![]() |
|
|
Vol. 19, Issue 8, 3536-3543, August 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




,
*Department of Pharmacology and Cancer Biology, Duke University Medical Center, Durham, NC 27710;
Department of Cell Regulation, Genentech Inc., South San Francisco, CA 94080; and
Department of Pathology, Stanford University School of Medicine, Palo Alto, CA 94022
Submitted April 23, 2008;
Revised May 30, 2008;
Accepted June 3, 2008
Monitoring Editor: Kerry S. Bloom
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
In addition to playing a role in MI, Mos kinase is a critical component of cytostatic factor (CSF), an activity required for arrest in MII (Masui and Markert, 1971
; Lorca et al., 1993
). Although Mos has been long known to act as a constituent of CSF (through activation of the MAPK pathway, as in MI; Sagata et al., 1989
; Haccard et al., 1993
), its precise mechanism of action was not clear. Recently, it was shown that Mos helps to maintain MII arrest by inhibiting degradation of substrates of the anaphase promoting complex (APC), including cyclin B and a key regulator of chromosome segregation, securin. This APC inhibitory activity of Mos is exerted through a known inhibitor of the APC, Emi2, or Erp1. In MII, Mos promotes both the stability and activity of Emi2; the ability of Emi2 to inhibit the APC is regulated through phosphorylation of its C-terminus by Cdc2 and Mos enhances Emi2 function by facilitating its PP2A-mediated dephosphorylation (Inoue et al., 2007
; Nishiyama et al., 2007
; Wu et al., 2007a
). Moreover, Mos helps to maintain steady-state levels of Emi2 by promoting the dephosphorylation of multiple Cdc2 sites on Emi2, which trigger slow degradation of Emi2 when Cdc2/cyclin B kinase levels rise above a certain threshold. At fertilization, a transient increase in cellular Ca2+ level activates calmodulin-dependent protein kinase II (CaMKII), which primes Emi2 for docking of the Polo-like kinase 1 (Plx1 in Xenopus) and subsequent Plx1-mediated Emi2 phosphorylation. This creates a phosphodegron for the E3 ligase SCFβTrcp, leading to proteasomal degradation (Liu and Maller, 2005
; Rauh et al., 2005
; Hansen et al., 2006
). When Emi2 is degraded, the APC is fully activated, releasing eggs from MII into the first embryonic cell cycle (Wu et al., 2007a
).
In comparison to MI entry and the CSF-induced MII arrest, the MI–MII transition is not well understood. However, errors in this transition, including both inappropriate MI arrest and failure to enter MII after MI exit are not uncommon and can lead to parthenogenesis and/or teratoma formation if abnormal oocytes are not properly eliminated (Hashimoto et al., 1994
; Eppig et al., 1996
). It is generally accepted that Mos is required for the MI–MII transition (Kanki and Donoghue, 1991
; Hashimoto et al., 1994
; Dupre et al., 2002
) because ablation of Mos translation clearly results in a failure of MII entry (and a consequent artificial interphase). Moreover, maintaining residual Cdc2 kinase activity at MI exit is necessary, as complete inhibition, either by chemical inhibitors or by overexpression of the inhibitory kinase Wee l promotes an artificial interphase (Iwabuchi et al., 2000
). One unsettled question, however, concerns the role of the APC in the MI–MII transition. Early studies in Xenopus oocytes indicated that the APC was dispensable for this transition, as neither antibody neutralization of the APC nor overexpression of its natural inhibitor, Mad2, inhibited the first meiotic anaphase (Peter et al., 2001
; Taieb et al., 2001
). This idea was challenged more recently by the discovery that activation of the spindle assembly checkpoint (SAC), that targets the APC in MI, could lead to MI arrest (Homer et al., 2005
). Moreover, in 2006, studies in both the Xenopus and murine oocyte systems demonstrated a requirement for Emi2 in the MI–MII transition and suggested that not only is the APC activated at MI anaphase, but also that its timely inhibition by Emi2 is required to promote entry into MII (Madgwick et al., 2006
; Ohe et al., 2007
). Although Emi2 protein has been remarkably difficult to detect in MI oocytes, it was shown that ablation of Emi2 message using antisense morpholino oligonucleotides could promote exit from MI into interphase. Moreover, overexpression of Emi2 in the immature oocyte will promote an MI arrest upon progesterone treatment. These findings argued that Emi2 is most likely present at the end of MI to prevent complete APC-mediated degradation of cyclin B, which would lead to parthenogenetic activation of the oocytes. Conversely, in order to prevent the MI arrest that would occur if cyclin B degradation were to be completely inhibited, Emi2 levels must be tightly controlled to allow only partial APC inhibition.
