|
|
|
|
Vol. 19, Issue 8, 3415-3425, August 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Dana-Farber Cancer Institute, Boston, MA 02115
Submitted November 20, 2007;
Revised May 20, 2007;
Accepted May 21, 2008
Monitoring Editor: Howard Riezman
| ABSTRACT |
|---|
|
|
|---|
AA or C
S mutations within the DHHC motif) failed to promote palmitoylation. Furthermore, DHHC2 associated with CD9 and CD151, but not other cell surface proteins, and DHHC2 knockdown diminished CD9 and CD151 palmitoylation. Knockdown of six other Golgi-resident DHHC proteins (DHHC3, -4, -8, -17, -18, and -21) had no effect on CD9 or CD151. DHHC2 selectively affected tetraspanin palmitoylation, but not the palmitoylations of integrin β4 subunit and bulk proteins visible in [3H]palmitate-labeled whole cell lysates. DHHC2-dependent palmitoylation also had multiple functional effects. First, it promoted physical associations between CD9 and CD151, and between
3 integrin and other proteins. Second, it protected CD151 and CD9 from lysosomal degradation. Third, the presence of DHHC2, but not other DHHC proteins, shifted cells away from a dispersed state and toward increased cell–cell contacts. | INTRODUCTION |
|---|
|
|
|---|
Palmitic acid is a 16-carbon fatty acid that can be added to intracellular cysteines of various cytoplasmic and transmembrane proteins, through the action of thiol-directed protein acyltransferases (PATs) (Mitchell et al., 2006
). The recently characterized "DHHC" family of PATs is composed of transmembrane proteins, typically containing four transmembrane domains and two extracellular/luminal loops, flanking a signature cytoplasmic Asp-His-His-Cys (DHHC) motif (Politis et al., 2005
; Mitchell et al., 2006
; Ohno et al., 2006
). The cysteine within the DHHC motif may play a central role in the transfer of palmitate to substrate (Mitchell et al., 2006
). There are at least 23 distinct mammalian DHHC proteins and eight yeast DHHC proteins, residing in diverse tissues and subcellular locations (Ohno et al., 2006
). A few of these DHHC proteins, possessing PAT activity, have been shown to target specific cytoplasmic substrates (Fukata et al., 2006
; Mitchell et al., 2006
).
Many transmembrane proteins undergo palmitoylation. These include not only tetraspanins but also integrins (
6,
3, and β4), claudins, G protein-coupled receptors, glutamate receptors, amino acid permeases, and soluble N-ethylmaleimide-sensitive factor attachment protein receptor proteins (Percherancier et al., 2001
; Yang et al., 2004
; Keller et al., 2004
; Hayashi et al., 2005
; Valdez-Taubas and Pelham, 2005
; Roth et al., 2006
; Kovalenko et al., 2007
). In general, palmitoylation of transmembrane proteins serves to regulate subcellular trafficking and/or protein degradation (Percherancier et al., 2001
; Hayashi et al., 2005
; Valdez-Taubas and Pelham, 2005
). Despite the functional importance of transmembrane protein palmitoylation, in only a few cases has the involvement of specific DHHC proteins been ascertained. For example, palmitoylations of yeast transmembrane proteins Tlg1 and Chs3 are mediated by DHHC proteins Swf1 (Valdez-Taubas and Pelham, 2005
) and Pfa4 (Lam et al., 2006
), respectively, whereas mammalian DHHC3/GODZ targets glutamate receptor subunits (Keller et al., 2004
; Hayashi et al., 2005
).
Given the considerable biological relevance of TEMs and their component tetraspanin proteins, and the importance of tetraspanin palmitoylation, we sought to identify specific mammalian DHHC proteins that might be involved. Using gene expression and small interfering RNA (siRNA) approaches, we implicate DHHC2 in the functionally relevant palmitoylation of multiple tetraspanin proteins.
| MATERIALS AND METHODS |
|---|
|
|
|---|
3 (A3X8 and D23) have been described previously (Stipp et al., 2003
Plasmid Construction and Mutagenesis
Cloned cDNA for DHHC2, 5, 7, 9, and 11 were from American Type Culture Collection (Manassas, VA) and DHHC15 was from Invitrogen. All (except DHHC5) were cloned into pEGFP N1 vector (Clontech, Mountain View, CA) to make C-terminal GFP fusion proteins. DHHC5 was cloned into pcDNA 3.1 vector (Invitrogen), and a FLAG tag was inserted at its C-terminal end. Inactivating point mutations in DHHC2 and -15 were generated by PCR, and cloned into pEGFP N1 vector to make C-terminal GFP fusion proteins, and then verified by DNA sequencing.
