![]() |
|
|
Vol. 19, Issue 8, 3554-3563, August 2008
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



,||
,||
,||
,||
*Department of Structural and Functional Biology, University of Insubria, 21052 Busto Arsizio (VA), Italy;
Department of Experimental Oncology, European Institute of Oncology, 20141 Milano, Italy; ¶BioCenter and Center for Integrated Protein Science (CIPS), Ludwig-Maximilians-Universität München (LMU), D-82152 Planegg-Martinsried Munich, Germany;
Département de Biologie du Cancer, Institut de Génétique et de Biologie Moléculaire et Cellulaire, Institut National de la Santé et de la Recherche Médicale U596, Centre National de la Recherche Scientifique Unité Mixte de Recherche 7104, Université Louis Pasteur Strasbourg, 67400 Illkirch Cedex, Strasbourg, France; ||Tranfected Cell Array Platform, Cancéropôle du Grand Est, 67400 Illkirch Cedex, Strasbourg, France
Submitted October 22, 2007;
Revised May 12, 2008;
Accepted May 16, 2008
Monitoring Editor: Yixian Zheng
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
These highly compacted chromatin structures are easily detectable in mouse cells; they form the characteristic nodules stained by 4,6-diamidino-2-phenylindole (DAPI) and are mainly constituted of pericentromeric heterochromatin (PH). In mammals, PH is characterized by repeated DNA sequences, by high levels of specifically methylated forms of histone H3 and H4, by deacetylated histone H4, and by methylated DNA. These epigenetic modifications represent binding substrates for chromatin modifiers, like HP1 and MeCP2, that are thought to contribute both to the highly silent environment and to the structural organization of this chromatin compartment (Maison and Almouzni, 2004
; Brero et al., 2005
). Apparently, the high content of repeated DNA sequences in heterochromatin enhances the condensation and aggregation properties that characterize these heterochromatin regions (Barr and Ellison, 1972
).
During middle S phase, these highly compacted structures must be opened to allow the replication machinery to proceed along DNA and to reconstitute the epigenetic marks and the silent state of this chromatin area. It has been proposed that these events occur at the pericentromeric duplication body (pHDB; Quivy et al., 2004
), in which parental chromatin from the interior is pulled out to the periphery, becomes transiently disrupted during replication, reassembled to form new chromatin, and finally pushed back inside the domain. The molecular mechanisms that produce the dynamic conformational changes of chromocenters are poorly understood although a role for some proteins has been proposed (Brero et al., 2005
).
Np95 is a cell cycle–regulated and histone-binding protein expressed only in proliferating cells and involved in PH replication and formation (Papait et al., 2007
). At the time of PH replication, Np95 specifically relocalizes to chromocenters where it gets highly concentrated in the areas of active replication known as the PH duplication body (pHDB; Quivy et al., 2004
). These areas correspond to less compacted DNA where the parental DNA is pulled out from the central core of the chromocenter and replicated. Newly synthesized nucleosomes are then deposited and epigenetically modified to allow the formation of new heterochromatin domains. Np95 is part of the pHDB, and its ablation in the cell strongly reduces both DNA duplication of this area and PH reformation. This involves modification of the acetylation status of lysines 8, 12, and 16 of histone H4 and the silencing of major satellite repeats. Very recent studies show that UHRF1 plays a role in maintaining DNA methylation in mammalian cells by recruiting DNMT1 to hemi-methylated DNA (Bostick et al., 2007
; Sharif et al., 2007
), adding more evidence for a key role of Np95 in PH replication and in the maintenance of the epigenetic modifications required for PH formation.
In this article, we investigated the possibility that Np95 might have a role in the control of large-scale reorganization of chromocenters, thereby possibly contributing to the dynamic changes of these dense chromatin areas that occur during PH replication.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Mouse Suv39h1/2 double-null (dn; Peters et al., 2001
), dnmt1, 3a, and 3b triple knockout (dnmt TKO) embryonic stem (ES) cells (Tsumura et al., 2006
), and wild-type mouse fibroblasts (NIH-3T3) were cultured in DMEM supplemented with 10% fetal bovine serum (Seromed, Berlin, Germany).
DNA Transfection and RNA Interference
NIH-3T3 cells were transfected with vectors expressing myc-tagged Np95 using FuGENE 6 (Roche, Indianapolis, IN) according to the manufacture's instructions. For experiments in Figure 5, 2 µg of pcDNA3.1-myc-his tag (Invitrogen, Carlsbad, CA) recombinant plasmids containing the wild type (wt), and the deletion mutants indicated in Figure 5 were transfected into NIH3T3 and Suv39h1/2dn cells using (Lipofectamine, Invitrogen). Forty-eight hours later, cells were fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) at room temperature (RT) for 10 min or pretreated with 0.5% Triton X-100 in PBS for 10 min on ice before fixation. Fixed cells were then permeabilized with 1% Triton X-100 in PBS for 10 min, followed by incubation in blocking solution (2% bovine serum albumin in PBS) for 30 min. dnmt TKO ES cells were transfected using FuGene HD (Roche) transfection reagent according to the manufacturer's instructions.