Though it was initially reported that Emi2 protein was present throughout oocyte maturation, multiple groups have subsequently determined that significant accumulation of Emi2 protein is prevented during MI (Liu et al., 2006
; Ohe et al., 2007
; Tung et al., 2007
). One of these groups reported that Emi2 levels are kept appropriately low in MI through the dampening of Emi2 mRNA translation (Ohe et al., 2007
). Rapid translation at the onset of MII would then allow efficient CSF arrest. However, Tung et al. (2007)
found that Emi2 mRNA polyadenylation, which governs the timing of translation, was controlled by Cdc2 and began immediately after MI entry, though Emi2 protein did not accumulate until the onset of MII. In this study, we demonstrate that translation of Emi2 does indeed occur during MI and that regulation of Emi2 levels in MI is exerted mainly at the level of protein stability. Throughout MI, Emi2 protein undergoes continuous and rapid turnover. Interestingly, we demonstrate that the same degron that controls precipitous degradation of Emi2 at exit from MII also regulates the continuous degradation of Emi2 before MI exit (Rauh et al., 2005
). Moreover, this degradation is required to prevent inappropriate MI arrest. However, unlike degradation at MII exit, MI Emi2 degradation does not appear to require Ca2+/CaMKII. Rather, phosphorylation of four sites in the Emi2 N-terminus (213/239/252/267) primes the protein for degradation through the degron site. Moreover, Mos facilitates MII entry, in large part, by promoting Emi2 stabilization through PP2A-mediated dephosphorylation of these sites, a pathway similar to that which controls slow Cdc2-mediated Emi2 degradation during MII. In concert with these observations, we have found that overall Cdc2/cyclin B kinase activity (and consequent Emi2 phosphorylation) is higher in MI than MII, providing an explanation for the instability and low abundance of Emi2 in MI that is necessary to avoid inappropriate MI arrest. Additionally, the reduction in Cdc2 kinase activity at MII, relative to MI, allows Mos/PP2A-mediated dephosphorylation of Emi2 to predominate, enhancing Emi2 stability, and allowing the prolonged arrest characteristic of MII.
| MATERIALS AND METHODS |
|---|
|
|
|---|
35S-labeled Emi2 proteins were generated using the TNT Quick-Coupled Transcription/Translation System (Promega, Madison, WI) in the presence of 35S-labeled methionine/cysteine (MP Biomedicals, Solon, OH).
Recombinant GST-Emi2 proteins (aa 489-651 T545/551A, aa 319-375, and aa 319-375 ST335AA) were prepared as previously described (Wu et al., 2007a
).
To ablate translation, 20 µM morpholino was injected to oocytes. Mos morpholino (AAGGCATTGCTGTGTGACTCGCTGA) and inverted Mos morpholino (AGTCGCTCAGTGTGTCGTTACGGAA) were purchased from Gene Tools (Philomath, OR). Emi2 morpholino was prepared as previously described (Wu et al., 2007a
).
