QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

Vol. 19, Issue 9, 3701-3712, September 2008

This Article Abstract Full Text (PDF) Supplemental Materials All Versions of this Article: E08-02-0175v1 19/9/3701    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Google Scholar Articles by Chen, J. Articles by Wang, J.-Y. PubMed PubMed Citation Articles by Chen, J. Articles by Wang, J.-Y.

JunD Represses Transcription and Translation of the Tight Junction Protein Zona Occludens-1 Modulating Intestinal Epithelial Barrier Function

Jie Chen^*,,,, Lan Xiao^*,,, Jaladanki N. Rao^*,, Tongtong Zou^*,, Lan Liu^*,, Emily Bellavance^*,, Myriam Gorospe^||, and Jian-Ying Wang^*,,¶

*Cell Biology Group, Department of Surgery and ^¶Department of Pathology, University of Maryland School of Medicine and Baltimore Veterans Affairs Medical Center, Baltimore, MD 21201; and ^||Laboratory of Cellular and Molecular Biology, National Institute on Aging-Intramural Research Program, National Institutes of Health, Baltimore, MD 21224

Submitted February 19, 2008; Revised May 30, 2008; Accepted June 9, 2008
Monitoring Editor: William P. Tansey

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The AP-1 transcription factor JunD is highly expressed in intestinal epithelial cells, but its exact role in maintaining the integrity of intestinal epithelial barrier remains unknown. The tight junction (TJ) protein zonula occludens (ZO)-1 links the intracellular domain of TJ-transmembrane proteins occludin, claudins, and junctional adhesion molecules to many cytoplasmic proteins and the actin cytoskeleton and is crucial for assembly of the TJ complex. Here, we show that JunD negatively regulates expression of ZO-1 and is implicated in the regulation of intestinal epithelial barrier function. Increased JunD levels by ectopic overexpression of the junD gene or by depleting cellular polyamines repressed ZO-1 expression and increased epithelial paracellular permeability. JunD regulated ZO-1 expression at the levels of transcription and translation. Transcriptional repression of ZO-1 by JunD was mediated through cAMP response element-binding protein-binding site within its proximal region of the ZO-1-promoter, whereas induced JunD inhibited ZO-1 mRNA translation by enhancing the interaction of the ZO-1 3'-untranslated region with RNA-binding protein T cell-restricted intracellular antigen 1-related protein. These results indicate that JunD is a biological suppressor of ZO-1 expression in intestinal epithelial cells and plays a critical role in maintaining epithelial barrier function.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
JunD is a member of the Jun family of proteins, which are primary components of the activator protein 1 (AP-1) transcription factor (Hirai et al., 1989; Ryder et al., 1989). Jun proteins (c-Jun, JunB, and JunD) can form either AP-1 homo- or heterodimers among themselves or with Fos family members (c-Fos, FosB, Fra1, and Fra2) and directly bind to their target promoters at specific DNA elements such as TGAGTCA (classical AP-1 site) and TGACGTCAT (Liu et al., 2004; Hock et al., 2007; Xiao et al., 2007a). Although the different AP-1 dimers exhibit rather similar DNA binding specificities, they differ in their transactivation efficiencies. Studies of AP-1 functions in vitro as well as in vivo reveal that there are distinct roles for each member (Wisdom et al., 1999; Wenger, 2002; Shaulian and Karin, 2002; Gerald et al., 2004; Tsuji, 2005; Hilfiker-Kleiner et al., 2006; Xiao et al., 2007a; Hock et al., 2007). Although c-jun and junB behave as immediate early response genes and enhance the G1 to S phase transition of the cell cycle upon mitogenic stimulation (Ryder et al., 1989; Bakiri et al., 2000), junD expression remains almost invariant, and its product is partially degraded upon serum-induced reentry into the cell cycle (Pfarr et al., 1994; Pillebout et al., 2003; Hilfiker-Kleiner et al., 2006). Overexpression of JunD inhibits cell proliferation, whereas immortalized cells lacking junD (junD^–/–) display higher proliferation rates than their wild-type counterparts (Weitzman et al., 2000), suggesting that JunD is a negative regulator of the cell division cycle. Our previous studies show that junD expression is tightly regulated in intestinal epithelial cells (IECs) and plays a critical role in maintaining intestinal mucosal tissue homeostasis under physiological conditions (Patel and Wang, 1999; Li et al., 2002; Xiao et al., 2007a). However, the exact role and mechanism of JunD action as a regulator of the intestinal epithelial barrier function remain unknown.