Metabolic Labeling and Immunoprecipitation
For [3H]palmitate labeling, cells (30 h after transfection) were serum starved (1.5 h) and then pulsed (2 h) with [3H]palmitic acid (0.2 mCi/ml) in a medium containing 5% dialyzed serum. After washing in phosphate-buffered saline (PBS), cells were lysed in 25 mM HEPES, 150 mM NaCl, 5 mM MgCl2, and protease inhibitor cocktail, with either 1% Brij 96 or NP-40 (1 h). After preclearing with protein G-Sepharose beads (GE Healthcare, Uppsala, Sweden), lysates containing equal amounts of protein were used for immunoprecipitation (Yang et al., 2006
). Proteins were visualized by immunoblotting, and 3H-labeled proteins were detected using BioMax MS film and Biomas TRAN-SCREEN LE intensifying screen (Eastman Kodak, Rochester, NY) for 1–2 wk at –80°C, as described previously (Yang et al., 2004
). Quantitation was done using Image Quant, version 5.2 software (GE Healthcare) or Gene Tools, version 3.00.22 (Syngene, Frederick, MD). For 35S-labeling, cells were incubated (1.5 h) in cysteine/methionine-free media, pulsed with [35S]methionine/cysteine (0.2 mCi/ml; 1.5 h) in 5% dialyzed serum, and then chased for variable times in media containing 25x unlabeled L-methionine/cysteine.
siRNA Transfection and RT-PCR
All duplex siRNAs were obtained from Dharmacon RNA Technologies (Lafayette, CO) and Ambion (Austin, TX). Sense strand codes were CCAAGGAUCUUCCCAUCUAUU (DHHC2 #6), GGAUCUUCCCAUCUAUACCtt (DHHC2 #10), GCAGGUCUUUGGCAUGA (CD151 #4), and GACAGAUGCCAACUUAUAAUU (control siRNA). Mixtures of siRNAs were used to target all other DHHC proteins. RNA duplexes were transfected using Lipofectamine RNAiMAX (Invitrogen). Cells were then used after 72 h, and the extent of knockdown was quantified by RT-PCR. Primer sequences for all DHHCs were indicated previously (Ohno et al., 2006
).
Flow Cytometry
Cells (3 d after siRNA transfection) were stained with specific mAbs (1–2 µg/well) in 96-well plates, for 30 min at 4°C. After washing with PBS, fluorescein isothiocyanate-conjugated secondary antibody was added (30 min; 4°C), and cells were analyzed by FACSCalibur (BD Biosciences). To obtain mean fluorescence intensity (MFI) values, background staining (from negative control antibody) was subtracted from specific mAb staining.
| RESULTS |
|---|
|
|
|---|
|
AA and C
S mutants of DHHC2 were prepared. Neither of these mutant forms of DHHC2 stimulated palmitoylation of Myc-tagged CD151 or CD9 in HEK293 cells (Figure 2A, left). In fact, after normalization for Myc-CD151 and Myc-CD9 recovery, the extent of palmitoylation was variably diminished compared with that yielded by wild-type DHHC2 (bar graphs). In a separate experiment, we analyzed endogenous CD9 and CD151 in a different cellular environment (A431 instead of HEK293 cells). On stable expression of DHHC2, palmitoylation of CD9 and CD151 was again increased, compared with vector control cells, whereas mutant forms of DHHC2 (DH/AA and C/S) again failed to stimulate palmitoylation (Figure 2B). Compared with wild-type DHHC2, there is 40–50% less DH/AA mutant, as seen in B and A, respectively. Nonetheless, the DH/AA mutant still inhibits palmitoylation by 30–70% in three of the four examples shown in Figure 2. Presumably, if wild-type and DH/AA proteins were present at the same level, even more inhibition would be seen. Costaining with Golgi matrix protein GM130 (Supplemental Figure 1) confirmed that DHHC2-GFP was almost entirely localized to the Golgi.
|
|
3 integrin, which is a major partner for CD151 (Figure 4A). Immunoprecipitation of control proteins such as CD147 (a cell surface IgSF protein; Tang and Hemler, 2004
3 integrin was relatively unaffected by DHHC protein expression (Figure 4B, fourth panel). Control experiments indicated that comparable amounts of CD9, CD151, and GFP-tagged DHHC proteins were present in total cell lysates (Figure 4B, bottom 3 panels).
|
3 integrin with several unknown proteins, as seen upon immunoprecipitation of
3 from [3H]palmitate-labeled 1% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate lysate (Figure 4C). Notably, association of these palmitoylated proteins was markedly diminished upon expression of the inactive DHHC2 mutants (Figure 4C). Expression of other DHHC proteins (DHHC7, -9, -11, and -5) did not enhance
3 association with these other proteins (data not shown).
