|
|
|
|
Vol. 19, Issue 8, 3272-3282, August 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



*Cardiovascular Research Institute, Department of Cell Biology and Molecular Medicine, and Department of Medicine, and
Division of Nephrology, University of Medicine and Dentistry of New Jersey, Newark, NJ 07103
Submitted February 15, 2008;
Revised May 19, 2008;
Accepted May 21, 2008
Monitoring Editor: Jonathan Chernoff
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
22 ribonucleotides long, and genetically encoded, with a potential to recognize multiple mRNA targets guided by sequence complementarity and RNA-binding proteins (Lee et al., 1993
Although mammalian miRNAs are commonly known for inhibiting translation versus inducing mRNA degradation, there is now substantial evidence to support the latter as well. Farh et al. (2005)
showed that predicted mRNA targets of tissue-specific miRNAs were lower in the corresponding tissue versus others. In support, Lim et al. (2005)
showed that by expressing the muscle-specific miR-1 or the brain-specific miR-124 in HeLa cells, its mRNA expression pattern shifted accordingly. The mechanism of mRNA degradation is similar to that used by small interfering RNA (siRNA), where the endonuclease Dicer mediates mRNA cleavage. Alternatively, miRNA may induce deadenylation, which induces mRNA degradation (Wu et al., 2006
). In contrast, it is well established that in metazoans miRNA inhibits mRNA translation, for which the Cap and poly(A) tail structures are required for inhibition of translation initiation, but the mechanism remains unknown (Humphreys et al., 2005
). It is plausible that transient exposure of an mRNA to a targeting miRNA will inhibit its translation, whereas chronic exposure will result in its degradation.
miR-21 is one of the most commonly and highly up-regulated miRNA in many forms of cancer (Volinia et al., 2006
; Meng et al., 2007
). Its knockdown activates caspases and induces apoptosis in glioblastoma cells (Chan et al., 2005
) and sensitizes cholangiocytes to chemotherapeutic agents (Meng et al., 2007
), whereas its overexpression inhibits apoptosis in myeloma cells (Loffler et al., 2007
). miR-21 is shown to target and down-regulate the expression of the tumor suppressors tropomyosin 1 (Zhu et al., 2007
), phosphatase and tensin homologue (PTEN) (Meng et al., 2007
), and programmed cell death 4 (Pdcd4) and promote cell invasion and metastasis (Asangani et al., 2007
). Moreover, anti-miR-21 inhibits tumor growth in vivo and in vitro (Si et al., 2007
). In human colorectal cancer, the levels of miR-21 positively correlated with the development of metastasis but not tumor size (Slaby et al., 2008
). Most interestingly, of 37 differentially expressed miRNA (26 up-regulated and 11 down-regulated) in colon adenocarcinoma, up-regulation of miR-21 singularly correlated with lower survival rates and poor response of patients to therapy (Schetter et al., 2008
). Thus, miR-21 is poised to be a major therapeutic target in colon carcinoma.
Cardiac hypertrophy is characterized by a change in the gene expression pattern that recapitulates the neonatal profile (Johnatty et al., 2000
). This switch is triggered by transcriptional and post-transcriptional regulators. Several labs have recently reported an array of posttranscriptional miRNA regulators that are differentially expressed and play a role in the development of cardiac hypertrophy (van Rooij et al., 2006
; Callis et al., 2007
; Care et al., 2007
; Cheng et al., 2007
; Sayed et al., 2007
; Tatsuguchi et al., 2007
). miR-21 is one of the most highly and consistently up-regulated miRNAs, but its role is still controversial (Cheng et al., 2007
; Tatsuguchi et al., 2007
). The underlying mechanisms involved in cardiac hypertrophy are reminiscent of those used in cancer, overlapping in many growth-promoting molecules and pathways, wherein miR-21 proves to be no exception (van Rooij et al., 2006
; Cheng et al., 2007
; Sayed et al., 2007
; Tatsuguchi et al., 2007
).
In this study, we describe a role for miR-21 in inducing unique connections between cardiocytes, a morphological aspect of the cell that has not been described previously. We also identify an upstream regulatory pathway and a downstream target of miR-21. Their implications in cardiac hypertrophy and cancer are discussed.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Cultures and Adenovirus (Ad) Infection
Neonatal cardiocytes were prepared as described previously, using both preplating and Percoll gradients for enriching for cardiocytes (Abdellatif et al., 1994
). Twenty-four hours later, medium was replaced without fetal bovine serum (FBS), and cells were infected with recombinant adenoviruses at a multiplicity of infection (moi) of 10–20.
Adult cardiocytes were prepared as described previously (Malhotra et al., 1997
). Briefly, beating hearts were perfused in a Langendorf apparatus with collagenase type II (Worthington Biochemicals, Freehold, NJ) until cardiocytes were dissociated, and they were then cultured in minimal essential medium with 1.2 mM CaCl2 on laminin-coated chamber slides.
Colon cancer SW480 and SW620 cell lines (American Type Culture Collection, Manassas, VA) were cultured in Leibovitz's medium (Invitrogen, Carlsbad, CA) with 10% FBS at 37°C in a CO2-free incubator. Cells were infected with the various viruses in FBS-free medium.
Northern Blot
Total RNA extracted from whole hearts or cultured cardiocytes was analyzed by Northern blots as described previously (Sayed et al., 2007
).
Construction of Adenoviruses
Recombinant adenoviruses were constructed, propagated, and titered as described previously by Dr. Frank Graham (Graham and Prevec, 1991
). The viruses were purified on a cesium chloride gradient followed by dialysis against 20 mM Tris-buffered saline with 2% glycerol.