Epithelial cells line the intestinal mucosa and form an important barrier that protects the subepithelial tissue against a wide array of noxious substances, allergens, and luminal microbial pathogens. The effectiveness and stability of this epithelial barrier depends on the activity of junctional complexes that include tight junctions (TJs), adherens junctions, desmosomes, and gap junctions (Guo et al., 2003; Van Itallie and Anderson, 2004; Schneeberger and Lynch, 2004; Funke et al., 2005). The TJ is the apical-most element of the junctional complex and seals epithelial cells together in a way that prevents even small molecules from leaking between cells (Van Itallie and Anderson, 2004; Matter et al., 2005; Shin et al., 2006). To date, four classes of TJ-transmembrane proteins and >30 TJ-membrane–associated proteins are identified in mammalian epithelial and endothelial cells (Fanning, 2006). At the ultrastructural level, the TJ seems as highly organized strands that encircle the apical-lateral boundary and primarily consist of transmembrane proteins such as occludin, tricellulin, and one or more members of the claudin family. These transmembrane proteins are, in turn, associated with a cytosolic plaque of proteins that closely links to the cortical cytoskeleton. Despite considerable efforts from many laboratories, the precise mechanisms underlying TJ assembly and the coordination of signals and barrier activity in response to stress are poorly understood.

The zona occludens (ZO)-1 protein is the best characterized member of a large family of membrane-associated scaffolding and signaling molecules known as the membrane-associated guanylate kinase homologues (MAGUKs). MAGUK proteins, characterized by a core motif of conserved protein-binding domains including one or more postsynaptic density 95/disc-large/zona occludens domains, a Src homology 3 domain, and a guanylate kinase-like domain, are highly organized within a complicated network of interconnecting cytoskeleton with TJ-transmembrane proteins (Funke et al., 2005; Fanning, 2006). Much effort has been made to define the function of ZO-1 and has shown that it is one of key regulators of TJ assembly (Fanning et al., 1998; Reichert et al., 2000; Ryeom et al., 2000; Wittchen et al., 2000; Fanning et al., 2007a). Umeda et al. (2006) have recently reported that ZO-1 and its homologue ZO-2 independently determine where claudins are polymerized in tight junction strand formation and that cells are unable to assemble tight junctions when both ZO-1 and ZO-2 are down-regulated. ZO-1 is proposed to function as a multidomain scaffold that coordinates the assembly of transmembrane and cytosolic proteins into the TJ and/or regulates the activity of these proteins once assembled (Utepbergenov et al., 2006; Fanning et al., 2007a,b). In support of this notion, ZO-1 is shown to bind most of TJ-transmembrane proteins including occludin, claudins, and the CTX (Ig) superfamily (Schneeberger and Lynch, 2004; Fanning, 2006). In addition, ZO-1 also binds >10 cytoplasmic proteins and various components of the cortical cytoskeleton.

Maintenance of dynamic level of ZO-1 protein is critical for normal function of the epithelial barrier, but little is known about the mechanism by which ZO-1 expression is regulated at the molecular level. By computational analysis, the ZO-1-promoter was shown to contain several potential AP-1 and cAMP response element-binding protein-binding (CREB) sites, suggesting that it is a putative target of JunD. In this study, we sought to directly investigate the role of JunD in regulating ZO-1 expression. The data presented here indicate that overexpression of JunD represses ZO-1 transcription, in turn causing an increase in epithelial paracellular permeability. Experiments using different ZO-1 promoter mutants revealed that the transcriptional repression of ZO-1 by JunD is mediated through CREB binding sites within the proximal region of the ZO-1 promoter. Unexpectedly, however, we also found that JunD also inhibited ZO-1 translation, likely by enhancing the interaction of the ZO-1 3'-untranslated region (3'-UTR) with the RNA-binding protein T cell-restricted intracellular antigen 1-related protein (TIAR). This study provides new insights into the mechanisms underlying ZO-1 expression and shows that JunD is implicated in the regulation of the epithelial barrier function through modulation of ZO-1.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Chemicals and Supplies
Tissue culture medium and dialyzed fetal bovine serum were from Invitrogen (Carlsbad, CA), and biochemicals were from Sigma-Aldrich (St. Louis, MO). The antibodies recognizing JunD, TIAR, HuR, and AUF1 were from Santa Cruz Biotechnology (Santa Cruz, CA), whereas antibodies against ZO-1, occludin, and E-cadherin were purchased from Invitrogen. The secondary antibody conjugated to horseradish peroxidase was from Sigma-Aldrich. -Difluoromethylornithine (DFMO) was from Genzyme (Cambridge, MA). ¹⁴C-Labeled mannitol was purchased from Amersham Pharmacia Biotech (Chalfont St. Giles, United Kingdom). The 12-mm Transwell filters (0.4-µm pore size; clear polyester) were obtained from Corning Life Sciences (Lowell, MA).