Oocyte Injections and Lysate Preparation
Stage VI oocytes were treated with 2.8 U of liberase in OR-2 buffer (82.5 mM NaCl, 2 mM KCl, 1 mM MgCl2, 5 mM HEPES, pH 7.5) for 1.5 h at room temperature, washed extensively with OR-2 buffer, and stored in OR-2 buffer with 10% fetal bovine serum and 0.5% gentamicin at 18°C. Oocyte lysate was made by crushing oocytes in oocyte lysis buffer (20 mM HEPES KOH, pH 7.5, 20 mM β-glycerophosphate, 15 mM MgCl2, 20 mM EGTA, 1 mM PMSF, and 5 ng/µl aprotinin/leupeptin). Lysate was clarified by centrifugation to remove insoluble material. For Western blot analysis, two oocytes equivalent was loaded to each lane. For autoradiography analysis, eight oocytes equivalent was loaded. To make MI extract, oocytes were treated with progesterone, and lysate was made immediately after Germinal Vesicle Breakdown (GVBD). To make MII extract, lysate was made 4 h after GVBD.
Immunoblot and Immunoprecipitation Analysis
The antibodies used for immunoblotting were as follows: mouse anti-cyclin B2 (Casaletto et al., 2005
), rabbit anti-Emi2 (Tung et al., 2005
), mouse anti-Cdc27 (BD Biosciences, San Diego, CA), mouse anti-PP2A (Upstate Biotechnology, Lake Placid, NY), rabbit anti-phospho-MAPK (Cell Signaling Technology, Beverly, MA), rabbit anti-phospho-Cdc2 (Cell Signaling Technology), mouse anti-Myc (Santa Cruz biotechnology, Santa Cruz, CA), and mouse anti-Rsk (Santa Cruz).
Myc-Emi2 was immunoprecipitated using anti-Myc-tag-Agarose (Molecular Biology Laboratory (Heidelberg, Germany). Lambda phosphatase (New England Biolabs, Ipswich, MA) treatment was performed according to the manufacturer's instructions.
HHI Kinase Assay
Oocytes lysate was made from five oocytes per sample and flash-frozen until processed. HI kinase reaction mix (15 µl; final concentrations: 10 mM HEPES KOH, pH 7.2, 5 mM MgCl2, 50 mM NaCl, 83 µM ATP, 4.2 mM DTT, 5 µg of histone HI) and 2 µCi [
-32P]ATP were added to the extract, and the reaction was incubated at room temperature for 10 min. Samples were resolved by SDS-PAGE, and the bands corresponding to HHI were quantified with a phosphorimager (Molecular Dynamics, Sunnyvale, CA).
| RESULTS |
|---|
|
|
|---|
|
|
Mos Promotes MII Entry by Promoting Stabilization of Emi2
With the knowledge that Emi2 levels are controlled at the level of stability, we wanted to determine whether Mos controlled Emi2 stability in MI as it does in MII. As shown in Figure 3A, the Mos pathway is turned on soon after progesterone treatment, as indicated by activation of mitogen-activated protein kinase (MAPK; Figure 3A). Moreover, we could largely abrogate its activity by ablating its translation through morpholino oligonucleotide injection (on the basis of multiple experiments, we have routinely achieve a reduction in Mos activity of
75–95%, judging by the degree of MAPK phosphorylation). In the absence of Mos, oocytes were still able to initiate the maturation process (Figure 3B), though entry into MI (as indicated by GVBD) was significantly delayed (data not shown). However, oocytes lacking Mos were unable to transition appropriately to MII. Rather, oocytes exhibited complete cyclin B degradation, as was seen when Emi2 was ablated (Figure 3B). Conversely, when Emi2 expression was inhibited by injection with Emi2-directed morpholino oligonucleotides, Mos activity was unaffected, yet oocytes still failed to enter MII. These data demonstrate that the Mos–MAPK pathway itself is not sufficient to promote MII entry and strongly suggest that the role of Mos in promoting MII entry is mediated through Emi2. As Mos had been previously shown to regulate Emi2 stability in MII, we wanted to examine the effect of Mos on Emi2 stability at the end of MI. Accordingly, we again injected oocytes with Myc-tagged Emi2 mRNA appended to its own 3'-UTR, but then performed a second injection with either control or Mos-directed morpholino oligonucleotide. As shown in Figure 3D, loss of Mos resulted in a failure of Emi2 accumulation, most likely accounting for the failure in MII entry (note that samples in the right-hand panel of Figure 3D were treated with lambda phosphatase before SDS-PAGE to collapse the phosphorylated species into a single electrophoretic species). These data suggest that one crucial function of Mos in both blocking S phase initiation after MI and promoting entry into MII is to enable timely accumulation of Emi2, thereby allowing only partial, rather than full, cyclin B degradation.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Cdc2 Kinase Activity in the Control of Emi2 Stability