DNA Constructs Cloned into Recombinant Adenovirus
miR-21, a 320-base pair sequence encompassing the stem-loop of miR-21, was amplified from mouse genomic DNA by polymerase chain reaction (PCR) by using primers: 5'-CCTGCCTGAGCACCTCGTGC-3' and 5'-GACTGTGACGACTACCCCAA-3'. For a control a nonsense sequence, 5'-GAACCGAGCCCACCAGCGAGC-3' replaced the mature miRNA sequence within its stem-loop structure. An miR-21 eraser, a tandem repeat of the anti-sense of mature miR-21 sequence, was synthesized as a double-stranded oligonucleotide and cloned into recombinant adenovirus under the control of a U6 promotor. Sprouty2 (SPRY2; accession no. NM_011897, the full-length cDNA, excluding the miR-21 targeting site and upward of the 3'UTR, was cloned by PCR from a mouse 17-d embryonic cDNA library (Clontech, Mountain View, CA). Short hairpin RNA (shRNA) SPRY2, a hairpin-forming oligonucleotide corresponding to bases 668–688 of open reading frame of Mus musculus SPRY2 (GenBank accession no. NM_011897), was cloned into adenovirus as described previously (Yue et al., 2004
).
Immunocytochemistry
As described previously (Sayed et al., 2007
). Cells were immunolabeled with anti-titin (Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA), anti-SPRY2 (Millipore, Billerica, MA), anti-connexin43 (Cx43; BD Biosciences, San Jose, CA), or anti-β-catenin (Santa Cruz Biotechnology, Santa Cruz, CA) in Tris-buffered saline with 1% bovine serum albumin. Slides were mounted using Prolong Gold anti-fade plus 4,6-diamidino-2-phenylindole (DAPI) (Invitrogen).
Immunohistochemistry
Slides were immunostained with 1:100 anti-connexin43 (BD Biosciences) by using BCIP/NBT chromagen from Zymed Laboratories (South San Francisco, CA), according to the manufacturer's protocol.
Cell Fractionation and Western Blotting
As described previously (Sayed et al., 2007
), cell lysate was fractionated using Subcellular ProteoExtract kit (Calbiochem, San Diego, CA), according to the manufacturer's protocol. The protein (5–10 µg) was analyzed on a 4–20% gradient SDS-polyacrylamide gel electrophoresis (PAGE) (Criterion gels; Bio-Rad, Hercules, CA). The antibodies used were anti-SPRY2 and anti-SPRY3 (Millipore); anti-PDCD4, anti-SPRY1, anti-SPRY4, anti-Ras, and anti-H2B (Santa Cruz Biotechnology); anti-phospho-p44/42 mitogen-activated protein kinase (MAPK)-Thr202/Tyr204 and anti-p44/42 MAPK (Cell Signaling Technology, Danvers, MA); anti-connexin43 (BD Biosciences); anti-phosphatase and tensin homolog deleted on chromosome 10 (PTEN; GeneScript, Piscataway, NJ), and anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Millipore).
Luciferase (Luc) Assay
A concatemere of the miR-21–predicted target sequence within the SPRY2 3'UTR (GGAGACCCACATTGCATAAGCT) x 3 and a mutant lacking complimentarity with miR-21 seed sequence (GGAGACCCACATTGCGACTATA) x 3, were cloned downstream of the luciferase gene driven by the cytomegalovirus (CMV) promoter, generating Luc.SPRY2 and Luc.mtSPRY2 vectors, respectively. Cultured neonatal cardiocytes were transfected with these constructs, using Lipofectamine (Invitrogen), in conjunction with plasmids expressing miR-21 (CMV.miR-21) or a nonsense stem-loop (pControl). The cells were harvested after 24 h, and luciferase activity was assayed using an Lmax multiwell luminometer (Molecular Devices, Sunnyvale, CA).
Cell–Cell Dye Transfer Assay
A suspension of two groups (
105 cells) of freshly isolated neonatal cardiocytes were independently loaded with the gap junction-permeable dye calcein AM (0.5 µg/ml; Invitrogen) or with the membrane-labeling dye Vibrant DiI (1.86 µg/ml; Invitrogen), for 30 min at 37°C in serum-free culturing medium. The cells were then washed with 3 x 5 ml of medium and the two groups were mixed and plated on 0.3% gelatin-coated glass slide. Transfer of calcein from one group of cells to the other was monitored by live fluorescence imaging.
Migration Assay
SW480 cells were treated with a control, miR-21 eraser, shRNA-SPRY2, or miR-21 eraser + shRNA-SPRY2 viruses for 48 h in serum-free Leibovitz's medium, after which they were trypsinized, collected, and counted. In the meantime, 24-well plates with transwell-permeable, 0.8-µm polycarbonate membrane inserts (Corning, Corning, NY) were preconditioned with culture medium. To each transwell, 105 cells/100 µl of serum-free medium was seeded for 30 min before adding 600 µl of serum-enriched medium to the lower chamber as an attractant. The plates were incubated for 5 h at 37°C. The cells were then fixed with 10% buffered Formalin and kept at 4°C overnight, before they were stained with hematoxylin (Zymed Laboratories). The upper side of the membrane was gently wiped using a wet cotton swab to remove excess stain before the lower side was imaged with a 20x objective. The number of cells migrated were counted using the free ImageJ cell counter software (National Institutes of Health, Bethesda, MD).