Knockdown of DHHC2 Affects Tetraspanin Palmitoylation and Expression
To evaluate further the functional consequences of DHHC2-dependent palmitoylation, DHHC2 siRNA knockdown experiments were carried out. As indicated in Supplemental Figure 2A, DHHC2 was appreciably diminished (by >70%) upon treatment of HEK293 cells with two different siRNAs (#6 and #10). In parallel, steady state amounts of CD9 (Figure 5, A and B) and CD151 (Figure 5B) were also diminished (
50%), upon treatment of two different cell lines with DHHC2 siRNA, but not control siRNA. Other cellular proteins (β-catenin, c-Src, integrin
3 subunit, and actin) were unaffected (Figure 5, A and B). In a control experiment, CD151 siRNA almost eliminated CD151, without affecting CD9 or the other proteins (Figure 5B). Cell surface CD9 and CD151 were also significantly decreased (by 35–40%) in DHHC2 siRNA-treated samples, as seen by flow cytometry (Figure 5C). By contrast, levels of other cell surface proteins (integrin
3, major histocompatibility complex class I, integrin β1, EWI-F, CD44, and CD147) were relatively unchanged (Figure 5C). In another control experiment, 3H-labeled proteins in a whole cell lysate from MDA-231 cells showed minimal changes in response to DHHC2 knockdown (Figure 5D).
|
75% in HEK293 cells (Supplemental Figure 2B). However, in contrast to DHHC2 knockdown, none of these other knockdowns significantly diminished CD9 palmitoylation or protein levels (Figure 6, A and C) or CD151 protein levels (Figure 6, B and C). Control experiments show that protein levels for
3 integrin and β-catenin are not affected, even by DHHC2 (Figure 6B).
|
50%, mutant CD9 (in which 6 membrane proximal cysteines were converted to alanine) was not affected (Figure 7A, top and bar graph). In control experiments, endogenous CD151 showed 50% loss of expression, regardless of whether wild-type or mutant CD9 was present in the same cell (Figure 7A, second panel), and integrin
3 protein was unaffected (Figure 7A, third panel).
|
3, third panel) and actin (data not shown) were relatively unaffected. Another inhibitor of lysosomes (NH4Cl) and inhibitors of lysosomal proteases (leupeptin + pepstatin A) also prevented loss of CD9 and CD151 protein upon DHHC2 knockdown (Table 1), yielding recoveries (86–100%) comparable with those seen upon bafilomycin A1 treatment (59–71%). By contrast, inhibition of the ubiquitin–proteosome degradation pathway (by MG132 or ALLM), or inhibition of matrix metalloproteinases (by GM6001) mostly did not prevent loss of CD9 and CD151 that is caused by knockdown of DHHC2 (Table 1). Together, these results suggest that knockdown of DHHC2 causes a loss of CD9 and CD151 palmitoylation, leading to enhanced lysosomal proteolysis.
|
DHHC2 Knockdown Accelerates Lysosomal Degradation and Triggers Cell Dispersion
To further assess protein degradation, [35S]cysteine/methionine pulse-chase labeling experiments were performed. After treatment with siRNA, HEK293 cells were pulsed with 35S-label, chased for various time periods, and then CD9 and
3 integrin were immunoprecipitated from 1% Triton X-100 lysates. As indicated, degradation of CD9 was markedly enhanced in cells in which DHHC2 was knocked down (half-life, 10 h), compared with control siRNA-treated cells (half-life, 22 h; Figure 8A). By contrast, degradation of
3 integrin was minimally affected (Figure 8B). Diminished cell surface expression of CD151, due to knockdown of DHHC2, also could be detected by antibody staining and immunofluorescence microscopy (Figure 9). Not only was the intensity of immunofluorescent staining diminished but also cell organization was altered. In particular, most of the cells treated with DHHC2 siRNA (oligo #10) showed dispersed, single cell morphology, whereas only <10% of control cells occurred as single cells (Figure 9). Similar results were obtained using a second DHHC2 siRNA (oligo #6; data not shown). Cotransfection with a fluorescent siRNA confirmed that transfection efficiency was nearly 100% (Supplemental Figure 4).
|
|
| DISCUSSION |
|---|
|
|
|---|
Palmitoylation Specificity
Among the 12 different DHHC proteins tested either by overexpression (DHHC2, DHHC5, DHHC7, DHHC9, DHHC11, and DHHC15) or by siRNA knockdown (DHHC2, DHHC3, DHHC4, DHHC8, DHHC17, DHHC18, and DHHC21) only DHHC2 promoted tetraspanin palmitoylation. The closest homologues of DHHC2 are DHHC15 and DHHC20 (Ohno et al., 2006
). However, DHHC15 was generally much less effective than DHHC2, and it was not detectable in four of five cell lines in which CD9 and CD151 palmitoylation occurs. DHHC20 was not considered further because expression is limited to the plasma membrane (Ohno et al., 2006
). DHHC2 has also been suggested to promote palmitoylation of PSD-95, a neural synapse protein (Fukata et al., 2006
). However, 1) those results were obtained when both DHHC2 and PSD-95 substrate were highly overexpressed, and 2) DHHC2 was not as effective as DHHC15 for that substrate.