Although we have not excluded the possibility that the translation of Emi2 is differentially regulated during MI and MII, it is clear that the rapid degradation of Emi2 is required to allow MI exit. This degradative process relies on the high Cdc2 kinase activity characteristic of MI. When Cdc2 kinase activity was raised in MII to mimic the higher levels found in MI, Emi2 was commensurately destabilized, consistent with this being a key determinant of Emi2 destabilization in MI. Although the Cdc2 kinase activity differed in MI and MII, we found that levels of cyclin B were very similar in MI and MII oocytes (Figure 3A; compare the 1.5- and 5.5-h time points). We speculate that the differing Cdc2 kinase activities at these two developmental stages could stem from higher levels of Ringo protein in MI than in MII (Gutierrez et al., 2006
). Alternatively, regulation of Cdc2 by Cks proteins may also dictate differential kinase activity. It was reported that knockout of Cks2 in mouse promoted an MI arrest, though the reason for this was unclear (Spruck et al., 2003
). It is possible that loss of Cks2 in the knockout lowered Cdc2 kinase activity in meiosis I, leading to inappropriate Emi2 stabilization. Finally, differential Wee1 levels may be another critical factor in determining Cdc2 activity (Kosaka et al., 2000
). Because premature Wee1 expression arrests oocytes at MI, the MII-specific appearance of Wee1 could potentially lessen Emi2-directed Cdc2 kinase activity sufficiently to allow PP2A to prevail; this would maintain Emi2 in the stable and active configuration necessary for MII arrest.
Differential Control of the APC in MI and MII
In MII, when cyclin B levels rise through de novo synthesis, there is a feedback loop operative in which elevated Cdc2 kinase activity leads to Emi2 dissociation from the APC. This dissociation allows cyclin degradation sufficient to restore Cdc2 kinase activity to the baseline levels characteristic of CSF arrest. When Cdc2 kinase activity drops sufficiently, Emi2 reassociates with the APC, maintaining its inhibition. On the face of it, it is perplexing that all of the components critical for operation of this loop could potentially be present in MI, yet this feedback pathway does not appear to operate at this cell cycle stage. This is most likely due to the fact that the spindle checkpoint is operative in MI (Wassmann et al., 2003
), but not during MII arrest (Tsurumi et al., 2004
). This checkpoint results in profound APC inhibition until the metaphase I plate is formed, allowing constitutively high Cdc2 kinase activity and consequently rapid Emi2 turnover. Once the metaphase plate is formed and chromosomes are properly attached to the spindle, the checkpoint signal dissipates, leading to APC activation and cyclin B degradation. Only then is Emi2 able to accumulate, preventing complete degradation of cyclin B. This prevents interphase entry, allowing transition directly into MII.
Mos and the MI–MII Transition
Although Mos had been implicated in regulating the MI–MII transition, the mechanism was not clear. We have provided a distinct mechanism to explain the role of Mos in regulating this transition: Mos helps to stabilize Emi2 at the end of MI, thus maintaining Emi2 at levels that partially inhibit the APC, allowing incomplete cyclin B destruction. The ability of Mos to modulate Emi2 in MI appears to reside, as in MII, with the Rsk-mediated recruitment of PP2A to Emi2. Although Mos has been implicated in suppressing the Cdc2 inhibitor MytI at MI entry, because Mos-Rsk kinase activities appeared to be similar in MI and MII, Mos is unlikely to account for the observed differences in Cdc2 kinase activity between MI and MII (Palmer et al., 1998
). In addition, similar Mos-mediated targeting of PP2A to Emi2 was observed in MI and MII. Thus, it is likely that similar phosphatase activities appear to be differentially effective given the different levels of antagonistic Cdc2 kinase activity. Taken together, these findings suggest that the smooth transition from MI to MII is a finely balanced process wherein higher Cdc2 kinase levels in MI than in MII renders Emi2 unstable in MI, but at the anaphase of MI, decreased kinase activity can be counterbalanced by Mos activity, which is critical to allow timely accumulation of Emi2 and the partial cyclin B degradation characteristic of the MI–MII transition.