Statistical Analysis
Calculation of significance between two groups was performed using an unpaired, two-tailed t test. The experiment in Figure 1e was performed twice, whereas all other experiments were done at least three times, as indicated in the figure legends. The relative intensities of the bands seen on Western blot or Northern blot radiographs were quantified using Unscan-it software and normalized to an internal control such as GAPDH, Ras, H2B, or actin for different cellular protein fractions, or U6 or 5S for RNA fractions. The numerical values reported within the text represent the average of at least three experiments ± SD. Otherwise, SE of the mean was used only where indicated in the text or figure legends.
| RESULTS |
|---|
|
|
|---|
|
|
Using Western blot analysis, we confirmed down-regulation of endogenous SPRY2 (52 ± 4%, average ± SD; n = 4) upon overexpression of miR-21 for 48 h (Figure 2e). The blots also revealed that the SPRY2 protein is present in the cytosol, membrane, nuclear, and cytoskeletal fractions of cardiocytes (Supplemental Figure 4S). It should be noted that SPRY2 is detected as two to three bands on an SDS-PAGE, which is thought to be due to its phosphorylation and palmitoylation (Impagnatiello et al., 2001
). The quantification takes into account all three forms. In contrast, overexpression of SPRY2 had no effect on endogenous miR-21 (Supplemental Figure 5S). Because Sprouty negatively regulates extracellular signal-regulated kinase (ERK)1/2, we used phospho-ERK1/2 as a marker for monitoring changes in Spry2 function that would be regulated by changes in its levels. The results show that down-regulation of SPRY2 by miR-21 or shRNA (67 ± 9%, average ± SD; n = 4) is accompanied by an increase in basal phosph-ERK1/2 normalized to the total ERK by 5 ± 0.4 (average ± SD; n = 4) and 2.2 ± 0.15-fold (average ± SD; n = 4), respectively (Figure 2, e and f). But excess (overexpressed) miR-21 did not augment FBS-induced phospho-ERK1/2 levels; plausibly, FBS has already induced maximal stimulation (Supplemental Figure 4SB). The increase of phospho-ERK1/2 by these treatments may reflect the inhibitory effect of SPRY2 on basal activation of surface receptors through autocrine effects. In contrast, knockdown of miR-21 by using the miR-21 eraser, or overexpression of SPRY2, results in >80% inhibition of fetal bovine serum-induced phospho-ERK1/2 (Figure 2, g and h). Thus, SPRY2 is a downstream target of miR-21 (could be a direct or indirect target at this juncture) and has limiting cellular concentrations.
To determine whether SPRY2 is a direct target of miR-21, we cloned the miR-21–predicted target sequence that is contained within its 3'UTR, downstream of a luciferase gene (Luc.SPRY2; Figure 2i). This sequence conferred miR-21–induced inhibition of the luciferase activity by 76 ± 4% (average ± SEM; n = 12). To determine specificity, we cloned a mutated miR-21 SPRY2 target sequence, in which the seed-binding sequence was completely altered (Luc.mtSPRY2), downstream of the luciferase gene. As seen in Figure 2i, not only did this mutant abolish the effect of exogenous miR-21 on the reporter but also it relieved it from inhibition by the endogenous miR-21. Thus, we conclude that SPRY2 is a direct target of miR-21.
β-Adrenergic Receptor Stimulation Induces down-Regulation of SPRY2, Which Is Accompanied by Cell-to-Cell Connecting Cellular Outgrowths
To address physiological relevance of these miR-21–induced outgrowths, we asked whether these structures accompany βAR induction of miR-21 in isolated cardiocytes. After treatment of the cells with isoproterenol and staining them with an antibody against the sarcomeric protein titin, we were able to observe cellular outgrowth that were connecting or reaching out to adjacent cells (Figure 3a, top). The striated pattern of titin staining reflects the presence of sarcomeres even within these branches. This effect was wide spread in all observed cells (4 ± 3 branches/cell, average ± SD; n = 20). Impressively, these outgrowths were abrogated by the miR-21 eraser or overexpression of SPRY2 (Figure 3a, bottom). Coimmunostaining the cells with anti-SPRY2 reveals that SPRY2 is depressed in the presence of isoproterenol but restored in the presence of the miR-21 eraser or exogenous SPRY2. Similar results were obtained when cells were treated with a virus overexpressing β2AR (Supplemental Figure 6S). Although Figure 1 confirms that isoproterenol and β2AR induce up-regulation of miR-21, Figure 3b confirms that they also induce 70 ± 22 and 64 ± 11 (average ± SD; n = 3) down-regulation of SPRY2 protein, respectively (Figure 3b). The functional consequence of this effect is reflected in the contractile behavior of the cardiocytes (Figure 3c). Normally, isolated cells have variable beating rates. In the presence of isoproterenol, the rate of contraction is immediately enhanced two- to fivefold and does not seem to suffer in the absence of miR-21. But after 24 h of stimulation, the cardiocytes are hypertrophied and form cell-to-cell connections and begin to beat synchronously. By disrupting the connecting cellular outgrowth, using miR-21 eraser, this synchronicity of beating is disrupted. Thus, cell-to-cell connecting cardiocyte outgrowths are a morphological change that accompanies βAR stimulation and hypertrophy and that is mediated by miR-21 through down-regulation of SPRY2. From the contractile behavior of the cells, we predicted that these outgrowths connect the cardiocytes via functional gap junctions, which we test next.