For RNA interference, NIH3T3 cells were transfected with 20 nM small interfering RNA (siRNA) duplex using Oligofectamine (Invitrogen). Two rounds of transfection were done for all experiments. Cells were analyzed 24 h after the last transfection. siRNA oligos were from Ambion (Austin, TX), and the targeting sequences were as follows: RNA interference (RNAi) control: AAAACGAGGCAGGAAAGGCGGTT; RNAi Np95: AACGCGGCTTCTGGTATGATGTT.
Protein Extraction and Immunofluorescence
Proteins were extracted as described previously (Citterio et al., 2004
). Triton X-100 extraction was performed by treating with 0.5% Triton X-100 in PBS for 10 min on ice, followed by three washes in PBS, before lysis or immunofluorescence.
FISH and Immunofluorescence
Immunofluorescence procedures were as described previously (Citterio et al., 2004
). Antibodies used were as follows: rabbit polyclonals anti-Np95 (Bonapace et al., 2002
); anti-HP1
, β, and
(Euromedex, Strasbourg, France); goat polyclonal anti-lamin B (Santa Cruz Biotechnology, Santa Cruz, CA). anti-MeCP2 (Sigma-Aldrich, St. Louis, MO), anti-H:K9met3 and anti-H4:K20 (Abcam, Cambridge, United Kingdom), mouse monoclonal anti-5mC (Calbiochem, Darmstadt, Germany). Secondary antibodies were from Jackson Laboratories (Bar Harbor, ME). Nuclear counterstaining was performed with DAPI. Samples for DNA-FISH were mounted in Vectashield antifade (Vector Laboratories, Burlingame, CA), whereas for immunofluorescence, with Mowiol (Calbiochem).
FISH with a mouse major satellite-specific probe was performed as described in Weierich et al. (2003)
. In brief, NIH-3T3 cells were fixed with 4% paraformaldehyde (PFA) in 1x PBS 36 h after DNA transfection. Cells were permeabilized with 0.5% Triton X-100/1x PBS followed by incubation in 20% glycerol and a repeated freezing-thawing step in liquid nitrogen. Finally, incubated in 0.1 N HCl for 5 min. Until hybridization, coverslips with fixed and pretreated cells were stored in 50% formamid/2x SSC at 4°C.
The probe was generated by PCR using 5'-GACGACTTGAAAAATGACGAAATC-3' (MajF1-for) and 5'-CATATTCCAGGTCCTTCAGTGTGC-3' (MajR1-rev) as primers and pCR4-MajSat9-2 plasmid as template (kind gift from T. Jenuwein, Research Institute of Molecular Pathology and The Vienna Biocenter, Vienna, Austria) and labeled by nick translation using Biotin-16-dUTP (Roche).
Labeled DNA was coprecipitated with salmon sperm DNA and mouse Cot-1. Hybridization mixture in all cases consisted of 50% formamid/10% dextran sulfate/2x SSC. Cells and probe DNA were denatured simultaneously at 75°C for 2 min and hybridization was performed for 2 or 3 d at 37°C on a hot-block in humid conditions, and posthybridization washes were performed with 2x SSC at 37°C and 0.1x SSC at 60°C, respectively. Bio-16-dUTP in major satellite probe was detected by two layers of avidin-Alexa488 (Molecular Probes, Eugene, OR) and FITC-conjugated goat anti-avidin antibodies (Vector Laboratories).
Cells were analyzed with a fluorescent microscope (BX51; Olympus, Melville, NY) equipped with 100x plan. Pictures were acquired with a color camera (DP50; Olympus). Blots were digitalized with an Epson scan system (Expression 1600 Pro; Epson, Long Beach, CA).
Picture Management
All pictures were managed with Adobe Photoshop (Adobe Systems, San Jose, CA) and Canvas (Deneba Software, Miami, FL). Quantitative analysis of chromocenters of Figure 1 were done with ImageJ (http://rsb.info.nih.gov/ij/; National Institutes of Health, Bethesda, MD).
|
| RESULTS |
|---|
|
|
|---|
To this end, we treated NIH-3T3 cells with siRNA against Np95, which resulted in a reduction of Np95 protein. This caused clustering of PH, visualized by a reduction in the number (Figure 1A; cf. picture 3 with 4; and 1B: cf. picture 7 with 8) and an increase in the size (Figure 1B; cf. picture 7 with 8) of the intense DAPI spots corresponding to chromocenters. We performed a quantitative analysis with ImageJ software (NIH; version 1.32j) to calculate the number and the size of chromocenters in RNAi-control (ctrl) and RNAi-Np95–treated cells (Figure 1B, pictures 9 and 10). The analysis of
200 cells per experiment per treatment is shown in Figure 1, C and D. In RNAi-Np95 experiments, 88% of the cells display 20 or less chromocenters, whereas in RNAi-ctrl experiments <42% of cells display this number of chromocenters (Figure 1C), as shown previously for NIH-3T3 cells (Cerda et al., 1999
). The differences become more obvious when counting the number of cells that display 15 or less chromocenters: more than 57% in the RNAi-Np95–treated cells and around 13% in RNAi-ctrl treated cells. The average size of the chromocenters in RNAi-Np95–treated cells is more than double with respect to the RNAi-ctrl cells (Figure 1D).