DHHC2 did not have a global effect on cellular palmitoylation. It physically associated with CD9, CD151, and to a small extent with
3 integrin, but not with control proteins (CD147 and c-Raf1). Neither overexpression nor knockdown of DHHC2 had much effect on the many proteins detectable in [3H]palmitate-labeled whole cell lysates.
Furthermore, a quantitative proteomics approach aimed at identifying DHHC2 substrates revealed 50 palmitoylated proteins that are unaffected by DHHC2, whereas one protein (called CKAP4/p63) showed only a marginal
30% decrease in palmitoylation upon DHHC2 knockdown (Zhang et al., 2008
). Also, DHHC2 overexpression did not alter integrin β4 palmitoylation, even though β4-associated CD151 was markedly affected in the same experiment. Hence, β4, a type I transmembrane protein, is palmitoylated by a different mechanism than tetraspanin proteins CD9 and CD151. Indeed, as summarized elsewhere, type I transmembrane proteins and polytopic transmembrane proteins may be palmitoylated by different DHHC PATs (Mitchell et al., 2006
; Linder and Deschenes, 2007
).
Tetraspanins CD9 and CD151 each contain six membrane-proximal cysteines (proximal to each of the four transmembrane domains), and all of these most likely undergo palmitoylation (Berditchevski et al., 2002
; Charrin et al., 2002
; Yang et al., 2002
; Kovalenko et al., 2004
). At present, we do not know whether DHHC2 targets all of these cysteines, which are each surrounded by different amino acids. There is not yet evidence for DHHC proteins recognizing specific palmitoylation motifs (Mitchell et al., 2006
). Hence, we suspect that within TEMs, DHHC2 may gain proximity to tetraspanin membrane cysteines, thereby enabling palmitoylation, regardless of flanking amino acids. Because CD9 and/or CD151 can readily associate with many other tetraspanins (e.g., CD37, CD53, CD63, CD81, CD82, and TSPAN4) (Tachibana et al., 1997
; Levy et al., 1998
), we predict that their membrane-proximal cysteines will also be palmitoylated by DHHC2. In this regard, multiple proteins containing membrane-proximal cysteines, but lacking a conserved consensus motif, were palmitoylated by Swf1, a DHHC PAT protein in yeast (Roth et al., 2006
).
Functional Consequences
DHHC2-dependent tetraspanin palmitoylation has several functional consequences. First, DHHC2 promotes TEM interactions, as evidenced by DHHC2 overexpression causing a marked increase in CD9–CD151 association. Other DHHC proteins and inactive DHHC2 mutants notably lacked this effect, indicating that enhanced palmitoylation was responsible for the increased association. Although not tested here, we suspect that homo- and hetero-clustering of many additional tetraspanins will also be promoted by DHHC2 overexpression. In this regard, prior studies involving mutation of membrane-proximal cysteines showed that palmitoylation promotes hetero- and homo-clustering among tetraspanins, including CD9, CD151, CD81, CD63, and CD53 (Berditchevski et al., 2002
; Charrin et al., 2002
; Yang et al., 2002
).
DHHC2 overexpression did not stimulate CD151 association with integrin
3β1 or
6β4. This is not surprising considering that the interaction of CD151 with integrins
3β1 and
6β4 involves a direct protein–protein interaction between extracellular domains, and it is not diminished upon mutation of CD151 palmitoylation sites (Yauch et al., 2000
; Yang et al., 2002
). Although DHHC2 did not affect β4 or
3 palmitoylation, it did promote increased association with five to seven unknown proteins associated with
3 integrin. At least one of these is likely to be autopalmitoylated DHHC2 itself. The others possibly represent additional proteins in
3–CD151–CD9 complexes that undergo enhanced palmitoylation. Their identification awaits further study.
A second functional consequence of DHHC2-dependent palmitoylation is stabilization of target protein expression. When DHHC2 was present (i.e., not siRNA depleted), detection of CD9 and CD151 was enhanced, both in total cell lysates and on the cell surface. By contrast, levels of nine other proteins were unaffected by DHHC2 depletion. Pulse-chase experiments confirmed that DHHC2 knockdown enhanced the degradation of CD9, without altering initial biosynthesis. In some cases, loss of transmembrane protein palmitoylation leads to proteolytic degradation by the ubiquitin–proteosome pathway (Valdez-Taubas and Pelham, 2005
). However, degradation of CD9 and CD151 was not affected by proteosome inhibitors MG132 and ALLM. Instead, disappearance of CD9 and CD151 was partially reversed upon treatment of cells with agents that disrupt lysosomes (bafilomycin A1 and NH4Cl) or inhibit lysosomal proteases (leupeptin + pepstatin A). In this regard, CD9 and CD151 resemble chemokine receptor CCR5. In the absence of palmitoylation, that polytopic cell surface receptor also showed enhanced degradation in lysosomes, but not proteosomes (Percherancier et al., 2001
).