|
|
Because the experiments described above were performed in neonatal cultured cardiocytes, which are generally more plastic, we questioned how these outgrowths might develop in the morphologically uniform rod-shaped adult cardiocytes in vivo. For this purpose, we sectioned hypertrophied hearts from the TAC mouse model and immunostained them with anti-Cx43. Compared with normal hearts, these hearts showed connecting, short, lateral outgrowths between adjacent cardiocytes, in which Cx43 that is normally strictly localized to the intercalated discs demarcated the sites of contact (Figure 5a). The figure shows three different depictions of these connections. To determine whether miR-21 mediates this effect, we isolated normal adult cardiocytes that we treated with the miR-21–expressing adenovirus for 72 h. After immunostaining with anti-Cx43, we were able to observe Cx43-demarcated lateral protrusions (Figure 5b, arrowheads). We also determined the levels of SPRY2 in the hypertrophied heart. The change in SPRY2 protein was only detected in the slower migrating form (
90%; n = 3), both in the membrane and nuclear fractions, but it was not associated with an increase in phosph-ERK1/2 (Figure 5c). Thus, the up-regulation of miR-21 in the adult cardiocytes evokes a rudimentary form of the cellular outgrowths observed in the neonatal cardiocytes.
|
70% (n = 2) reduction in endogenous miR-21 (Figure 6a) accompanied by up-regulation of SPRY2 protein (Figure 6c). Staining the cells with actin-binding phalloidin reveals microvillus-like protrusions that are enriched throughout the circumference of the control and miR-21–overexpressing cells alike (Figure 6b). In contrast, SPRY2 and miR-21 eraser resulted in dramatic reduction of these protrusions. Immunostaining the cells confirmed an increase in SPRY2 accompanying miR-21 eraser or SPRY2 overexpression. In addition to a reduction of the microvilli-like structures, miR-21 knockdown was associated with a 0.4 ± 0.12-fold lower cell migration relative to control, which was almost completely rescued by shRNA-SPRY2 (Figure 6c). Conversely, shRNA-SPRY2 alone increased cell migration 1.47 ± 0.05-fold that was inhibited by miR-21 eraser. Western blot analysis demonstrates the corresponding changes in SPRY2 levels, which reflects its increase with miR-21 eraser, inhibition by shRNA-SPRY2, and its inverse correlation with the extent of migration. Thus, we conclude that miR-21, through inhibition of SPRY2, reduces the formation of microvillus-like protrusions and migration of colon cancer cells.
|
| DISCUSSION |
|---|
|
|
|---|
Evidence Supporting a Role for βAR in Inducing Cardiocyte Connectivity and Its Association with Cardiac Hypertrophy
In support of a role for βAR stimulation in cell–cell connections and conduction, it was recently reported to increase the expression of connexin43 (Salameh et al., 2006
) and conduction velocity in cultured neonatal cardiocytes (de Boer et al., 2007
). Conduction velocity, which is partly regulated by the abundance of gap junctions, is increased during early hypertrophy but decreased during later decompensation stages (Cooklin et al., 1998
), which coincides with the decline in βARs and connexin43. Similarly, stretch (Zhuang et al., 2000
) and cAMP (Darrow et al., 1996
) induce up-regulation of connexin43 and gap junction density in parallel with an increase in conduction velocity in cultured cardiocytes. These data reconcile well with our results in Figure 3a showing extensive interconnecting cellular branches induced by isoproterenol treatment of isolated cardiocytes.
Cardiocytes adjacent to infarct zones (Smith et al., 1991
) or those subjected to aortic banding-induced hypertrophy (Emdad et al., 2001
) or pulmonary hypertension-induced hypertrophy (Uzzaman et al., 2000
) exhibit extensive remodeling of gap junctions. This remodeling is in the form of punctate distribution of connexin43 throughout the perimeter of the cell, which is normally confined to its end intercalate discs. This is similar to its diffuse distribution in neonatal heart cardiocytes (Spach et al., 2000
). Interestingly, we observe a similar pattern of connexin43 labeling after TAC and in isolated adult cardiocytes overexpressing miR-21 (Figure 5b). We propose that the lateralization of connexin43 demarcates sites of cell-to-cell connecting branches, which are induced by up-regulation of miR-21 and down-regulation of its target SPRY2. Similarly, in normal human hearts connexin43 is predominantly (91.7%) restricted to the intercalated discs (Kostin et al., 2004
). During early stages of cardiac hypertrophy, connexin43 is increased by 44.3%, but only 60.3% is localized to intercalated discs, whereas more of the protein occurs on the lateral sarcolemma (Kostin et al., 2004
). But during later stages of hypertrophy and decompensation, connexin43 levels are reduced and the lateral distribution disappears. This distribution and expression profile of connexin43 agrees with a scenario in which increased miR-21 during compensatory hypertrophy is associated with increased Cx43-positive, cell-cell connecting side branches, which is reversed during failure commensurate with the decline of miR-21.
The Role of SPRY in Branching and Cancer
Sprouty was first discovered as an inhibitor of fibroblast growth factor (FGF) signaling and branching of Drosophila airways (Hacohen et al., 1998
). This effect is conserved as shown by knockdown of SPRY2 in mouse lungs (Tefft et al., 1999
). Sprouty inhibits MAPK activation by FGF and epidermal growth factor (Reich et al., 1999
). Inhibition of branching is not restricted to the lungs, but SPRY2 also inhibits ureteric (Chi et al., 2004
) as well as chorionic vellous branching and reduces trophoblast cell migration (Chi et al., 2004
). Although the branches referred to here are tubular multicellular structures that underlie organogenesis, they are initiated by single cell sprouting. But most relevant to our study, is inhibition of neurite outgrowths by SPRY2 (Lao et al., 2006
; Gross et al., 2007
).