Clustering of chromocenters (present results) and impairment of PH replication in the absence of Np95 (Papait et al., 2007
), together with the specific relocalization of Np95 to PH in middle S phase and association to the areas of less dense chromatin (Papait et al., 2007
), argue in favor of a role of the protein in chromocenter dynamics.
Clustering of PH Is Independent from Alterations of HP1, Histone H3:K9, and H4:K20 Methylation
We next checked if this clustering was accompanied by modifications of H3:K9 and H4:K20 trimethylation levels, two of the most relevant epigenetic modifications of this chromatin compartment. We also monitored the distribution and expression level of HP1, a key protein for PH organization.
As Figure 2 shows, no significant alterations of these three pericentromeric markers are observed in RNAi-Np95 experiments. The increased size of HP1, H3:K9met3, and H4:K20met3 dots observed in the absence of Np95, in fact, parallels the variations observed for the DAPI staining (cf. in Figure 2A, pictures b, e, h, k, n, and q, respectively, with c, f, i, l, o, and r). Western blots performed on protein extracts obtained from Np95-depleted or control cells indicate no major alterations of these markers, even when cells were pretreated with Triton X-100 to extract proteins weakly bound to chromatin (Figure 2B). A slight increase in HP1
and H4:K20met3 was observed.
|
|
Overexpression of Np95 and of ICBP90 Mislocalizes HP1
, -β, and -
from PH
To verify this hypothesis, we overexpressed Np95-ICBP90 in NIH-3T3 cells. In Figure 4, we show that infection with a recombinant adenovirus expressing Np95 (AdNp95; Bonapace et al., 2002
), but not the control adenovirus (Ad-TRACK), causes an alteration of the immunofluorescence distribution of HP1 in a dose-dependent manner (see Figure 4C for the overexpression levels of Np95 after infection). HP1 is displaced from the heterochromatic DAPI spots and becomes diffused in the nucleoplasm (cf. pictures b with e, h, and m in Figure 4, A and B). The effect on HP1 was confirmed by transfection experiments, which showed that overexpression of recombinant myc-tagged Np95-wt protein displaced all three forms of endogenous HP1 (HP1
, -β, and -
) from PH (Figure 4D; cf. pictures b, h and p, respectively with e, m, and s). Confocal microscopy corroborated the results (Figure 4E; cf. pictures b with e). The same outcome was obtained with transfection of myc-tagged ICBP90-wt protein, indicating that higher cellular levels of either the human and the murine proteins displace HP1 from PH (Figure 4F; cf. pictures b with e).
|
Fluorescent in situ hybridization with a major satellite probe showed that dispersion of DAPI-bright chromocenters is accompanied by a similar decondensation of pericentromeric satellite DNA (Lehnertz et al., 2003
; Figure 4G, cf. picture b with e).
Immunodecoration of overexpressed and fixed cells with antibodies against trimethylated H3:K9 and H4:K20 shows that the distribution of these PH markers mirrors the altered DAPI staining (Figure 5A; cf. respectively, pictures 4 and 6 with 13 and 15; and 7 and 9 with 16 and 18). Strikingly, the decondensation effect of chromocenters is observed also in Suv39h1/2dn double null cells, which lack H3:K9met3, and in dnmt TKO ES cells, which lack DNA methylation. (Tsumura et al., 2006
; Figure 5A; cf. respectively, pictures 19 and 21 with 22 and 24 for the Suv39h1/2dn cells; in this case the specific Ab utilized is anti-5-methyl-cytosine; and 26 with 28 for TKO cells). MeCP2 has been shown to play a relevant role in chromocenter dynamics and to induce chromocenter clustering during terminal differentiation and in overexpression independently from the H3:K9 trimethylation pathway (Brero et al., 2005
). Figure 5A (pictures 10, 11, and 12) shows that overexpression of Np95 delocalizes MeCP2, which also mirrors the altered DAPI staining. This suggests that overexpression of Np95 is able to counteract the chromocenter clustering effect of MeCP2.
|
The delocalization of HP1 and the dissolving effect on chromocenters was also independent of the cell cycle. Overexpression of Ad-Np95 in serum-starved NIH-3T3 cells, a cell cycle phase in which the protein is completely absent, had the same effect as that in asynchronously growing cells (Figure 5C).
The pattern of bromodeoxyuridine (BrdU) incorporation in growing cells after transfection of recombinant myc-tagged Np95-wt reflected the altered DNA organization. No specific replication foci were observable, and the BrdU was distributed homogenously throughout the nucleus (Figure 5D), although it resulted less intense, once more indicating that higher amounts of Np95 profoundly modified chromatin organization.
Altogether, these results indicate that large-scale chromocenter modifications induced by the overexpression of Np95 are independent of the H3:K9met3-H4:K20met3-HP1 pathways, DNA methylation, and the clustering activity of MeCP2, and are independent from the cell cycle.
