and Peter, M. E. (2004). CD95 ligand induces motility and invasiveness of apoptosis-resistant tumor cells. EMBO J 23, 3175–3185.[CrossRef][Medline]
Becher, B., Barker, P. A., Owens, T., and Antel, J. P. (1998). CD95-CD95L: can the brain learn from the immune system? Trends Neurosci 21, 114–117.[CrossRef][Medline]
Bechmann, I., Mor, G., Nilsen, J., Eliza, M., Nitsch, R., and Naftolin, F. (1999). FasL (CD95L, Apo1L) is expressed in the normal rat and human brain: evidence for the existence of an immunological brain barrier. Glia 27, 62–74.[CrossRef][Medline]
Biancone, L., Martino, A. D., Orlandi, V., Conaldi, P. G., Toniolo, A., and Camussi, G. (1997). Development of inflammatory angiogenesis by local stimulation of Fas in vivo. J. Exp. Med 186, 147–152.
Bretscher, A. (1999). Regulation of cortical structure by the ezrin-radixin-moesin protein family. Curr. Opin. Cell Biol 11, 109–116.[CrossRef][Medline]
Brunner, T. et al. (1995). Cell-autonomous Fas (CD95)/Fas-ligand interaction mediates activation-induced apoptosis in T-cell hybridomas. Nature 373, 441–444.[CrossRef][Medline]
Charrin, S., and Alcover, A. (2006). Role of ERM (ezrin-radixin-moesin) proteins in T lymphocyte polarization, immune synapse formation and in T cell receptor-mediated signaling. Front. Biosci 11, 1987–1997.[CrossRef][Medline]
Cheng, L., Itoh, K., and Lemmon, V. (2005). L1-mediated branching is regulated by two ezrin-radixin-moesin (ERM)-binding sites, the RSLE region and a novel juxtamembrane ERM-binding region. J. Neurosci 25, 395–403.
Choi, C., Gillespie, G. Y., Van Wagoner, N. J., and Benveniste, E. N. (2002). Fas engagement increases expression of interleukin-6 in human glioma cells. J. Neurooncol 56, 13–19.[CrossRef][Medline]
Curto, M., and McClatchey, A. I. (2004). Ezrin. A metastatic detERMinant? Cancer Cell 5, 113–114.[CrossRef][Medline]
Desbarats, J., Birge, R. B., Mimouni-Rongy, M., Weinstein, D. E., Palerme, J. S., and Newell, M. K. (2003). Fas engagement induces neurite growth through ERK activation and p35 upregulation. Nat. Cell Biol 5, 118–125.[CrossRef][Medline]
Desbarats, J., and Newell, M. K. (2000). Fas engagement accelerates liver regeneration after partial hepatectomy. Nat. Med 6, 920–923.[CrossRef][Medline]
Desbarats, J., Wade, T., Wade, W. F., and Newell, M. K. (1999). Dichotomy between naïve and memory CD4+ T cell responses to Fas (CD95) engagement. Proc. Natl. Acad. Sci. USA 96, 8104–8109.
Dhein, J., Walczak, H., Baumler, C., Debatin, K.-M., and Krammer, P. H. (1995). Autocrine T-cell suicide mediated by APO-1/(Fas/CD95). Nature 373, 438–441.[CrossRef][Medline]
Fais, S. (2004). A role for ezrin in a neglected metastatic tumor function. Trends Mol. Med 10, 249–250.[CrossRef][Medline]
Fais, S., De Milito, A., and Lozupone, F. (2005). The role of FAS to ezrin association in FAS-mediated apoptosis. Apoptosis 10, 941–947.[CrossRef][Medline]
French, L. E., and Tschopp, J. (1996). Constitutive Fas ligand expression in several non-lymphoid mouse tissues: implications for immune protection and cell turnover. Behring Inst. Mitteilungen 97, 156–160.[Medline]
Gimeno, L., Corradi, A., Cobos, I., Consalez, G. G., and Martinez, S. (2004). Ezrin gene, coding for a membrane-cytoskeleton linker protein, is regionally expressed in the developing mouse neuroepithelium. Gene Expr. Patterns 4, 749–754.[CrossRef][Medline]
Haas, M. A., Vickers, J. C., and Dickson, T. C. (2004). Binding partners L1 cell adhesion molecule and the ezrin-radixin-moesin (ERM) proteins are involved in development and the regenerative response to injury of hippocampal and cortical neurons. Eur. J. Neurosci 20, 1436–1444.[CrossRef][Medline]
Haouzi, D., Baghdiguian, S., Granier, G., Travo, P., Mangeat, P., and Hibner, U. (2005). Three-dimensional polarization sensitizes hepatocytes to Fas/CD95 apoptotic signalling. J. Cell Sci 118, 2763–2773.