A related isoform, SPRY1, was reported to be up-regulated after relieving a human heart from its workload, which is consistent with our finding in which SPRY2 is down-regulated during pressure overload (Huebert et al., 2004
). SPRY was also found in vascular endothelial cells and has been shown to inhibit vasculogenesis (Huebert et al., 2004
). Likewise, Sprouty4 inhibits FGF and vascular endothelial growth factor-induced endothelial cell migration and proliferation (Lee et al., 2001
), whereas SPRY2 inhibits migration and proliferation of smooth muscle cells (Zhang et al., 2005
). This reconciles well with the observed up-regulation of miR-21 during neointimal formation, which has been shown to enhance smooth muscle proliferation (Ji et al., 2007
), and our discovery of SPRY2 being one of its targets.
Sprouty is down-regulated in prostrate cancer (Kwabi-Addo et al., 2004
), breast cancer (Lo et al., 2004
), hepatocellular carcinoma (Fong et al., 2006
), and non–small-cell lung cancer (Sutterluty et al., 2007
). Although independently, it was shown that these forms of cancer are also associated with up-regulation of miR-21 (Volinia et al., 2006
; Meng et al., 2007
). Whereas overexpression of SPRY2 inhibits cell migration (Yigzaw et al., 2001
; Lee et al., 2004
), an increase in miR-21 enhances cell proliferation and migration (Meng et al., 2007
). This is consistent with a pathway in which up-regulated miR-21 targets and down-regulates SPRY2, thereby enhancing proliferation and migration. But in addition, it has been shown that miR-21 can contribute to carcinogenesis through inhibition of apoptosis, or down-regulation of other tumor suppressors, such as phosphatase and PTEN (Meng et al., 2007
) and tropomyosin 1 (Zhu et al., 2007
). This further establishes a link between miR-21 and SPRY2, which is known to induce up-regulation of PTEN and inhibit cell proliferation (Edwin et al., 2006
). Using the miR-21 eraser in cancer cells, we show that knockdown of miR-21 is associated with up-regulation of both SPRY2 and PTEN. Thus, it seems that miR-21 negatively regulates PTEN both directly and indirectly through inhibition of SPRY2. Moreover, SPRY2 differentially regulates apoptosis: in differentiated neuronal cells it is apoptotic (Gross et al., 2007
), but it is antiapoptotic in adenocarcinoma cells (Edwin and Patel, 2008
). Our results suggest that miR-21 through down-regulating SPRY2 enhances migration through promoting formation of microvillus-like protrusions. But, the possibility remains that miR-21 through inhibition of SPRY2 and PTEN enhances cancer cell proliferation as well. Also, while validating the function of our miR-21 eraser, we found that it up-regulates PDCD4 in SW480 but not in myocytes, corroborating an antiapoptotic effect of miR-21 in cancer cells.
The Eraser Is a Powerful Tool for Specific Knockdown of Endogenous miRNA
Inhibition or knockdown of a specific miRNA is key in understanding its function. For that purpose several approaches have been devised. Those include the 2'-O-methyl (Hutvagner et al., 2004
; Meister et al., 2004
) or LNA-modified oligoribonuleotides (Orom et al., 2006
), and "antagomirs," which have a phosphorothioate backbone, a cholesterol-moiety at 3' end, and 2'-O-methyl modifications (Krutzfeldt et al., 2005
). In contrast to these transiently delivered oligonucleotides, Ebert et al. (2007)
have recently reported the delivery of antisense miRNA sequence by using expression vectors termed "sponges" (Ebert et al., 2007
). Our miRNA eraser is similar in concept to the latter, but it differs in the mechanism of inhibition of the miRNA. Although the sponges induce a modest variable decrease of the endogenous miRNA, our eraser wipes it out. The apparent loss of the miRNA signal on the Northern blots cannot be explained by competition of the complementary eraser RNA with the labeled miRNA probe used for the detection, as proposed by Ebert et al. (2007)
because Northern blots are normally run under extreme denaturing conditions. In cardiocytes, miR-specific erasers rendered endogenous miR-21 and miR-199a undetectable on Northern blots. In colon cancer cells, however, the effect was less complete only because it was diluted out by the rapidly proliferating cultures. The eraser differs from the sponge in two physical aspects: 1) the lack of stem-loop sequences at the 5' and 3' ends of tandem repeat sequence and 2) its delivery via a viral vector. Other plausible reasons for the difference in the outcome are the nature of the cell types or the targeted microRNA tested in both studies.
In conclusion, miR-21 plays a role in inducing the formation of cellular outgrowths that connect cardiocytes through gap junctions, which are usually confined to the intercalated discs in the normal adult heart. This change is provoked by βAR stimulation and mediated through down-regulation of SPRY2, an established negative regulator branching morphogenesis. We propose that this is an adaptive effect seen during cardiac hypertrophic growth and that it is associated with gap junction remodeling and enhanced conduction velocity but that it is reversed during cardiac failure. In contrast, miR-21 is necessary for formation of microvillus-like protrusions in colon cancer cells and enhances cell migration. It remains to be tested whether βAR stimulation also induces up-regulation of miR-21 in cancer cells, which if confirmed would provide us with a convenient therapeutic target.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: Department of Immunology, Merck & Co, Inc., 125 East Lincoln Avenue, Rahway, NJ 07065. ![]()
Address correspondence to: Maha Abdellatif (abdellma{at}umdnj.edu)
| REFERENCES |
|---|
|
|
|---|
Asangani, I. A., Rasheed, S. A., Nikolova, D. A., Leupold, J. H., Colburn, N. H., Post, S., and Allgayer, H. (2007). MicroRNA-21 (miR-21) post-transcriptionally downregulates tumor suppressor Pdcd4 and stimulates invasion, intravasation and metastasis in colorectal cancer. Oncogene 29, 29.