Why is the palmitoylation-deficient CD9 mutant highly expressed in Figure 7A, when it should be rapidly degraded? Because palmitoylation-deficient CD151 is degraded at a faster rate (Yang et al., 2002
), we suspect that mutant CD9 may also show accelerated degradation (although we have not yet measured it). However, despite faster degradation, mutant CD151 is readily expressed on cells at a high steady-state level (Berditchevski et al., 2002
; Yang et al., 2002
), and mutant CD9 also can be expressed at high levels (Charrin et al., 2002
; Kovalenko et al., 2004
). Hence, we cannot infer much about degradation of palmitoylation-deficient CD151 or CD9 mutants from steady-state levels. Furthermore, palmitoylation-deficient CD9 and CD151 not only lose palmitoylation but also they lack membrane proximal cysteines. This could help to explain why loss of CD9 and CD151 expression is not that dramatic for palmitoylation-deficient mutants (Berditchevski et al., 2002
; Charrin et al., 2002
; Yang et al., 2002
), compared with DHHC2 knockdown conditions.
Due to rapid protein degradation, we were initially unable to capture and study CD9 and CD151 in DHHC2-depleted cells, to confirm that they were indeed deficient in palmitoylation. However, in subsequent experiments, treatment of intact cells with bafilomycin A1 inhibited protein degradation, thus enabling demonstration that palmitoylation was diminished in CD9 and CD151 proteins upon DHHC2 knockdown. Hence, tetraspanin degradation is closely related to loss of palmitoylation. Consistent with this, DHHC2 knockdown accelerated CD9 degradation to an extent similar to that seen when CD151 palmitoylation sites were mutated (Yang et al., 2002
). Also, there is precedent for protein degradation being accelerated upon loss of palmitoylation (Linder and Deschenes, 2007
). We suggest that CD151, which normally traffics through endosomal/lysosomal-type vesicles (Sincock et al., 1999
), is exposed to resident proteases when palmitoylation is impaired.
A third functional role for DHHC2 is to promote cell–cell association, as indicated by DHHC2 knockdown causing cell dispersion. Because complete substrate profiles are not known for DHHC2 or any other DHHC protein, we cannot be certain which DHHC2 substrates might be involved in the cell dispersion phenotype. However, all evidence available so far points toward tetraspanins as being major substrates (see discussion above). Tetraspanin proteins, in the context of TEMs, are associated with a variety of cellular functions (e.g., motility, morphology, signaling, and fusion) (Berditchevski et al., 2002
; Charrin et al., 2002
; Yang et al., 2002
; Zhou et al., 2004
; Cherukuri et al., 2004
; Yang et al., 2006
) that could play key roles indirectly promoting cell–cell contacts instead of cell dispersion. Notably, mutation of four CD151 palmitoylation sites previously caused a related shift in cell morphology, except that cells containing palmitoylation-deficient CD151 became more epithelial-like and less fibroblastic (Yang et al., 2002
). At present, we cannot explain why the functional consequences of diminishing palmitoylation of multiple tetraspanins (via DHHC2 knockdown) are somewhat opposite to the effects of overexpressing a single palmitoylation-deficient tetraspanin mutant. One possibility is that DHHC2 depletion effects on multiple other tetraspanins (e.g., CD9, CD82, and CD63) override its effects on CD151.
Novelty and Broader Implications
Despite the functional importance of tetraspanin palmitoylation, the responsible PAT had not been identified. Now our results strongly implicate DHHC2 as playing a major role.
The gene coding for human DHHC2 is ubiquitously expressed (Oyama et al., 2000
). Hence, DHHC2 should be widely available to promote tetraspanin palmitoylation, which has been observed in all primary cells and tumor cell lines so far examined.
In previous studies, tetraspanin palmitoylation was studied using the inhibitor 2-bromopalmitate, or by mutation of relevant cysteines. However, 2-bromopalmitate partially and nonspecifically inhibits nearly all palmitoylation, and replacement of cysteines may alter a protein in a manner that goes beyond simply preventing palmitoylation. Because we can now manipulate DHHC2, we are no longer so reliant on 2-bromopalmitate or cysteine mutagenesis to study tetraspanin palmitoylation. Indeed, our results now provide new insight into how tetraspanin palmitoylation may be selectively enhanced or inhibited, via DHHC2 overexpression, mutation, and/or knockdown. We suspect that manipulation of DHHC2 will prove to be of considerable utility in future studies aimed at understanding the functions of TEMs, because they contribute to events such as cell signaling, motility, morphology, fusion, and human immunodeficiency virus assembly.