Huang, B., Eberstadt, M., Olejniczak, E. T., Meadows, R. P., and Fesik, S. W. (1996). NMR structure and mutagenesis of the Fas (APO-1/CD95) death domain. Nature 384, 638–641.[CrossRef][Medline]
Ivetic, A., and Ridley, A. J. (2004). Ezrin/radixin/moesin proteins and Rho GTPase signalling in leucocytes. Immunology 112, 165–176.[CrossRef][Medline]
Ju, S. T., Panka, D. J., Cui, H., Ettinger, R., El-Khatib, M., Sherr, D. H., Stanger, B. Z., and Marshak-Rothstein, A. (1995). Fas(CD95)/FasL interactions required for programmed cell death after T-cell activation. Nature 373, 444–448.[CrossRef][Medline]
Kauppila, S. et al. (2003). Eiger and its receptor, Wengen, comprise a TNF-like system in Drosophila. Oncogene 22, 4860–4867.[CrossRef][Medline]
Lambert, C., Landau, A. M., and Desbarats, J. (2003). Fas–beyond death: a regenerative role for Fas in the nervous system. Apoptosis 8, 551–562.[CrossRef][Medline]
Landau, A. M., Luk, K. C., Jones, M. L., Siegrist-Johnstone, R., Young, Y. K., Kouassi, E., Rymar, V. V., Dagher, A., Sadikot, A. F., and Desbarats, J. (2005). Defective Fas expression exacerbates neurotoxicity in a model of Parkinson's disease. J. Exp. Med 202, 575–581.
Lozupone, F., Lugini, L., Matarrese, P., Luciani, F., Federici, C., Iessi, E., Margutti, P., Stassi, G., Malorni, W., and Fais, S. (2004). Identification and relevance of the CD95-binding domain in the N-terminal region of ezrin. J. Biol. Chem 279, 9199–9207.
Luciani, F., Matarrese, P., Giammarioli, A. M., Lugini, L., Lozupone, F., Federici, C., Iessi, E., Malorni, W., and Fais, S. (2004). CD95/phosphorylated ezrin association underlies HIV-1 GP120/IL-2-induced susceptibility to CD95(APO-1/Fas)-mediated apoptosis of human resting CD4(+)T lymphocytes. Cell Death Differ 11, 574–582.[CrossRef][Medline]
Manser, E., Leung, T., Salihuddin, H., Zhao, Z. S., and Lim, L. (1994). A brain serine/threonine protein kinase activated by Cdc42 and Rac1. Nature 367, 40–46.[CrossRef][Medline]
Martin-Villalba, A., Hahne, M., Kleber, S., Vogel, J., Falk, W., Schenkel, J., and Krammer, P. H. (2001). Therapeutic neutralization of CD95-ligand and TNF attenuates brain damage in stroke. Cell Death Differ 8, 679–686.[CrossRef][Medline]
Meyer, G., and Feldman, E. L. (2002). Signaling mechanisms that regulate actin-based motility processes in the nervous system. J. Neurochem 83, 490–503.[CrossRef][Medline]
Nagata, S., and Golstein, P. (1995). The Fas death factor. Science 267, 1449–1456.