The PHD Domain Is Essential for the Large-Scale Changes in Chromocenter Structure
To investigate which domain of Np95-ICBP90 is involved in large-scale chromocenter modifications, we performed overexpression experiments in NIH3T3, Suv39h1/2dn, and TKO cells with various recombinant Np95 deletion mutants.
Np95 contains several protein domains. Progressing from the N to the C terminus, these are: a Ub-like domain, a putative nuclear localization signal, a PHD domain, an SRA-YDG domain and a RING finger domain (Figure 6B). In a previous study, we showed that Np95 is a RING-type E3 ubiquitin ligase (Citterio et al., 2004
). The SRA-YDG domain has been implicated in the control of DNA methylation (Unoki et al., 2004
; Bostick et al., 2007
; Johnson et al., 2007
; Sharif et al., 2007
), the recruitment of HDAC (Unoki et al., 2004
), and transcriptional silencing of major satellites (Papait et al., 2007
). We constructed deletion mutants of each of these domains (Figure 6B) and evaluated the effects of their expression on the stability of chromocenters by immunofluorescence with antibodies against HP1
and by staining the PH areas with DAPI. Only those constructs retaining the PHD domain (Figure 6B, Np95-wt, -1-719, -1-590, -1-419, -82-782, and -
-SRA) were able to disaggregate chromocenters and to delocalized HP1
from PH regions (Figure 6A; for HP1, cf. images 12, 13, 14, 15, 17, and 18 with 16, 19, and 20; for DAPI, cf. images 22, 23, 24, 25, and 27 with 26, 29, and 30). Deletion of the PHD domain only (Figure 6A,
-PHD mutant) is sufficient to impair the large-scale modifications observed with the wild-type protein in either NIH-3T3, Suv39h1/2dn or dnmt TKO cells. It has been shown that a RING point domain, but not ICBP90wt causes large-scale chromocenter changes (Karagianni et al., 2008
). Our experiments in at least three type of mouse cells (NIH-3T3, Suv39h1/2dn, and TKO) indicate that overexpression of Np95wt or ICBP90wt or of the deletion mutants
-SRA,
-RING,
-ubiquitin-like domain (82-782), but not
-PHD always causes large-scale chromocenter modifications.
|
Np95 Increases the Access of Restriction Enzymes to DNA Packaged into Nucleosomal Arrays
During PH replication in middle S phase, the bulk of Np95 specifically relocalizes to and gets highly concentrated in the chromocenters where it occupies the areas of less compacted DNA that correspond to "replication factories." The disaggregating effects we observe on chromocenters in overexpression experiments suggest that, in living cells, Np95 might contribute to the opening and/or stabilization of the dense chromatic structure to support the access and recruitment of modifying enzymes required for replication and formation of PH.
We therefore used in vitro experiments to investigate if Np95 is able to facilitate the access to modifying enzymes (restriction enzyme SfcI) to DNA (pFM218-H5 plasmid) packaged into nucleosome arrays (Figure 7A). This type of assay has been used by various authors to assess the chromatin accessibility activity of various protein complexes in vitro (Almer et al., 1986
; Varga-Weisz et al., 1997
; Boyer et al., 2000
; Shen et al., 2000
; Alexiadis and Kadonaga, 2002
). Recombinant GST-Np95 was incubated with reconstituted chromatin in the presence or absence of the restriction enzyme SfcI, separated by agarose gel electrophoresis, and visualized by hybridization with radiolabeled pFM218-H5 plasmid DNA. Figure 7B shows that 1 or 2 µg of GST-Np95 (Figure 7B, lanes 6 and 7), 2 µg of ICBP90 (Figure 7B, lane 14), and 200 ng of the positive control (Drosophila nuclear extracts; Figure 7B, lane 5), but not 2 µg of GST alone (Figure 7B, lane 4), increase access of a restriction enzyme to packaged DNA (Figure 7B, cf. lanes 4 and 5 with lane 6). Figure 7 further shows that deletion of the PHD domain, but not of the SRA domain strongly reduces this activity, although it does not abolish it (Figure 7B, cf. lanes 6–7 with 8–9, 10–11, and 12–13).
|
| DISCUSSION |
|---|
|
|
|---|
Remarkably, the dissolving effect on chromocenters is independent from the H3:K9/K4:K20met3/HP1 pathway, from DNA methylation, and from the cell cycle. In Suv39h1/2dn and in dnmt TKO cells, indeed, overexpression of Np95 leads to the disappearance of the DAPI nodules. In NIH-3T3 cells, neither the histone trimethylation pattern in PH nor the expression levels of HP1 are significantly affected after Np95 depletion or overexpression. This, however, is not surprising because several studies show that the H3:K9 methylation pathway is not involved in chromocenter dynamics. Accumulation of HP1 in PH regions does not cause large-scale chromocenter modifications (Mateos-Langerak et al., 2007
). The number and size of chromocenters in Suv39h1/2dn cells are comparable to control cells (Peters et al., 2001
). Large-scale rearrangements of PH induced during terminal differentiation of muscle cells and by overexpression of MeCP2 are independent from H3:K9met3 and from HP1 levels (Brero et al., 2005
). In plants, the methyltransferase suvh4 mutant has normal chromocenters although H3:K9met2 is strongly reduced (Jasencakova et al., 2003
; Naumann et al., 2005
; Zemach et al., 2005
).