Cell Culture
Caco-2 cells (a human colon carcinoma cell line) were obtained from the American Type Culture Collection (Manassas, VA) at passage 16. They were maintained in Eagle's minimal essential medium with 10% heat-inactivated fetal bovine serum and 50 µg/ml gentamicin, and passages 18–23 were used for the experiments as described previously (Li et al., 2002). The stable Cdx-2–transfected IEC-6 cells (IEC-Cdx2L1 cells) were developed from IEC-6 cells (Quaroni et al., 1979) that were derived from normal rat intestinal crypt cells (Suh and Traber, 1996). The LacSwitch System (Stratagene, La Jolla, CA) was used for directing the conditional expression of Cdx2, and isopropyl β-D-thiogalactoside (IPTG) was used to induce gene expression. Stock stable Cdx-2-transfected IEC-6 cells were grown in DMEM as described previously (Rao et al., 2002; Guo et al., 2005). Before experiments, cells were grown in DMEM containing 4 mM IPTG for 16 d to induce cell differentiation.

Plasmid Construction and Transfection
The plasmid clone (pRSV-hjD) containing the human junD gene was obtained from American Type Culture Collection. Two polymerase chain reaction (PCR) primers (sense, TACCGCTAGCGGAGGATGGAAACACCCTTC; antisense, GTCAGGTACCCTCAGTACGCCGGGACCTG) were used to amplify the complete open reading frame of junD from pRSV-hjD. The resulting PCR product was sequenced to confirm that no mutations were introduced by PCR and then cloned into an expression vector pcDNA3.1(+) (Invitrogen) for expression directed by the cytomegalovirus promoter. The full-length ZO-1 promoter was cloned from human genomic DNA, and various constructs of the ZO-1 promoter luciferase (Luc) reporter were generated, including full-length ZO-1 promoter Luc reporter, F-Luc (2.8-kb regulatory region upstream of the ZO-1 gene fused to the Luc reporter gene), and its deletion mutants, 22-Luc, 10-Luc, and 5-Luc. The 5'-deletion ZO-1 promoter construct of the 10-Luc and the cAMP response element-binding protein (CREB) point mutants of the ZO-1 promoter were generated using QuikChange site-directed mutagenesis kit and performed according to the manufacturer's instructions (Stratagene). Mutations of CREB binding site within the ZO-1-promoter were verified by DNA sequencing. Transient transfection was performed with Lipofectamine reagent (Invitrogen). All these ZO-1-promoter constructs are from firefly luciferase reporters. The promoter constructs were transfected into cells along with phRL-null, a Renilla luciferase control reporter vector from Promega (Madison, WI), to monitor transfection efficiencies. The transfected cells were lysed for assays of promoter activity using the dual-luciferase reporter assay system (Promega). The luciferase activity from individual constructs was normalized by Renilla-driven luciferase activity in every experiment.

RNA Interference
Silencing RNA duplexes were designed to specifically cleave JunD mRNA, and they were transfected into cells as described previously (Pfäfflin et al., 2006). The sequence of small interfering RNA (siRNA) specifically targeting the coding region of JunD mRNA (siJunD) was AGCATGCTGAAGAAAGACGC, whereas the sequence of control siRNA (C-siRNA) was ATGATCAGCCTTTCCAGCTC. The siRNA sequence targeting TIAR (siTIAR) was AAGGGCTAATTCATTTGTCAGA; and the C-siRNA was AATTCTCCGAACGTGTCACGT (Mazan-Mamczarz et al., 2006). For each 60-mm cell culture dish, 15 µl of the 20 µM stock duplex siJunD, siTIAR, or C-siRNA was mixed with 300 µl of Opti-MEM (Invitrogen). This mixture was gently added to a solution containing 15 µl of Lipofectamine 2000 in 300 µl of Opti-MEM. The solution was incubated for 20 min at room temperature and gently overlaid onto monolayers of cells in 3 ml of medium, and cells were harvested for various assays after 48-h incubation.

Western Blot Analysis
Whole-cell lysates were prepared using 2% SDS, sonicated, and centrifuged (12,000 rpm) at 4°C for 15 min. The supernatants were boiled for 5 min and size-fractionated by SDS-polyacrylamide gel electrophoresis (7.5% acrylamide). After transferring proteins onto nitrocellulose filters, the blots were incubated with primary antibodies recognizing ZO-1, occludin, E-cadherin, TIAR, AUF1, or HuR; following incubations with secondary antibodies, immunocomplexes were developed by using chemiluminescence.