An Autoinhibitory Loop Regulates APC Activity during the MI–MII Transition
Although exit from MI requires cyclin B degradation, residual cyclin B/Cdc2 kinase activity is known to be required for transiting from MI to MII. However, the mechanism underlying the delicate control of cyclin B degradation at MI–MII has not been clear. With the finding that Cdc2 and Mos coordinately control Emi2 stability, we now propose a model of APC-directed APC inhibition to ensure a smooth MI–MII transition. Before the onset of MI anaphase, Emi2 protein levels are held in check by Cdc2 kinase–mediated destabilization. APC activation then results in decreased Cdc2 kinase activity as cyclin B levels drop. With the Mos–PP2A pathway promoting Emi2 dephosphorylation, Emi2 can accumulate and effectively inhibit the APC. This leads to appropriately-timed stabilization of cyclin B and subsequent entry into MII without an intervening interphase. Although other regulatory pathways no doubt contribute to ensuring the smooth progression from MI to MII, this autoinhibitory regulation loop of APC plays critical role in regulating the meiotic transitions.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
These authors contributed equally to this work. ![]()
Address correspondence to: Sally A. Kornbluth (kornb001{at}mc.duke.edu)
| REFERENCES |
|---|
|
|
|---|
Doree, M., and Hunt, T. (2002). From Cdc2 to Cdk1: when did the cell cycle kinase join its cyclin partner? J. Cell Sci 115, 2461–2464.
Dupre, A., Jessus, C., Ozon, R., and Haccard, O. (2002). Mos is not required for the initiation of meiotic maturation in Xenopus oocytes. EMBO J 21, 4026–4036.[CrossRef][Medline]
Eppig, J. J., Wigglesworth, K., Varnum, D. S., and Nadeau, J. H. (1996). Genetic regulation of traits essential for spontaneous ovarian teratocarcinogenesis in strain LT/Sv mice: aberrant meiotic cell cycle, oocyte activation, and parthenogenetic development. Cancer Res 56, 5047–5054.
Ferby, I., Blazquez, M., Palmer, A., Eritja, R., and Nebreda, A. R. (1999). A novel p34(cdc2)-binding and activating protein that is necessary and sufficient to trigger G(2)/M progression in Xenopus oocytes. Genes Dev 13, 2177–2189.
Frank-Vaillant, M., Jessus, C., Ozon, R., Maller, J. L., and Haccard, O. (1999). Two distinct mechanisms control the accumulation of cyclin B1 and Mos in Xenopus oocytes in response to progesterone. Mol. Biol. Cell 10, 3279–3288.
Gutierrez, G. J., Vogtlin, A., Castro, A., Ferby, I., Salvagiotto, G., Ronai, Z., Lorca, T., and Nebreda, A. R. (2006). Meiotic regulation of the CDK activator RINGO/Speedy by ubiquitin-proteasome-mediated processing and degradation. Nat. Cell Biol 8, 1084–1094.[CrossRef][Medline]
Haccard, O., Sarcevic, B., Lewellyn, A., Hartley, R., Roy, L., Izumi, T., Erikson, E., and Maller, J. L. (1993). Induction of metaphase arrest in cleaving Xenopus embryos by MAP kinase. Science 262, 1262–1265.
Hansen, D. V., Tung, J. J., and Jackson, P. K. (2006). CaMKII and polo-like kinase 1 sequentially phosphorylate the cytostatic factor Emi2/XErp1 to trigger its destruction and meiotic exit. Proc. Natl. Acad. Sci. USA 103, 608–613.
Hashimoto, N. et al. (1994). Parthenogenetic activation of oocytes in c-mos-deficient mice. Nature 370, 68–71.[CrossRef][Medline]
Homer, H. A., McDougall, A., Levasseur, M., Yallop, K., Murdoch, A. P., and Herbert, M. (2005). Mad2 prevents aneuploidy and premature proteolysis of cyclin B and securin during meiosis I in mouse oocytes. Genes Dev 19, 202–207.