Bristow, M. R., Ginsburg, R., Minobe, W., Cubicciotti, R. S., Sageman, W. S., Lurie, K., Billingham, M. E., Harrison, D. C., and Stinson, E. B. (1982). Decreased catecholamine sensitivity and beta-adrenergic-receptor density in failing human hearts. N. Engl. J. Med 307, 205–211.[Abstract]
Callis, T. E., Chen, J. F., and Wang, D. Z. (2007). MicroRNAs in skeletal and cardiac muscle development. DNA Cell Biol 26, 219–225.[CrossRef][Medline]
Care, A. et al. (2007). MicroRNA-133 controls cardiac hypertrophy. Nat. Med 13, 613–618.[CrossRef][Medline]
Chan, J. A., Krichevsky, A. M., and Kosik, K. S. (2005). MicroRNA-21 is an antiapoptotic factor in human glioblastoma cells. Cancer Res 65, 6029–6033.
Cheng, Y., Ji, R., Yue, J., Yang, J., Liu, X., Chen, H., Dean, D. B., and Zhang, C. (2007). MicroRNAs are aberrantly expressed in hypertrophic heart: do they play a role in cardiac hypertrophy? Am. J. Pathol 170, 1831–1840.
Chi, L., Zhang, S., Lin, Y., Prunskaite-Hyyrylainen, R., Vuolteenaho, R., Itaranta, P., and Vainio, S. (2004). Sprouty proteins regulate ureteric branching by coordinating reciprocal epithelial Wnt11, mesenchymal Gdnf and stromal Fgf7 signalling during kidney development. Development 131, 3345–3356.
Cooklin, M., Wallis, W. R., Sheridan, D. J., and Fry, C. H. (1998). Conduction velocity and gap junction resistance in hypertrophied, hypoxic guinea-pig left ventricular myocardium. Exp. Physiol 83, 763–770.[Abstract]
Darrow, B. J., Fast, V. G., Kleber, A. G., Beyer, E. C., and Saffitz, J. E. (1996). Functional and structural assessment of intercellular communication. Increased conduction velocity and enhanced connexin expression in dibutyryl cAMP-treated cultured cardiac myocytes. Circ. Res 79, 174–183.
de Boer, T. P., van Rijen, H. V., Van der Heyden, M. A., Kok, B., Opthof, T., Vos, M. A., Jongsma, H. J., de Bakker, J. M., and van Veen, T. A. (2007). Beta-, not alpha-adrenergic stimulation enhances conduction velocity in cultures of neonatal cardiomyocytes. Circ. J 71, 973–981.[CrossRef][Medline]
Ebert, M. S., Neilson, J. R., and Sharp, P. A. (2007). MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells. Nat. Methods 4, 721–726.[CrossRef][Medline]
Edwin, F., and Patel, T. B. (2008). A novel role of Sprouty 2 in regulating cellular apoptosis. J. Biol. Chem 283, 3181–3190.
Edwin, F., Singh, R., Endersby, R., Baker, S. J., and Patel, T. B. (2006). The tumor suppressor PTEN is necessary for human Sprouty 2-mediated inhibition of cell proliferation. J. Biol. Chem 281, 4816–4822.
Emdad, L., Uzzaman, M., Takagishi, Y., Honjo, H., Uchida, T., Severs, N. J., Kodama, I., and Murata, Y. (2001). Gap junction remodeling in hypertrophied left ventricles of aortic-banded rats: prevention by angiotensin II type 1 receptor blockade. J. Mol. Cell Cardiol 33, 219–231.[CrossRef][Medline]
Farh, K. K., Grimson, A., Jan, C., Lewis, B. P., Johnston, W. K., Lim, L. P., Burge, C. B., and Bartel, D. P. (2005). The widespread impact of mammalian microRNAs on mRNA repression and evolution. Science 310, 1817–1821.
Fong, C. W. et al. (2006). Sprouty 2, an inhibitor of mitogen-activated protein kinase signaling, is down-regulated in hepatocellular carcinoma. Cancer Res 66, 2048–2058.
Graham, F. L., and Prevec, L. (1991). Methods in Molecular Biology, Clifton, NJ: Humana Press Inc.
Gross, I., Armant, O., Benosman, S., de Aguilar, J. L., Freund, J. N., Kedinger, M., Licht, J. D., Gaiddon, C., and Loeffler, J. P. (2007). Sprouty2 inhibits BDNF-induced signaling and modulates neuronal differentiation and survival. Cell Death Differ 14, 1802–1812.[CrossRef][Medline]
Hacohen, N., Kramer, S., Sutherland, D., Hiromi, Y., and Krasnow, M. A. (1998). sprouty encodes a novel antagonist of FGF signaling that patterns apical branching of the Drosophila airways. Cell 92, 253–263.[CrossRef][Medline]
Huebert, R. C. et al. (2004). Identification and regulation of Sprouty1, a negative inhibitor of the ERK cascade, in the human heart. Physiol. Genomics 18, 284–289.
Humphreys, D. T., Westman, B. J., Martin, D. I., and Preiss, T. (2005). MicroRNAs control translation initiation by inhibiting eukaryotic initiation factor 4E/cap and poly(A) tail function. Proc. Natl. Acad. Sci. USA 102, 16961–16966.