Reverse Transcription (RT)-PCR and Real-Time PCR Analysis
Total RNA was isolated by using RNeasy mini kit (QIAGEN, Valencia, CA) and used in reverse transcription and PCR amplification reactions as described previously (Guo et al., 2005). The specific sense and antisense primers for ZO-1 included 5'-GCCTCTGCAGTTAAGCAT-3' and 5'-AAGAGCTGGCTGTTTTAA-3', and the expected size of ZO-1 fragments was 249 base pairs. The levels of β-actin PCR product were assessed to monitor the even RNA input in RT-PCR samples. Real-time quantitative PCR (qRT-PCR) was performed using 7500-Fast Real-Time PCR Systems (Applied Biosystems, Foster City, CA) with specific primers, probes, and software (Applied Biosystems). The levels of ZO-1, occludin, and E-cadherin mRNAs were quantified by qRT-PCR analysis and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) levels.

Chromatin Immunoprecipitation (ChIP)
Caco-2 cells were transfected with the JunD expression vector or control vector (Null) for 48 h and then fixed with 1% formaldehyde to cross-link chromatin. ChIP analysis was performed using the ChIP-IT kit (Active Motif, Carlsbad, CA), following the manufacturer's recommendations with minor modification, as described previously (Xiao et al., 2007a). Briefly, cells were suspended in lysis buffer and gently dounced on ice with 10 strokes to aid in nuclei release. After centrifugation, the nuclear pellet was suspended in digestion buffer and the chromatin was sheared with Enzymatic Shearing Cocktail. The sheared DNA samples were centrifuged, and the supernatants were collected and precleared with protein G beads. The precleared DNA samples were then incubated with the anti-JunD or control immunoglobulin G (IgG) antibodies overnight with constant rotation. The immunocomplexes were captured by addition of protein G beads, and the immunoprecipitated DNA was collected from the beads using ChIP elution buffer. DNA–protein cross-links were reversed and deproteinized, and DNA was recovered and amplified by PCR. Primers to amplify the proximal region of the ZO-1-promoter containing a CREB binding site were 5'-CTTGAGGTCTAATGTGGGGTG-3' and 5'-CATGGCTTTCATCTCCGAG-3'. Primers to amplify the proximal region of the GAPDH promoter (a negative control) were 5'-TACTAGCGGTTTTACGGGCG-3' and 5'-TCGAA-CAGGAGGAGCAGAGAGCGA-3'. The DNA isolated through IgG ChIP was used as a negative control. The input DNA, obtained from chromatin that was processed (cross-linked and reversed) similarly to the samples, served as a positive control for PCR effectiveness.

Translation Assays
ZO-1 translation was measured by chimeric firefly luciferase reporter assays (Vasudevan and Steitz, 2007) and polysome analysis (Kawai et al., 2006). The 545-base pairs AU-rich element (ARE) fragment from the human ZO-1 3'-UTR was amplified and subcloned into the pGL3-Luc plasmid (Promega) at the XbaI site to generate the chimeric pGL3-Luc-ZO1-3'UTR. The sequence and orientation of the fragment in the luciferase reporter were identified by DNA sequencing and enzyme digestion. Luciferase activity was measured using the dual-luciferase assay system following the manufacturer's instruction. The firefly-to-Renilla luciferase ratio was further normalized for RNA levels.

Polysome analysis was performed as described previously (Kawai et al., 2006). For the preparation of different molecular weights of polysomal fractions, 70% confluent cells were transfected with the JunD expression vector or Null plasmid for 48 h before the collection. Gradient analysis was performed essentially as described previously (Pillai et al., 2005). Briefly, cycloheximide was added to 100 µg/ml concentration 15 min before lysine and was also incubated in solution used for cell washing and lysis. After lysis with the PEB lysis buffer (0.3 M NaCl, 15 mM MgCl₂, 15 mM Tris-HCl, pH 7.6, 1% Triton X-100, 1 mg/ml heparin, and 100 µg/ml cycloheximide), nuclei were pelleted at 10,000 x g for 10 min, and the resulting supernatant was fractionated through 10 to 50% linear sucrose gradient. The eluted fractions were prepared with a fraction collector (Brandel, Gaithersburg, MD), and their quality was monitored at 254 nm using a UV-6 detector (ISCO, Lincoln, NE). RNA extracted from gradient fractions and input lysates was used for qPCR analysis.

Preparation of Synthetic RNA Transcripts
cDNA from Caco-2 cells was used as a template for PCR amplification of the coding region (CR) and 3'-UTR of ZO-1. The 5'-primers contained the T7 RNA polymerase promoter sequence (T7): 5'-CCAAGCTTCTAATACGACTCA-CTATAGGGAGA-3'. To prepare the CR of ZO-1, oligonucleotides (T7)5'- CGGTGGTCTGAGCCTGTAAG-3' and 5'-GGATCTACATGCGACGACAA-3' were used. To prepare the ZO-1 3'-UTR template (spanning position 5659–7186), oligonucleotides (T7)5'-CCCGGAGATCCAAATTATCTCG-3' and 5'-GCAAACAGACCAAGCCAGCAC-3' were used. PCR-amplified products were used as templates to transcribe biotinylated RNAs by using T7 RNA polymerase in the presence of biotin-cytidine 5'-triphosphate as described previously (Mazan-Mamczarz et al., 2006).