Inoue, D., Ohe, M., Kanemori, Y., Nobui, T., and Sagata, N. (2007). A direct link of the Mos-MAPK pathway to Erp1/Emi2 in meiotic arrest of Xenopus laevis eggs. Nature 446, 1100–1104.[CrossRef][Medline]
Iwabuchi, M., Ohsumi, K., Yamamoto, T. M., Sawada, W., and Kishimoto, T. (2000). Residual Cdc2 activity remaining at meiosis I exit is essential for meiotic M-M transition in Xenopus oocyte extracts. EMBO J 19, 4513–4523.[CrossRef][Medline]
Jones, K. T. (2004). Turning it on and off: M-phase promoting factor during meiotic maturation and fertilization. Mol. Hum. Reprod 10, 1–5.
Kanki, J. P., and Donoghue, D. J. (1991). Progression from meiosis I to meiosis II in Xenopus oocytes requires de novo translation of the mosxe protooncogene. Proc. Natl. Acad. Sci. USA 88, 5794–5798.
Karaiskou, A., Perez, L. H., Ferby, I., Ozon, R., Jessus, C., and Nebreda, A. R. (2001). Differential regulation of Cdc2 and Cdk2 by RINGO and cyclins. J. Biol. Chem 276, 36028–36034.
Kosaka, Y., Yamaya, M., Nakajoh, K., Matsui, T., Yanai, M., and Sasaki, H. (2000). Prognosis of elderly patients with dysphagia in Japan. Gerontology 46, 111–112.[CrossRef][Medline]
Liu, J., Grimison, B., Lewellyn, A. L., and Maller, J. L. (2006). The anaphase-promoting complex/cyclosome inhibitor Emi2 is essential for meiotic but not mitotic cell cycles. J. Biol. Chem 281, 34736–34741.
Liu, J., and Maller, J. L. (2005). Calcium elevation at fertilization coordinates phosphorylation of XErp1/Emi2 by Plx1 and CaMK II to release metaphase arrest by cytostatic factor. Curr. Biol 15, 1458–1468.[CrossRef][Medline]
Lorca, T., Cruzalegui, F. H., Fesquet, D., Cavadore, J. C., Mery, J., Means, A., and Doree, M. (1993). Calmodulin-dependent protein kinase II mediates inactivation of MPF and CSF upon fertilization of Xenopus eggs. Nature 366, 270–273.[CrossRef][Medline]
Madgwick, S., Hansen, D. V., Levasseur, M., Jackson, P. K., and Jones, K. T. (2006). Mouse Emi2 is required to enter meiosis II by reestablishing cyclin B1 during interkinesis. J. Cell Biol 174, 791–801.
Masui, Y. (2001). From oocyte maturation to the in vitro cell cycle: the history of discoveries of Maturation-Promoting Factor (MPF) and Cytostatic Factor (CSF). Differentiation 69, 1–17.[CrossRef][Medline]
Masui, Y., and Markert, C. L. (1971). Cytoplasmic control of nuclear behavior during meiotic maturation of frog oocytes. J. Exp. Zool 177, 129–145.[CrossRef][Medline]
Nishiyama, T., Ohsumi, K., and Kishimoto, T. (2007). Phosphorylation of Erp1 by p90rsk is required for cytostatic factor arrest in Xenopus laevis eggs. Nature 446, 1096–1099.[CrossRef][Medline]
Ohe, M., Inoue, D., Kanemori, Y., and Sagata, N. (2007). Erp1/Emi2 is essential for the meiosis I to meiosis II transition in Xenopus oocytes. Dev. Biol 303, 157–164.[CrossRef][Medline]
Palmer, A., Gavin, A. C., and Nebreda, A. R. (1998). A link between MAP kinase and p34(cdc2)/cyclin B during oocyte maturation: p90(rsk) phosphorylates and inactivates the p34(cdc2) inhibitory kinase Myt1. EMBO J 17, 5037–5047.[CrossRef][Medline]
Peter, M., Castro, A., Lorca, T., Le Peuch, C., Magnaghi-Jaulin, L., Doree, M., and Labbe, J. C. (2001). The APC is dispensable for first meiotic anaphase in Xenopus oocytes. Nat. Cell Biol 3, 83–87.[CrossRef][Medline]
Peter, M., Labbe, J. C., Doree, M., and Mandart, E. (2002). A new role for Mos in Xenopus oocyte maturation: targeting Myt1 independently of MAPK. Development 129, 2129–2139.