It remains to be determined whether reduced DHHC2 expression in colorectal cancers (Oyama et al., 2000
) is associated with diminished tetraspanin palmitoylation. Also, it is intriguing to consider that a suggested tumor suppressor function for DHHC2 in colon cancer (Oyama et al., 2000
) may be related to its role in palmitoylating CD9, which itself has been suggested to be a tumor suppressor (Ikeyama et al., 1993
; Miyake et al., 2000
). Although we do not yet know which DHHC2 substrate(s) is(are) most critical, we have gained new insight into DHHC2 function. The shift of DHHC2-knockdown A431 cells from a state of cell–cell association toward one of almost complete cell dispersion resembles an epithelial-mesenchymal transition (EMT). EMT is the process in which epithelial cells lose epithelial morphology and markers and gain a fibroblastic morphology during tumor progression (Zavadil et al., 2001
; Janda et al., 2002
; Thiery, 2002
). A role for DHHC2 in maintaining an epithelial phenotype would be consistent with its putative tumor suppressor role (Oyama et al., 2000
).
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Address correspondence to: Martin E. Hemler (martin_hemler{at}dfci.harvard.edu)
Abbreviations used: DHHC, Asp-His-His-Cys motif that defines a family of enzymes involved in protein palmitoylation; PAT, protein acyl transferase; TEM, tetraspanin enriched microdomain.
| REFERENCES |
|---|
|
|
|---|
Boucheix, C., Thien Duc, G. H., Jasmin, C., and Rubinstein, E. (2001). Tetraspanins and malignancy. Expert Rev. Mol. Med 2001, 1–17.[Medline]
Charrin, S., Manie, S., Oualid, M., Billard, M., Boucheix, C., and Rubinstein, E. (2002). Differential stability of tetraspanin/tetraspanin interactions: role of palmitoylation. FEBS Lett 516, 139–144.[CrossRef][Medline]
Cherukuri, A., Carter, R. H., Brooks, S., Bornmann, W., Finn, R., Dowd, C. S., and Pierce, S. K. (2004). B cell signaling is regulated by induced palmitoylation of CD81. J. Biol. Chem 279, 31973–31982.
Fernandez-Hernando, C., Fukata, M., Bernatchez, P. N., Fukata, Y., Lin, M. I., Bredt, D. S., and Sessa, W. C. (2006). Identification of Golgi-localized acyl transferases that palmitoylate and regulate endothelial nitric oxide synthase. J. Cell Biol 174, 369–377.
Fradkin, L. G., Kamphorst, J. T., DiAntonio, A., Goodman, C. S., and Noordermeer, J. N. (2002). Genomewide analysis of the Drosophila tetraspanins reveals a subset with similar function in the formation of the embryonic synapse. Proc. Natl. Acad. Sci. USA 99, 13663–13668.
Fukata, M., Fukata, Y., Adesnik, H., Nicoll, R. A., and Bredt, D. S. (2004). Identification of PSD-95 palmitoylating enzymes. Neuron 44, 987–996.[CrossRef][Medline]
Fukata, Y., Iwanaga, T., and Fukata, M. (2006). Systematic screening for palmitoyl transferase activity of the DHHC protein family in mammalian cells. Methods 40, 177–182.[CrossRef][Medline]
Geisert, E. E., Jr., Williams, R. W., Geisert, G. R., Fan, L., Asbury, A. M., Maecker, H. T., Deng, J., and Levy, S. (2002). Increased brain size and glial cell number in CD81-null mice. J. Comp. Neurol 453, 22–32.[CrossRef][Medline]
Gourgues, M., Clergeot, P. H., Veneault, C., Cots, J., Sibuet, S., Brunet-Simon, A., Levis, C., Langin, T., and Lebrun, M. H. (2002). A new class of tetraspanins in fungi. Biochem. Biophys. Res. Commun 297, 1197–1204.[CrossRef][Medline]
Hayashi, T., Rumbaugh, G., and Huganir, R. L. (2005). Differential regulation of AMPA receptor subunit trafficking by palmitoylation of two distinct sites. Neuron 47, 709–723.[CrossRef][Medline]
Hemler, M. E. (2003). Tetraspanin proteins mediate cellular penetration, invasion and fusion events, and define a novel type of membrane microdomain. Annu. Rev. Cell Dev. Biol 19, 397–422.[CrossRef][Medline]
Hemler, M. E. (2005). Tetraspanin functions and associated microdomains. Nat. Rev. Mol. Cell Biol 6, 801–811.[CrossRef][Medline]
Huang, S. et al. (2005). The phylogenetic analysis of tetraspanins projects the evolution of cell-cell interactions from unicellular to multicellular organisms. Genomics 86, 674–684.[CrossRef][Medline]
Ikeyama, S., Koyama, M., Yamaoko, M., Sasada, R., and Miyake, M. (1993). Suppression of cell motility and metastasis by transfection with human motility-related protein (MRP-1/CD9) DNA. J. Exp. Med 177, 1231–1237.