RNA–Protein Binding Assays
For biotin pull-down assays, biotinylated transcripts (6 µg) were incubated with 120 µg of cytoplasmic lysate for 30 min at room temperature. Complexes were isolated with paramagnetic streptavidin-conjugated Dynabeads (Invitrogen) and analyzed by Western blot analysis. To assess the association of endogenous TIAR with endogenous ZO-1 mRNA, immunoprecipitations (IPs) of TIAR–mRNA complexes were performed as described previously (Xiao et al., 2007). Twenty million Caco-2 cells were collected per sample, and lysates were used for IP for 4 h at room temperature in the presence of excess (30 µg) IP antibody (IgG or anti-TIAR). RNA in IP materials was used in RT followed by PCR analysis to detect the presence of ZO-1 mRNA.

Immunofluorescence Staining
Immunofluorescence was performed as described previously (Guo et al., 2003). Cells were fixed using 3.7% formaldehyde, and the rehydrated samples were incubated overnight at 4°C with primary antibody in blocking buffer and then incubated with secondary antibody conjugated with Alexa Fluor-594 (Invitrogen) for 2 h at room temperature. After rinsing, slides were mounted, and viewed through a confocal microscope (model LSM410; Carl Zeiss, Thornwood, NY). Images were processed using PhotoShop software (Adobe Systems, San Jose, CA).

Paracellular Tracer Flux Assay and Transepithelial Electrical Resistance Measurement
Flux assays were performed on the 12-mm Transwell as described in our previous publications (Guo et al., 2003). [¹⁴C]Mannitol (mol. wt. 184), a membrane-impermeable molecule, served as the paracellular tracer, and the basal medium was collected 2 h after addition of [¹⁴C]mannitol for measurement using a liquid scintillation counter (Beckman Coulter, Fullerton, CA). Transepithelial electrical resistance (TEER) was measured with an epithelial voltometer under open circuit conditions (WPI, Sarasota, FL) as described previously (Wang et al., 2005), and the TEER of all monolayers was normalized to that of control monolayers in same experiment.

Polyamine Analysis
The cellular polyamine content was analyzed by high-performance liquid chromatography analysis as described previously (Wang and Johnson, 1991). Briefly, after 0.5 M perchloric acid was added, the cells were frozen at –80°C until ready for extraction, dansylation, and high-performance liquid chromatography analysis. The standard curve encompassed 0.31–10 µM. Values that fell >25% below the curve were considered undetectable. The results are expressed as nanomoles of polyamines per milligram of protein.

Statistics
Values are means ± SE from three to eight samples. Immunoblotting and immunofluorescence staining results were repeated three times. The significance of the difference between means was determined by analysis of variance. The level of significance was determined using Duncan's multiple range test (Harter, 1960).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Overexpression of JunD Inhibits ZO-1 Expression and Disrupts Epithelial Barrier Function
To determine the involvement of JunD in the regulation of the intestinal epithelial barrier, we examined the effect of overexpressing the wild-type junD gene on the expression of the TJ protein ZO-1 in Caco-2 cells. This cell line was chosen for analysis because it provides a unique in vitro model for epithelial barrier studies (Chen et al., 2007; Halbleib et al., 2007; Schwarz et al., 2007; Subramanian et al., 2007) and can be efficiently transfected (Li et al., 2002; Xiao et al., 2007a). As shown in Figure 1A, transient transfection with the JunD vector dramatically increased JunD protein expression levels (by 6-fold at 24 h and by 14-fold at 48 and 72 h after transfection) compared with JunD levels in the population transfected with the control vector. Increased JunD was associated with a potent inhibition in ZO-1 expression, as indicated by a decrease in levels of ZO-1 mRNA (Figure 1Ba) and protein (Figure 1C). The inhibitory effect of JunD was specific for ZO-1 because JunD overexpression did not alter the expression levels of occludin or the adherens junction E-cadherin (Figure 1B, b and c, and C).