Hutvagner, G., Simard, M. J., Mello, C. C., and Zamore, P. D. (2004). Sequence-specific inhibition of small RNA function. PLoS Biol 2, 24.[CrossRef]
Impagnatiello, M. A., Weitzer, S., Gannon, G., Compagni, A., Cotten, M., and Christofori, G. (2001). Mammalian sprouty-1 and -2 are membrane-anchored phosphoprotein inhibitors of growth factor signaling in endothelial cells. J. Cell Biol 152, 1087–1098.
Ji, R., Cheng, Y., Yue, J., Yang, J., Liu, X., Chen, H., Dean, D. B., and Zhang, C. (2007). MicroRNA expression signature and antisense-mediated depletion reveal an essential role of MicroRNA in vascular neointimal lesion formation. Circ. Res 100, 1579–1588.
Johnatty, S. E., Dyck, J. R., Michael, L. H., Olson, E. N., and Abdellatif, M. (2000). Identification of genes regulated during mechanical load-induced cardiac hypertrophy. J. Mol. Cell Cardiol 32, 805–815.[CrossRef][Medline]
Kostin, S., Dammer, S., Hein, S., Klovekorn, W. P., Bauer, E. P., and Schaper, J. (2004). Connexin 43 expression and distribution in compensated and decompensated cardiac hypertrophy in patients with aortic stenosis. Cardiovasc. Res 62, 426–436.
Krutzfeldt, J., Rajewsky, N., Braich, R., Rajeev, K. G., Tuschl, T., Manoharan, M., and Stoffel, M. (2005). Silencing of microRNAs in vivo with antagomirs. Nature 438, 685–689.[CrossRef][Medline]
Kwabi-Addo, B., Wang, J., Erdem, H., Vaid, A., Castro, P., Ayala, G., and Ittmann, M. (2004). The expression of Sprouty1, an inhibitor of fibroblast growth factor signal transduction, is decreased in human prostate cancer. Cancer Res 64, 4728–4735.
Lagos-Quintana, M., Rauhut, R., Yalcin, A., Meyer, J., Lendeckel, W., and Tuschl, T. (2002). Identification of tissue-specific microRNAs from mouse. Curr. Biol 12, 735–739.[CrossRef][Medline]
Lao, D. H., Chandramouli, S., Yusoff, P., Fong, C. W., Saw, T. Y., Tai, L. P., Yu, C. Y., Leong, H. F., and Guy, G. R. (2006). A Src homology 3-binding sequence on the C terminus of Sprouty2 is necessary for inhibition of the Ras/ERK pathway downstream of fibroblast growth factor receptor stimulation. J. Biol. Chem 281, 29993–30000.
Lee, C. C., Putnam, A. J., Miranti, C. K., Gustafson, M., Wang, L. M., Vande Woude, G. F., and Gao, C. F. (2004). Over-expression of sprouty 2 inhibits HGF/SF-mediated cell growth, invasion, migration, and cytokinesis. Oncogene 23, 5193–5202.[CrossRef][Medline]
Lee, R. C., Feinbaum, R. L., and Ambros, V. (1993). The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75, 843–854.[CrossRef][Medline]
Lee, S. H., Schloss, D. J., Jarvis, L., Krasnow, M. A., and Swain, J. L. (2001). Inhibition of angiogenesis by a mouse sprouty protein. J. Biol. Chem 276, 4128–4133.
Lim, L. P., Lau, N. C., Garrett-Engele, P., Grimson, A., Schelter, J. M., Castle, J., Bartel, D. P., Linsley, P. S., and Johnson, J. M. (2005). Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature 433, 769–773.[CrossRef][Medline]
Lo, T. L. et al. (2004). The ras/mitogen-activated protein kinase pathway inhibitor and likely tumor suppressor proteins, sprouty 1 and sprouty 2 are deregulated in breast cancer. Cancer Res 64, 6127–6136.
Loffler, D. et al. (2007). Interleukin-6 dependent survival of multiple myeloma cells involves the Stat3-mediated induction of microRNA-21 through a highly conserved enhancer. Blood 110, 1330–1333.
Malhotra, A., Reich, D., Reich, D., Nakouzi, A., Sanghi, V., Geenen, D. L., and Buttrick, P. M. (1997). Experimental diabetes is associated with functional activation of protein kinase C epsilon and phosphorylation of troponin I in the heart, which are prevented by angiotensin II receptor blockade. Circ. Res 81, 1027–1033.
Meister, G., Landthaler, M., Dorsett, Y., and Tuschl, T. (2004). Sequence-specific inhibition of microRNA- and siRNA-induced RNA silencing. RNA 10, 544–550.
Meng, F., Henson, R., Wehbe-Janek, H., Ghoshal, K., Jacob, S. T., and Patel, T. (2007). MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancer. Gastroenterology 133, 647–658.[CrossRef][Medline]
Orom, U. A., Kauppinen, S., and Lund, A. H. (2006). LNA-modified oligonucleotides mediate specific inhibition of microRNA function. Gene 372, 137–141.[CrossRef][Medline]
Reich, A., Sapir, A., and Shilo, B. (1999). Sprouty is a general inhibitor of receptor tyrosine kinase signaling. Development 126, 4139–4147.[Abstract]
Salameh, A., Frenzel, C., Boldt, A., Rassler, B., Glawe, I., Schulte, J., Muhlberg, K., Zimmer, H. G., Pfeiffer, D., and Dhein, S. (2006). Subchronic alpha- and beta-adrenergic regulation of cardiac gap junction protein expression. FASEB J 20, 365–367.