Ishidoh, K., Takeda-Ezaki, M., Watanabe, S., Sato, N., Aihara, M., Imagawa, K., Kikuchi, M., and Kominami, E. (1999). Analysis of where and which types of proteinases participate in lysosomal proteinase processing using bafilomycin A1 and Helicobacter pylori Vac A toxin. J. Biochem 125, 770–779.
Janda, E., Lehmann, K., Killisch, I., Jechlinger, M., Herzig, M., Downward, J., Beug, H., and Grunert, S. (2002). Ras and TGFβ cooperatively regulate epithelial cell plasticity and metastasis: dissection of Ras signaling pathways. J. Cell Biol 156, 299–313.
Keller, C. A., Yuan, X., Panzanelli, P., Martin, M. L., Alldred, M., Sassoe-Pognetto, M., and Luscher, B. (2004). The gamma2 subunit of GABA(A) receptors is a substrate for palmitoylation by GODZ. J. Neurosci 24, 5881–5891.
Kovalenko, O. V., Yang, X., Kolesnikova, T. V., and Hemler, M. E. (2004). Evidence for specific tetraspanin homodimers: inhibition of palmitoylation makes cysteine residues available for cross-linking. Biochem. J 377, 407–417.[CrossRef][Medline]
Kovalenko, O. V., Yang, X. H., and Hemler, M. E. (2007). A novel cysteine crosslinking method reveals a direct association between claudin-1 and tetraspanin CD9. Mol. Cell Proteomics 6, 1855–1867.
Lam, K. K., Davey, M., Sun, B., Roth, A. F., Davis, N. G., and Conibear, E. (2006). Palmitoylation by the DHHC protein Pfa4 regulates the ER exit of Chs3. J. Cell Biol 174, 19–25.
Levy, S., and Shoham, T. (2005). The tetraspanin web modulates immune-signalling complexes. Nat. Rev. Immunol 5, 136–148.[CrossRef][Medline]
Levy, S., Todd, S. C., and Maecker, H. T. (1998). CD81 (TAPA-1): a molecule involved in signal transduction and cell adhesion in the immune system. Annu. Rev. Immunol 16, 89–109.[CrossRef][Medline]
Linder, M. E., and Deschenes, R. J. (2007). Palmitoylation: policing protein stability and traffic. Nat. Rev. Mol. Cell Biol 8, 74–84.[CrossRef][Medline]
Mitchell, D. A., Vasudevan, A., Linder, M. E., and Deschenes, R. J. (2006). Protein palmitoylation by a family of DHHC protein S-acyltransferases. J. Lipid Res 47, 1118–1127.
Mittelbrunn, M., Yanez-Mo, M., Sancho, D., Ursa, A., and Sanchez-Madrid, F. (2002). Cutting edge: dynamic redistribution of tetraspanin CD81 at the central zone of the immune synapse in both T lymphocytes and APC. J. Immunol 169, 6691–6695.
Miyake, M., Inufusa, H., Adachi, M., Ishida, H., Hashida, H., Tokuhara, T., and Kakehi, Y. (2000). Suppression of pulmonary metastasis using adenovirally motility related protein-1 (MRP-1/CD9) gene delivery. Oncogene 19, 5221–5226.[CrossRef][Medline]
Moribe, H., Yochem, J., Yamada, H., Tabuse, Y., Fujimoto, T., and Mekada, E. (2004). Tetraspanin protein (TSP-15) is required for epidermal integrity in Caenorhabditis elegans. J. Cell Sci 117, 5209–5220.
Nydegger, S., Khurana, S., Krementsov, D. N., Foti, M., and Thali, M. (2006). Mapping of tetraspanin-enriched microdomains that can function as gateways for HIV-1. J. Cell Biol 173, 795–807.
Odintsova, E., Butters, T. D., Monti, E., Sprong, H., van Meer, G., and Berditchevski, F. (2006). Gangliosides play an important role in the organisation of CD82-enriched microdomains. Biochem. J 400, 315–325.[CrossRef][Medline]
Ohno, Y., Kihara, A., Sano, T., and Igarashi, Y. (2006). Intracellular localization and tissue-specific distribution of human and yeast DHHC cysteine-rich domain-containing proteins. Biochim. Biophys. Acta 1761, 474–483.[Medline]
Oyama, T., Miyoshi, Y., Koyama, K., Nakagawa, H., Yamori, T., Ito, T., Matsuda, H., Arakawa, H., and Nakamura, Y. (2000). Isolation of a novel gene on 8p21.3–22 whose expression is reduced significantly in human colorectal cancers with liver metastasis. Genes Chromosomes Cancer 29, 9–15.[CrossRef][Medline]
Percherancier, Y., Planchenault, T., Valenzuela-Fernandez, A., Virelizier, J. L., Arenzana-Seisdedos, F., and Bachelerie, F. (2001). Palmitoylation-dependent control of degradation, life span, and membrane expression of the CCR5 receptor. J. Biol. Chem 276, 31936–31944.