View larger version (20K): [in this window] [in a new window]   Figure 1. Effect of ectopic expression of the junD gene on ZO-1 expression. (A) Representative immunoblots of JunD protein. Caco-2 cells were grown in minimum essential medium containing 10% fetal bovine serum and transfected using the expression vector containing human junD cDNA (JunD) or control vector lacking junD cDNA (Null) by using Lipofectamine. Whole-cell lysates were harvested at the indicated times after transfection, and JunD protein (40 kDa) was measured by Western blot analysis. After the blot was stripped, actin (42 kDa) immunoblotting was performed as an internal control for equal loading. (B) Changes in mRNA levels in cells described in A. a, ZO-1; b, occludin; and c, E-cadherin. Total cellular RNA was isolated, and levels of ZO-1, occludin, and E-cadherin mRNAs were measured by real-time quantitative PCR analysis. Values are means ± SE of data from three separate experiments. *p < 0.05 compared with cells transfected with the Null for 48 h. C, representative immunoblots of ZO-1, occludin, and E-cadherin proteins as measured by Western blot analysis in cells described in A. Data are representative from three independent experiments showing similar results.

View larger version (55K): [in this window] [in a new window]   Figure 2. Cellular distribution of ZO-1, occludin, and E-cadherin proteins and changes in epithelial barrier function after JunD overexpression. For immunostaining studies, Caco-2 cells were plated in a four-well chamber slide for 2 d and then transfected with the JunD expression vector (JunD) or control vector (Null) for 72 h. Cells were fixed; permeablized; incubated with the specific antibody against ZO-1, occludin, or E-cadherin; and then with anti-IgG conjugated with fluorescein isothiocyanate. (A) ZO-1 in Null-transfected cells. (B) ZO-1 in JunD-transfected cells. (C) Occludin in Null-transfected cells. (D) Occludin in JunD-transfected cells. (E) E-Cadherin in Null-transfected cells. (F) E-Cadherin in JunD-transfected cells. Original magnification, 1000x. Three experiments were performed that showed similar results. (G) Changes in TEER in control cells and cells transfected with JunD or Null for 72 h. TEER assays were performed on 12-mm Transwell filters as described in Materials and Methods. Values are means ± SE of data from eight samples. *p < 0.05 compared with control cells and cells transfected with the Null. (H) [14C]Mannitol permeability. The membrane-impermeable trace molecule [14C]mannitol was added to the insert medium, and the entire basal medium was collected 2 h thereafter for paracellular trace flux assays. Values are means ± SE of data from eight samples. *p < 0.05 compared with control cells and cells transfected with the Null.

View larger version (19K): [in this window] [in a new window]   Figure 3. Effect of ectopic expression of the junD gene on ZO-1 promoter activity after mutation of AP-1 and CREB binding sites. (A) Schematic representation of deletion of ZO-1-promoter Luc reporter constructs. AP-1 and CREB indicate the relative locations of AP-1 and CREB binding sites within the ZO-1-promoter. (B) Basal activity of various deletion mutants of the ZO-1 promoter in Caco-2 cells without JunD overexpression. Cells were transfected with different deletion mutants of ZO-1-promoter, and levels of the luciferase reporter activity were detected 48 h after the transfection. Results were normalized relative to Renilla-driven luciferase activity and expressed as means ± SE of data from three separate experiments. (C) Changes in luciferase reporter activity of deletion constructs after JunD overexpression. Cells were cotransfected with different ZO-1 promoter luciferase reporter deletion constructs and the JunD expression vector or Null, and luciferase activity was assayed 48 h after transfection. Values are means ± SE of data from three separate experiments. *p < 0.05 compared with cells transfected with the Null. (D) Luciferase reporter activity of CREB point mutant of ZO-1-promoter. a, schematic representation of CREB point mutants of the ZO-1 promoter. Mutagenic oligonucleotides were designed to hybridize to the ZO-1-promoter construct to create the mutant where the CREB consensus site was eliminated by making a base change. b, levels of reporter gene activity. Values are means ± SE of data from three separate experiments. *p < 0.05 compared with Null-transfected cells. (E) Binding activity as measured by ChIP analysis. The association of JunD with a proximal region of ZO-1 promoter (between –620 and –446) was determined using an anti-JunD antibody (Ab); IgG was used as a negative control. Cross-linked chromatin isolated from cells transfected with either JunD-overexpressing or empty control vectors was immunoprecipitated by using an anti-JunD antibody and the associated chromosomal DNA fragments were amplified by PCR using ZO-1 promoter-specific primers and GAPDH promoter-specific primers as described in Materials and Methods. The expected size of the PCR product was 175 base pairs. Chromosomal DNA input was subject to the same procedures and served as a positive control. Three experiments were performed that showed similar results.