It has also been suggested that extensive DNA methylation is not necessary for PH clustering. The DNA methyl-binding protein MeCP2 was shown to assemble secondary chromatin structures independently from the methylated DNA-binding domain and from DNA methylation (Georgel et al., 2003
). However, during muscle terminal differentiation the MBD domain of MeCP2 and of other MBD-containing proteins seems to be necessary and sufficient to increase percientromeric clustering (Brero et al., 2005
). In plants, disruption of chromocenter structures during dedifferentiation of specialized mesophyll cells into undifferentiated protoplasts is not accompanied by changes in DNA or H3:K9 methylation and in transcriptional reactivation of silent genomic elements (Tessadori et al., 2007
). The severe DNA hypomethylation mutants ddm1-5, ddm1-2, met1-1, and hog1 only show a limited decondensation of chromocenter heterochromatin (Mittelsten Scheid et al., 2002
; Probst et al., 2003
). Deletion of Np95 results in a drastic reduction of DNA methylation levels in mouse ES cells and embryos (Bostick et al., 2007
; Sharif et al., 2007
). Our results indicate that loss of Np95 increases chromocenters size and that overexpression of Np95 in TKO cells disaggregates chromocenters, once more suggesting that the chromocenter dynamics we observe is independent from DNA methylation.
Alterations in chromocenter structure by Np95 must, therefore, depend on different processes. We show that PHD is the domain required in vivo for the profound alterations of chromocenters structure after overexpression of Np95-ICBP90. It has been shown that a RING point domain, but not ICBP90wt, causes large-scale chromocenter changes (Karagianni et al., 2008
). Our experiments in at least three type of mouse cells (NIH-3T3, Suv39h1/2dn, and TKO) indicate that overexpression of Np95-ICBP90wt or of the deletion mutants
-SRA,
-RING,
-ubiquitin-like domain (82-782), but not
-PHD, always causes large-scale chromocenter modifications.
Significant sequence differences have been found in PHD domains, and accordingly, various activities have been assigned to this domain (Bienz, 2006
). The PHD domain is an important chromatin-binding module and is crucial for the function of proteins within chromatin-associated complexes that display chromatin-modifying activities, like Dnmt3L (Jia et al., 2007
), BHC80 (Lan et al., 2007
), ACF-1 (Eberharter et al., 2004
), and BPTF (Wysocka et al., 2006
). The deletion or functional impairment of the C-terminal PHD finger of ACF1 profoundly affected the nucleosome mobilization capability of associated SNF2H in trans. Some of these complexes have been implicated in DNA replication (Corona and Tamkun, 2004
) and the ACF1–SNF2H complex specifically in PH replication (Collins et al., 2002
).
Our in vitro experiments show that the PHD of Np95 is required to facilitate the access of a restriction enzyme (SfcI) to DNA packaged into nucleosome arrays, suggesting that in vivo this domain might enhance Np95s chromatin-binding ability and favor the recruitment of chromatin modifiers. Indeed, the PHD domain of Np95 has a role in chromatin binding, although the SRA is critical (Citterio et al., 2004
). Although a recent publication (Karagianni et al., 2008
) shows that the PHD and SRA domains of Np95 are required for preferential binding to H3:K9met3 and that Np95 in Suv39h1/2dn cells does not bind heterochromatin, our experiments performed on those cells clearly show that the protein distribution is not affected by that genetic background (Figure 3). In synchronized Suv39h1/2dn cells, Np95 exhibits foci of PH staining over a more diffuse pattern at the onset of S phase, relocalizes to chromocenters at the time of PH replication and is part of the pHDB, as it does in NIH-3T3 cells. A possible interpretation of this discrepancy is that Suv39h1/2dn cells grow slower and most cells are in G1, a cell cycle phase in which Np95 is well known to appear diffused in the nucleoplasm (Uemura et al., 2000
; Miura et al., 2001
; Papait et al., 2007
).
The PHD-mediated large-scale PH reorganization might reflect changes that occur at a yet unknown level of chromatin organization and disrupts the structure of chromocenters, producing an open chromatin configuration. This view is reinforced by our FISH experiments, which show that major satellite DNA is disaggregated along with chromocenters. At the time of PH replication, the bulk of Np95 relocalizes to the chromocenters and always associates with the pHDB, which corresponds to the less dense chromatin areas. In these partially disaggregated chromocenter areas, parental DNA is pulled out and duplicated by the replication machinery (Quivy et al., 2004
). We propose the hypothesis that the PHD domain of Np95 is involved in PH replication and formation by contributing to the "opening" of this chromatin compartment during replication. The SRA domain would recruit HDAC1 (Unoki et al., 2004
; Papait et al., 2007
), contributing to the establishment of the repressive environment that produces major satellite transcriptional repression (Papait et al., 2007
). Our results showing chromocenter clustering and impairment of PH replication after Np95 depletion, are an indirect confirmation of this hypothesis.