Nikolic, M. (2002). The role of Rho GTPases and associated kinases in regulating neurite outgrowth. Int. J. Biochem. Cell Biol 34, 731–745.[CrossRef][Medline]
O'Brien, D., O'Connor, T., Shanahan, F., and O'Connell, J. (2002). Activation of the p38 MAPK and ERK1/2 pathways is required for Fas-induced IL-8 production in colonic epithelial cells. Ann. N Y Acad. Sci 973, 161–165.[Medline]
Parlato, S., Giammarioli, A. M., Logozzi, M., Lozupone, F., Matarrese, P., Luciani, F., Falchi, M., Malorni, W., and Fais, S. (2000). CD95 (APO-1/Fas) linkage to the actin cytoskeleton through ezrin in human T lymphocytes: a novel regulatory mechanism of the CD95 apoptotic pathway. EMBO J 19, 5123–5134.[CrossRef][Medline]
Peter, M. E. et al. (2007). The CD95 receptor: apoptosis revisited. Cell 129, 447–450.[CrossRef][Medline]
Peter, M. E., and Krammer, P. H. (2003). The CD95(APO-1/Fas) DISC and beyond. Cell Death Differ 10, 26–35.[CrossRef][Medline]
Peter, M. E., Legembre, P., and Barnhart, B. C. (2005). Does CD95 have tumor promoting activities? Biochim. Biophys. Acta 1755, 25–36.[Medline]
Ramaswamy, M., Dumont, C., Cruz, A. C., Muppidi, J. R., Gomez, T. S., Billadeau, D. D., Tybulewicz, V.L.J., and Siegel, R. M. (2007). Rac GTPases sensitize activated T cells to die via Fas. J. Immunol 179, 6384–6388.
Raoul, C., Estevez, A. G., Nishimune, H., Cleveland, D. W., deLapeyriere, O., Henderson, C. E., Haase, G., and Pettmann, B. (2002). Motoneuron death triggered by a specific pathway downstream of Fas. Potentiation by ALS-linked SOD1 mutations. Neuron 35, 1067–1083.[CrossRef][Medline]
Ricci-Vitiani, L., Pedini, F., Mollinari, C., Condorelli, G., Bonci, D., Bez, A., Colombo, A., Parati, E., Peschle, C., and De Maria, R. (2004). Absence of caspase 8 and high expression of PED protect primitive neural cells from cell death. J. Exp. Med 200, 1257–1266.
Sakic, B., Szechtman, H., Denburg, J., Gorny, G., Kolb, B., and Whishaw, I. (1998). Progressive atrophy of pyramidal neuron dendrites in autoimmune MRL-lpr mice. J. Neuroimmunol 87, 162–170.[CrossRef][Medline]
Shinohara, H., Yagita, H., Ikawa, Y., and Oyaizu, N. (2000). Fas drives cell cycle progression in glioma cells via extracellular signal-regulated kinase. Cancer Res 60, 1766–1772.
Takahashi, K., Sasaki, T., Mammoto, A., Takaishi, K., Kameyama, T., Tsukita, S., and Takai, Y. (1997). Direct interaction of the Rho GDP dissociation inhibitor with ezrin/radixin/moesin initiates the activation of the Rho small G protein. J. Biol. Chem 272, 23371–23375.
Tamm, C., Robertson, J. D., Sleeper, E., Enoksson, M., Emgard, M., Orrenius, S., and Ceccatelli, S. (2004). Differential regulation of the mitochondrial and death receptor pathways in neural stem cells. Eur. J. Neurosci 19, 2613–2621.[CrossRef][Medline]
Trauth, B. C., Klas, C., Peters, A. M., Matzku, S., Moller, P., Falk, W., Debatin, K. M., and Krammer, P. H. (1989). Monoclonal antibody-mediated tumor regression by induction of apoptosis. Science 245, 301–305.
Tsukita, S., and Yonemura, S. (1999). Cortical actin organization: lessons from ERM (ezrin/radixin/moesin) proteins. J. Biol. Chem 274, 34507–34510.