Increased Levels of Endogenous JunD by Depleting Cellular Polyamines Is Associated with ZO-1 Inhibition and Impairment of the Epithelial Barrier Function
To examine the implication of JunD-modulated ZO-1 expression in maintaining the epithelial barrier integrity under biological conditions, we examined the changes in ZO-1 expression levels and intestinal epithelial paracellular permeability after an increase in endogenous JunD abundance by depleting cellular polyamines in differentiated IEC-Cdx2L1 cells. As reported previously (Suh and Traber, 1996; Rao et al., 2002; Guo et al., 2005), IEC-Cdx2L1 cells grown in the presence of 4 mM IPTG for 16 d showed a well-differentiated phenotype. These differentiated IEC-Cdx2L1 cells were polarized, showed lateral membrane interdigitations and microvilli at the apical pole, and also exhibited a well-developed barrier function as indicated by an increase in TEER and a decrease in paracellular tracer flux compared with their parental IEC-6 cells (data not shown). Consistent with our previous studies (Rao et al., 2002; Guo et al., 2005), exposure of differentiated IEC-Cdx2L1 cells to 5 mM DFMO (specific inhibitor of polyamine biosynthesis) for 6 d completely inhibited ornithine decarboxylase (ODC) enzyme activity and almost totally depleted cellular polyamines. The levels of putrescine and spermidine were undetectable on day 6 after treatment with DFMO, and spermine had decreased by 65% (data not shown).

As shown in Figure 4A, polyamine depletion by DFMO increased the steady-state levels of JunD protein, which was prevented by exogenous putrescine (10 µM) given together with DFMO. The increase in endogenous JunD levels in the polyamine-deficient cells was also associated with an inhibition in ZO-1 promoter activity (Figure 4B, left) when cells were transfected with the 10WT-Luc (with the CREB site), but this repression was abolished when the CREB site was mutated (Figure 4B, right). The decreased levels of ZO-1 promoter activity were accompanied by reductions of ZO-1 mRNA (Figure 4Ca) and protein (Figure 4Cb) in polyamine-deficient cells. Furthermore, the reduced ZO-1 levels in cells with elevated JunD through polyamine depletion was also associated with dysfunction of the epithelial barrier, as indicated by an increase in levels of paracellular flux of [¹⁴C]mannitol (Figure 4D). In the presence of DFMO, exogenous putrescine not only prevented induced JunD but also returned ZO-1 expression to near normal level. Consequently, the epithelial barrier function was also returned to normal when putrescine was administered together with DFMO.

View larger version (27K): [in this window] [in a new window]   Figure 4. Effect of increased levels of endogenous JunD by depleting cellular polyamines through inhibition of ODC on ZO-1 transcription and epithelial barrier function. Cells were grown in control cultures, cultures in which ODC activity was inhibited with 5 mM DFMO, and cultures inhibited with DFMO and supplemented with 10 µM putrescine (Put) for 6 d. (A) Representative immunoblots for JunD protein as measured by Western blotting analysis. Equal loading was monitored by immunoblotting of actin, and three experiments were performed that showed similar results. (B) ZO-1 promoter activity as measured by using either wild-type (10WT-Luc) or CREB point-mutated (10Mut-Luc) ZO-1 promoter reporter constructs. Cells were grown in media containing either DFMO alone or DFMO plus Put for 4 d and then transfected with the 10WT-Luc or 10Mut-Luc. After 48 h, transfected cells were harvested and assayed for luciferase activity. Values are means ± SE of data from three separate experiments. *p < 0.05 compared with controls, and cells were exposed to DFMO plus Put. (C) Changes in levels of ZO-1 mRNA (a) and protein (b) in cells described in A. Levels of ZO-1 mRNA were measured by real-time quantitative PCR analysis, whereas its protein levels were examined by Western blot analysis using the specific anti-ZO-1 antibody. Values are means ± SE of data from three separate experiments. *p < 0.05 compared with controls and cells exposed to DFMO plus Put. (D) [14C]Mannitol permeability in cells descried in A. After cells were grown in control cultures or cultures containing DFMO or DFMO plus Put for 4 d, and then they were trypsinized, plated at confluent density on the insert, and maintained under the same culture conditions for additional 48 h. [14C]Mannitol was added to the insert medium, and the entire basal medium was collected 2 h thereafter for paracellular trace flux assays. Values are means ± SE of data from eight samples. *p < 0.05 compared with control and DFMO + Put.

View larger version (21K): [in this window] [in a new window]   Figure 5. Effect of JunD silencing on ZO-1 expression and paracellular permeability in polyamine-deficient cells. Cells were initially treated with 5 mM DFMO for 4 d and then transfected with siJunD or C-siRNA in the presence of DFMO for additional 48 h. (A) Representative immunoblots of JunD and ZO-1 proteins. (B) Changes in levels of paracellular permeability in JunD-knockdown cells described in A. After cells were transfected with siJunD or C-siRNA, they were plated at confluent density on the insert, and maintained in the presence of DFMO for additional 48 h. Levels of paracelluar permeability were measured 2 h after addition of [14C]mannitol. Values are means ± SE of data from eight samples. *p < 0.05 compared with control cells; +, p < 0.05 compared with cells treated with DFMO alone or DFMO-treated cells transfected with C-siRNA.