The results described here, together with our previous studies, tend to suggest that higher amounts of this protein would contribute to a "proliferating" competence of the cells, which is consistent with the observation of Np95-ICBP90 overexpression in many tumors (Mousli et al., 2003
; Crnogorac-Jurcevic et al., 2005
; Jenkins et al., 2005
). Indeed, large-scale positional or structural modifications of heterochromatin have key roles in cellular transformation (Zink et al., 2004
) and may involve epigenetic regulation of gene expression (van Driel et al., 2003
).
In conclusion, we propose that Np95-ICBP90 has an important role for chromocenter dynamics that is accomplished independently from the H3:K9-H4:K20-HP1 pathway and from DNA methylation and that the PHD domain has an important role for chromocenter dynamics and might actively participate to the replication and reformation of PH domains in middle S phase.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
These authors have equally contributed to the work. ![]()
Address correspondence to: Ian Marc Bonapace (ian.bonapace{at}uninsubria.it)
Abbreviations used: DAPI, 4,6-diamidino-2-phenylindole; DNMT1, DNA methyltransferase 1; H3:K9met3, tri-methylated lysine 9 of histone H3; H4:K20met3, tri-methylated lysine 20 of histone H4; pHDB, PH duplication body; RNAi, RNA interference; siRNA, small interfering RNA oligonucleotides.
| REFERENCES |
|---|
|
|
|---|
Almer, A., Rudolph, H., Hinnen, A., and Horz, W. (1986). Removal of positioned nucleosomes from the yeast PHO5 promoter upon PHO5 induction releases additional upstream activating DNA elements. EMBO J 5, 2689–2696.[Medline]
Barr, H. J., and Ellison, J. R. (1972). Ectopic pairing of chromosome regions containing chemically similar DNA. Chromosoma 39, 53–61.[CrossRef][Medline]
Baumann, M., Mamais, A., McBlane, F., Xiao, H., and Boyes, J. (2003). Regulation of V(D)J recombination by nucleosome positioning at recombination signal sequences. EMBO J 22, 5197–5207.[CrossRef][Medline]
Bienz, M. (2006). The PHD finger, a nuclear protein-interaction domain. Trends Biochem. Sci 31, 35–40.[CrossRef][Medline]
Bonapace, I. M., Latella, L., Papait, R., Nicassio, F., Sacco, A., Muto, M., Crescenzi, M., and Di Fiore, P. P. (2002). Np95 is regulated by E1A during mitotic reactivation of terminally differentiated cells and is essential for S phase entry. J. Cell Biol 157, 909–914.
Bostick, M., Kim, J. K., Esteve, P. O., Clark, A., Pradhan, S., and Jacobsen, S. E. (2007). UHRF1 plays a role in maintaining DNA methylation in mammalian cells. Science 317, 1760–1764.
Boyer, L. A., Logie, C., Bonte, E., Becker, P. B., Wade, P. A., Wolffe, A. P., Wu, C., Imbalzano, A. N., and Peterson, C. L. (2000). Functional delineation of three groups of the ATP-dependent family of chromatin remodeling enzymes. J. Biol. Chem 275, 18864–18870.
Brero, A., Easwaran, H. P., Nowak, D., Grunewald, I., Cremer, T., Leonhardt, H., and Cardoso, M. C. (2005). Methyl CpG-binding proteins induce large-scale chromatin reorganization during terminal differentiation. J. Cell Biol 169, 733–743.
Cerda, M. C., Berrios, S., Fernandez-Donoso, R., Garagna, S., and Redi, C. (1999). Organisation of complex nuclear domains in somatic mouse cells. Biol. Cell 91, 55–65.[CrossRef][Medline]
Cheutin, T., McNairn, A. J., Jenuwein, T., Gilbert, D. M., Singh, P. B., and Misteli, T. (2003). Maintenance of stable heterochromatin domains by dynamic HP1 binding. Science 299, 721–725.
Citterio, E., Papait, R., Nicassio, F., Vecchi, M., Gomiero, P., Mantovani, R., Di Fiore, P. P., and Bonapace, I. M. (2004). Np95 is a histone-binding protein endowed with ubiquitin ligase activity. Mol. Cell. Biol 24, 2526–2535.
Collins, N., Poot, R. A., Kukimoto, I., Garcia-Jimenez, C., Dellaire, G., and Varga-Weisz, P. D. (2002). An ACF1-ISWI chromatin-remodeling complex is required for DNA replication through heterochromatin. Nat. Genet 32, 627–632.[CrossRef][Medline]
Corona, D. F., and Tamkun, J. W. (2004). Multiple roles for ISWI in transcription, chromosome organization and DNA replication. Biochim. Biophys. Acta 1677, 113–119.[Medline]
Crnogorac-Jurcevic, T. et al. (2005). Proteomic analysis of chronic pancreatitis and pancreatic adenocarcinoma. Gastroenterology 129, 1454–1463.[CrossRef][Medline]
Dimitrova, D. S., and Berezney, R. (2002). The spatio-temporal organization of DNA replication sites is identical in primary, immortalized and transformed mammalian cells. J. Cell Sci 115, 4037–4051.