Sayed, D., Hong, C., Chen, I. Y., Lypowy, J., and Abdellatif, M. (2007). MicroRNAs play an essential role in the development of cardiac hypertrophy. Circ. Res 100, 416–424.
Schetter, A. J. et al. (2008). MicroRNA expression profiles associated with prognosis and therapeutic outcome in colon adenocarcinoma. Jama 299, 425–436.
Si, M. L., Zhu, S., Wu, H., Lu, Z., Wu, F., and Mo, Y. Y. (2007). miR-21-mediated tumor growth. Oncogene 26, 2799–2803.[CrossRef][Medline]
Slaby, O., Svoboda, M., Fabian, P., Smerdova, T., Knoflickova, D., Bednarikova, M., Nenutil, R., and Vyzula, R. (2008). Altered expression of miR-21, miR-31, miR-143 and miR-145 is related to clinicopathologic features of colorectal cancer. Oncology 72, 397–402.
Smith, J. H., Green, C. R., Peters, N. S., Rothery, S., and Severs, N. J. (1991). Altered patterns of gap junction distribution in ischemic heart disease. An immunohistochemical study of human myocardium using laser scanning confocal microscopy. Am. J. Pathol 139, 801–821.[Abstract]
Sood, A. K., Bhatty, R., Kamat, A. A., Landen, C. N., Han, L., Thaker, P. H., Li, Y., Gershenson, D. M., Lutgendorf, S., and Cole, S. W. (2006). Stress hormone-mediated invasion of ovarian cancer cells. Clin. Cancer Res 12, 369–375.
Spach, M. S., Heidlage, J. F., Dolber, P. C., and Barr, R. C. (2000). Electrophysiological effects of remodeling cardiac gap junctions and cell size: experimental and model studies of normal cardiac growth. Circ. Res 86, 302–311.
Sutterluty, H., Mayer, C. E., Setinek, U., Attems, J., Ovtcharov, S., Mikula, M., Mikulits, W., Micksche, M., and Berger, W. (2007). Down-regulation of Sprouty2 in non-small cell lung cancer contributes to tumor malignancy via extracellular signal-regulated kinase pathway-dependent and -independent mechanisms. Mol. Cancer Res 5, 509–520.
Tatsuguchi, M., Seok, H. Y., Callis, T. E., Thomson, J. M., Chen, J. F., Newman, M., Rojas, M., Hammond, S. M., and Wang, D. Z. (2007). Expression of microRNAs is dynamically regulated during cardiomyocyte hypertrophy. J. Mol. Cell Cardiol 42, 1137–1141.[CrossRef][Medline]
Tefft, J. D., Lee, M., Smith, S., Leinwand, M., Zhao, J., Bringas, P., Jr, Crowe, D. L., and Warburton, D. (1999). Conserved function of mSpry-2, a murine homolog of Drosophila sprouty, which negatively modulates respiratory organogenesis. Curr. Biol 9, 219–222.[CrossRef][Medline]
Uzzaman, M., Honjo, H., Takagishi, Y., Emdad, L., Magee, A. I., Severs, N. J., and Kodama, I. (2000). Remodeling of gap junctional coupling in hypertrophied right ventricles of rats with monocrotaline-induced pulmonary hypertension. Circ. Res 86, 871–878.
van Rooij, E., Sutherland, L. B., Liu, N., Williams, A. H., McAnally, J., Gerard, R. D., Richardson, J. A., and Olson, E. N. (2006). A signature pattern of stress-responsive microRNAs that can evoke cardiac hypertrophy and heart failure. Proc. Natl. Acad. Sci. USA 103, 18255–18260.
Volinia, S. et al. (2006). A microRNA expression signature of human solid tumors defines cancer gene targets. Proc. Natl. Acad. Sci. USA 103, 2257–2261.
Wu, L., Fan, J., and Belasco, J. G. (2006). MicroRNAs direct rapid deadenylation of mRNA. Proc. Natl. Acad. Sci. USA 103, 4034–4039.
Yigzaw, Y., Cartin, L., Pierre, S., Scholich, K., and Patel, T. B. (2001). The C terminus of sprouty is important for modulation of cellular migration and proliferation. J. Biol. Chem 276, 22742–22747.
Yue, Y., Lypowy, J., Hedhli, N., and Abdellatif, M. (2004). Ras GTPase-activating protein binds to Akt and is required for its activation. J. Biol. Chem 279, 12883–12889.
Zhang, C., Chaturvedi, D., Jaggar, L., Magnuson, D., Lee, J. M., and Patel, T. B. (2005). Regulation of vascular smooth muscle cell proliferation and migration by human sprouty 2. Arterioscler Thromb. Vasc. Biol 25, 533–538.
Zhu, S., Si, M. L., Wu, H., and Mo, Y. Y. (2007). MicroRNA-21 targets the tumor suppressor gene tropomyosin 1 (TPM1). J. Biol. Chem 282, 14328–14336.
Zhuang, J., Yamada, K. A., Saffitz, J. E., and Kleber, A. G. (2000). Pulsatile stretch remodels cell-to-cell communication in cultured myocytes. Circ. Res 87, 316–322.
This article has been cited by other articles:
![]() |
E. van Rooij, W. S. Marshall, and E. N. Olson Toward MicroRNA-Based Therapeutics for Heart Disease: The Sense in Antisense Circ. Res., October 24, 2008; 103(9): 919 - 928. [Abstract] [Full Text] [PDF] |