Rauh, N. R., Schmidt, A., Bormann, J., Nigg, E. A., and Mayer, T. U. (2005). Calcium triggers exit from meiosis II by targeting the APC/C inhibitor XErp1 for degradation. Nature 437, 1048–1052.[CrossRef][Medline]
Sagata, N., Oskarsson, M., Copeland, T., Brumbaugh, J., and Vande Woude, G. F. (1988). Function of c-mos proto-oncogene product in meiotic maturation in Xenopus oocytes. Nature 335, 519–525.[CrossRef][Medline]
Sagata, N., Watanabe, N., Vande Woude, G. F., and Ikawa, Y. (1989). The c-mos proto-oncogene product is a cytostatic factor responsible for meiotic arrest in vertebrate eggs. Nature 342, 512–518.[CrossRef][Medline]
Spruck, C. H., de Miguel, M. P., Smith, A. P., Ryan, A., Stein, P., Schultz, R. M., Lincoln, A. J., Donovan, P. J., and Reed, S. I. (2003). Requirement of Cks2 for the first metaphase/anaphase transition of mammalian meiosis. Science 300, 647–650.
Taieb, F. E., Gross, S. D., Lewellyn, A. L., and Maller, J. L. (2001). Activation of the anaphase-promoting complex and degradation of cyclin B is not required for progression from Meiosis I to II in Xenopus oocytes. Curr. Biol 11, 508–513.[CrossRef][Medline]
Tsurumi, C., Hoffmann, S., Geley, S., Graeser, R., and Polanski, Z. (2004). The spindle assembly checkpoint is not essential for CSF arrest of mouse oocytes. J. Cell Biol 167, 1037–1050.
Tung, J. J., Hansen, D. V., Ban, K. H., Loktev, A. V., Summers, M. K., Adler, J. R., 3rd, and Jackson, P. K. (2005). A role for the anaphase-promoting complex inhibitor Emi2/XErp1, a homolog of early mitotic inhibitor 1, in cytostatic factor arrest of Xenopus eggs. Proc. Natl. Acad. Sci. USA 102, 4318–4323.
Tung, J. J., Padmanabhan, K., Hansen, D. V., Richter, J. D., and Jackson, P. K. (2007). Translational unmasking of Emi2 directs cytostatic factor arrest in meiosis II. Cell Cycle 6, 725–731.[Medline]
Wassmann, K., Niault, T., and Maro, B. (2003). Metaphase I arrest upon activation of the Mad2-dependent spindle checkpoint in mouse oocytes. Curr. Biol 13, 1596–1608.[CrossRef][Medline]
Wu, J. Q., Hansen, D. V., Guo, Y., Wang, M. Z., Tang, W., Freel, C. D., Tung, J. J., Jackson, P. K., and Kornbluth, S. (2007a). Control of Emi2 activity and stability through Mos-mediated recruitment of PP2A. Proc. Natl. Acad. Sci. USA 104, 16564–16569.
Wu, Q. et al. (2007b). A role for Cdc2- and PP2A-mediated regulation of Emi2 in the maintenance of CSF arrest. Curr. Biol 17, 213–224.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
J. E. Holt and K. T. Jones Control of homologous chromosome division in the mammalian oocyte Mol. Hum. Reprod., March 1, 2009; 15(3): 139 - 147. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Q. Wu and S. Kornbluth Across the meiotic divide - CSF activity in the post-Emi2/XErp1 era J. Cell Sci., November 1, 2008; 121(21): 3509 - 3514. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||