Eberharter, A., Vetter, I., Ferreira, R., and Becker, P. B. (2004). ACF1 improves the effectiveness of nucleosome mobilization by ISWI through PHD-histone contacts. EMBO J 23, 4029–4039.[CrossRef][Medline]
Festenstein, R., and Aragon, L. (2003). Decoding the epigenetic effects of chromatin. Genome Biol 4, 342.[CrossRef][Medline]
Georgel, P. T., Horowitz-Scherer, R. A., Adkins, N., Woodcock, C. L., Wade, P. A., and Hansen, J. C. (2003). Chromatin compaction by human MeCP2. Assembly of novel secondary chromatin structures in the absence of DNA methylation. J. Biol. Chem 278, 32181–32188.
Hochstrasser, M., and Sedat, J. W. (1987). Three-dimensional organization of Drosophila melanogaster interphase nuclei. I. Tissue-specific aspects of polytene nuclear architecture. J. Cell Biol 104, 1455–1470.
Jasencakova, Z., Soppe, W. J., Meister, A., Gernand, D., Turner, B. M., and Schubert, I. (2003). Histone modifications in Arabidopsis—high methylation of H3 lysine 9 is dispensable for constitutive heterochromatin. Plant J 33, 471–480.[CrossRef][Medline]
Jenkins, Y. et al. (2005). Critical role of the ubiquitin ligase activity of UHRF1, a nuclear RING finger protein, in tumor cell growth. Mol. Biol. Cell 16, 5621–5629.
Jia, D., Jurkowska, R. Z., Zhang, X., Jeltsch, A., and Cheng, X. (2007). Structure of Dnmt3a bound to Dnmt3L suggests a model for de novo DNA methylation. Nature 449, 248–251.[CrossRef][Medline]
Johnson, L. M., Bostick, M., Zhang, X., Kraft, E., Henderson, I., Callis, J., and Jacobsen, S. E. (2007). The SRA methyl-cytosine-binding domain links DNA and histone methylation. Curr. Biol 17, 379–384.[CrossRef][Medline]
Karagianni, P., Amazit, L., Qin, J., and Wong, J. (2008). ICBP90, a novel methyl K9 H3 binding protein linking protein ubiquitination with heterochromatin formation. Mol. Cell. Biol 28, 705–717.
Kosak, S. T., and Groudine, M. (2004). Form follows function: the genomic organization of cellular differentiation. Genes Dev 18, 1371–1384.
Lan, F., Collins, R. E., De Cegli, R., Alpatov, R., Horton, J. R., Shi, X., Gozani, O., Cheng, X., and Shi, Y. (2007). Recognition of unmethylated histone H3 lysine 4 links BHC80 to LSD1-mediated gene repression. Nature 448, 718–722.[CrossRef][Medline]
Lehnertz, B., Ueda, Y., Derijck, A. A., Braunschweig, U., Perez-Burgos, L., Kubicek, S., Chen, T., Li, E., Jenuwein, T., and Peters, A. H. (2003). Suv39h-mediated histone H3 lysine 9 methylation directs DNA methylation to major satellite repeats at pericentric heterochromatin. Curr. Biol 13, 1192–1200.[CrossRef][Medline]
Ma, H., Samarabandu, J., Devdhar, R. S., Acharya, R., Cheng, P. C., Meng, C., and Berezney, R. (1998). Spatial and temporal dynamics of DNA replication sites in mammalian cells. J. Cell Biol 143, 1415–1425.
Maison, C., and Almouzni, G. (2004). HP1 and the dynamics of heterochromatin maintenance. Nat. Rev. Mol. Cell Biol 5, 296–304.[CrossRef][Medline]
Mateos-Langerak, J., Brink, M. C., Luijsterburg, M. S., van der Kraan, I., van Driel, R., and Verschure, P. J. (2007). Pericentromeric heterochromatin domains are maintained without accumulation of HP1. Mol. Biol. Cell 18, 1464–1471.
Mittelsten Scheid, O., Probst, A. V., Afsar, K., and Paszkowski, J. (2002). Two regulatory levels of transcriptional gene silencing in Arabidopsis. Proc. Natl. Acad. Sci. USA 99, 13659–13662.
Miura, M., Watanabe, H., Sasaki, T., Tatsumi, K., and Muto, M. (2001). Dynamic changes in subnuclear NP95 location during the cell cycle and its spatial relationship with DNA replication foci. Exp. Cell Res 263, 202–208.[CrossRef][Medline]
Mousli, M., Hopfner, R., Abbady, A. Q., Monte, D., Jeanblanc, M., Oudet, P., Louis, B., and Bronner, C. (2003). ICBP90 belongs to a new family of proteins with an expression that is deregulated in cancer cells. Br. J. Cancer 89, 120–127.[CrossRef][Medline]
Naumann, K., Fischer, A., Hofmann, I., Krauss, V., Phalke, S., Irmler, K., Hause, G., Aurich, A. C., Dorn, R., Jenuwein, T., and Reuter, G. (2005). Pivotal role of AtSUVH2 in heterochromatic histone methylation and gene silencing in Arabidopsis. EMBO J 24, 1418–1429.[CrossRef][Medline]
Papait, R., Pistore, C., Negri, D., Pecoraro, D., Cantarini, L., and Bonapace, I. M. (2007). Np95 is implicated in pericentromeric heterochromatin replication and in major satellite silencing. Mol. Biol. Cell 18, 1098–1106.