Politis, E. G., Roth, A. F., and Davis, N. G. (2005). Transmembrane topology of the protein palmitoyl transferase Akr1. J. Biol. Chem 280, 10156–10163.
Roth, A. F., Wan, J., Bailey, A. O., Sun, B., Kuchar, J. A., Green, W. N., Phinney, B. S., Yates, J. R., 3rd, and Davis, N. G. (2006). Global analysis of protein palmitoylation in yeast. Cell 125, 1003–1013.[CrossRef][Medline]
Sincock, P. M., Fitter, S., Parton, R. G., Berndt, M. C., Gamble, J. R., and Ashman, L. K. (1999). PETA-3/CD151, a member of the transmembrane 4 superfamily, is localised to the plasma membrane and endocytic system of endothelial cells, associates with multiple integrins and modulates cell function. J. Cell Sci 112, 833–844.[Abstract]
Stein, K. K., Primakoff, P., and Myles, D. (2004). Sperm-egg fusion: events at the plasma membrane. J. Cell Sci 117, 6269–6274.
Stipp, C. S., Kolesnikova, T. V., and Hemler, M. E. (2003). EWI-2 regulates {alpha}3{beta}1 integrin-dependent cell functions on laminin-5. J. Cell Biol 163, 1167–1177.
Tachibana, I., Bodorova, J., Berditchevski, F., Zutter, M. M., and Hemler, M. E. (1997). NAG-2, a novel transmembrane-4 superfamily (TM4SF) protein that complexes with integrins and other TM4SF proteins. J. Biol. Chem 272, 29181–29189.
Tang, W., and Hemler, M. E. (2004). Caveolin-1 regulates matrix metalloproteinases-1 induction and CD147/EMMPRIN cell surface clustering. J. Biol. Chem 279, 11112–11118.
Thiery, J. P. (2002). Epithelial-mesenchymal transitions in tumour progression. Nat. Rev. Cancer 2, 442–454.[CrossRef][Medline]
Valdez-Taubas, J., and Pelham, H. (2005). Swf1-dependent palmitoylation of the SNARE Tlg1 prevents its ubiquitination and degradation. EMBO J 24, 2524–2532.[CrossRef][Medline]
Wright, M. D., Moseley, G. W., and van Spriel, A. B. (2004). Tetraspanin microdomains in immune cell signalling and malignant disease. Tissue Antigens 64, 533–542.[CrossRef][Medline]
Yang, X., Claas, C., Kraeft, S. K., Chen, L. B., Wang, Z., Kreidberg, J. A., and Hemler, M. E. (2002). Palmitoylation of tetraspanin proteins: modulation of CD151 lateral interactions, subcellular distribution, and integrin-dependent cell morphology. Mol. Biol. Cell 13, 767–781.
Yang, X., Kovalenko, O. V., Tang, W., Claas, C., Stipp, C. S., and Hemler, M. E. (2004). Palmitoylation supports assembly and function of integrin-tetraspanin complexes. J. Cell Biol 167, 1231–1240.
Yang, X. H., Kovalenko, O. V., Kolesnikova, T. V., Andzelm, M. M., Rubinstein, E., Strominger, J. L., and Hemler, M. E. (2006). Contrasting effects of EWI proteins, integrins, and protein palmitoylation on cell surface CD9 organization. J. Biol. Chem 281, 12976–12985.
Yauch, R. L., Kazarov, A. R., Desai, B., Lee, R. T., and Hemler, M. E. (2000). Direct extracellular contact between integrin
3β1 and TM4SF protein CD151. J. Biol. Chem 275, 9230–9238.
Zavadil, J., Bitzer, M., Liang, D., Yang, Y. C., Massimi, A., Kneitz, S., Piek, E., and Bottinger, E. P. (2001). Genetic programs of epithelial cell plasticity directed by transforming growth factor-beta. Proc. Natl. Acad. Sci. USA 98, 6686–6691.
Zhang, J., Planey, S. L., Ceballos, C., Stevens, S. M., Jr., Keay, S. K., and Zacharias, D. A. (2008). Identification of CKAP4/p63 as a major substrate of the palmitoyl acyl transferase DHHC2, a putative tumor suppressor, using a novel proteomic method. Mol. Cell Proteomics (in press).
Zhou, B., Liu, L., Reddivari, M., and Zhang, X. A. (2004). The palmitoylation of metastasis suppressor KAI1/CD82 is important for its motility- and invasiveness-inhibitory activity. Cancer Res 64, 7455–7463.
| ||||||||||||||||||||||||||||||||||||||||