Peters, A. H. et al. (2001). Loss of the Suv39h histone methyltransferases impairs mammalian heterochromatin and genome stability. Cell 107, 323–337.[CrossRef][Medline]
Polo, S. E., and Almouzni, G. (2006). Chromatin assembly: a basic recipe with various flavours. Curr. Opin. Genet Dev 16, 104–111.[CrossRef][Medline]
Probst, A. V., Fransz, P. F., Paszkowski, J., and Mittelsten Scheid, O. (2003). Two means of transcriptional reactivation within heterochromatin. Plant J 33, 743–749.[CrossRef][Medline]
Quivy, J. P., Roche, D., Kirschner, D., Tagami, H., Nakatani, Y., and Almouzni, G. (2004). A CAF-1 dependent pool of HP1 during heterochromatin duplication. EMBO J 23, 3516–3526.[CrossRef][Medline]
Sharif, J. et al. (2007). The SRA protein Np95 mediates epigenetic inheritance by recruiting Dnmt1 to methylated DNA. Nature 450, 908–912.[CrossRef][Medline]
Shen, X., Mizuguchi, G., Hamiche, A., and Wu, C. (2000). A chromatin remodelling complex involved in transcription and DNA processing. Nature 406, 541–544.[CrossRef][Medline]
Tessadori, F., Chupeau, M. C., Chupeau, Y., Knip, M., Germann, S., van Driel, R., Fransz, P., and Gaudin, V. (2007). Large-scale dissociation and sequential reassembly of pericentric heterochromatin in dedifferentiated Arabidopsis cells. J. Cell Sci 120, 1200–1208.
Tsumura, A. et al. (2006). Maintenance of self-renewal ability of mouse embryonic stem cells in the absence of DNA methyltransferases Dnmt1, Dnmt3a and Dnmt3b. Genes Cells 11, 805–814.
Uemura, T., Kubo, E., Kanari, Y., Ikemura, T., Tatsumi, K., and Muto, M. (2000). Temporal and spatial localization of novel nuclear protein NP95 in mitotic and meiotic cells. Cell Struct. Funct 25, 149–159.[CrossRef][Medline]
Unoki, M., Nishidate, T., and Nakamura, Y. (2004). ICBP90, an E2F-1 target, recruits HDAC1 and binds to methyl-CpG through its SRA domain. Oncogene 23, 7601–7610.[CrossRef][Medline]
van Driel, R., Fransz, P. F., and Verschure, P. J. (2003). The eukaryotic genome: a system regulated at different hierarchical levels. J. Cell Sci 116, 4067–4075.
Varga-Weisz, P. D., Wilm, M., Bonte, E., Dumas, K., Mann, M., and Becker, P. B. (1997). Chromatin-remodelling factor CHRAC contains the ATPases ISWI and topoisomerase II. Nature 388, 598–602.[CrossRef][Medline]
Weierich, C., Brero, A., Stein, S., von Hase, J., Cremer, C., Cremer, T., and Solovei, I. (2003). Three-dimensional arrangements of centromeres and telomeres in nuclei of human and murine lymphocytes. Chromosome Res 11, 485–502.[CrossRef][Medline]
Wysocka, J. et al. (2006). A PHD finger of NURF couples histone H3 lysine 4 trimethylation with chromatin remodelling. Nature 442, 86–90.[Medline]
Zemach, A., Li, Y., Wayburn, B., Ben-Meir, H., Kiss, V., Avivi, Y., Kalchenko, V., Jacobsen, S. E., and Grafi, G. (2005). DDM1 binds Arabidopsis methyl-CpG binding domain proteins and affects their subnuclear localization. Plant Cell 17, 1549–1558.
Zink, D., Fischer, A. H., and Nickerson, J. A. (2004). Nuclear structure in cancer cells. Nat. Rev. Cancer 4, 677–687.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
J. K. Kim, P.-O. Esteve, S. E. Jacobsen, and S. Pradhan UHRF1 binds G9a and participates in p21 transcriptional regulation in mammalian cells Nucleic Acids Res., February 1, 2009; 37(2): 493 - 505. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Fischle Talk is cheap--cross-talk in establishment, maintenance, and readout of chromatin modifications Genes & Dev., December 15, 2008; 22(24): 3375 - 3382. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Qian, S. Li, J. Jakoncic, L. Zeng, M. J. Walsh, and M.-M. Zhou Structure and Hemimethylated CpG Binding of the SRA Domain from Human UHRF1 J. Biol. Chem., December 12, 2008; 283(50): 34490 - 34494. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||