Second, we determined the effect of induced JunD on ZO-1 translation by examining the relative distributions of ZO-1 mRNA and RNA-binding proteins (HuR, TIAR, and AUF1) on individual fractions from polysome gradients. Polysome distribution profiles were prepared in control cells and in cells transfected with the JunD vector as described previously (Bhattacharya et al., 2006; Lal et al., 2006; Vasudevan and Steitz, 2007). In this study, fractions 1–3 made up mRNAs that were not associated with components of the translation machinery or cosedimented with ribosome subunits (monosomes); hence, they were not considered to be translated. Fractions 4–6 made up mRNAs that bound to single ribosomes or formed polysomes of low olecular-weight and they were considered to be translated at low-to-moderate levels. Fractions 7–9 made up the mRNAs that were associated with polysomes of high molecular weight, and they were thus considered to be actively translated. As shown in Figure 6A, ectopic expression of the junD caused a global inhibition of translation as indicated by a decrease in the high-molecular-weight polysome component. Western analysis of fractions across the profiles showed that HuR was abundant in low-molecular-weight fractions (2–5), but there were no significant differences in HuR abundance in sucrose density gradients from control and JunD-transfected cells. The levels of TIAR and AUF1 in both controls and JunD-transfected cells were predominantly located in monosomes and ribosome subunits (1–3). Interestingly, the levels of TIAR detected in fractions 1–2 were increased after JunD overexpression. When the distribution of the ZO-1 mRNA levels in fractions across the profiles in these two groups was compared, ZO-1 mRNA was shown to shift toward nontranslating or low-translating gradient fractions (3–4) after JunD overexpression (Figure 6B). These observations are in keeping with the general trend in polysome levels and strongly support the possibility that increased JunD also inhibits ZO-1 translation.

View larger version (43K): [in this window] [in a new window]   Figure 6. Polysomal distributions of RNA-binding proteins (HuR, TIAR, and AUF-1) and ZO-1 mRNA in cells overexpressing JunD. After cells were transfected with Null (control) or the JunD expression vector (JunD) for 48 h, nuclei were pelleted, and the resulting supernatant was fractionated through a 10 to 50% linear sucrose gradient. (A) Distribution of HuR, TIAR, and AUF1 proteins in various polysomal fractions prepared from control cells (a) or cells transfected with the JunD (b). Proteins obtained from individual fractions were analyzed by Western blot analysis with the specific antibody against HuR, TIAR, or AUF1; and three experiments were performed that showed similar results. (B) quantification of ZO-1 mRNA levels in extracts from controls and JunD-transfected cells. Left, relative distribution of ZO-1 mRNA along the gradients. Total RNA was isolated from each of fractions, and levels of ZO-1 mRNA were measured by real-time RT-PCR analysis. Right, quantitative data of ZO-1 mRNA in fractions of monosomes unbound to ribosomal material (UN), fractions of lo molecular weight (LMW), and fractions of high molecular weight (HMW). Values are means ± SE from three separate experiments. *p < 0.05 compared with controls.

View larger version (21K): [in this window] [in a new window]   Figure 7. Binding of cytoplasmic TIAR, AUF1, and HuR to ZO-1 transcripts in cells described in Figure 6. (A) Schematic representation of ZO-1 mRNA and the AU-rich sequences in its 3'-UTR. (B) Representative immunoblots of TIAR, AUF1, and HuR using the pull-down materials from the 3'-UTR (a) or CR (b). Cytoplasmic lysates (120 µg each) prepared from either controls and JunD-transfected cells were incubated with 6 µg of biotinylated ZO-1 3'-UTR or CR for 30 min at 25°C, and the resulting RNP complexes were pulled down by using streptavidin-coated beads. Levels of TIAR, AUF1, and HuR proteins in the pull-down materials were measured by Western blot analysis. Three experiments were performed that showed similar results. (C) Association of endogenous TIAR with endogenous ZO-1 mRNA after ectopic expression of the junD gene. a, lysates from controls and JunD-transfected cells were used for IP in the presence of anti-TIAR antibody or nonspecific IgG1. RNA in the IP material was used in RT-PCR reactions to detect the presence of ZO-1 mRNA and the resulting PCR products (249 base pairs) were visualized in agarose gels. b, quantification of ZO-1 mRNA levels in the IP materials as measured by real-time PCR analysis. Values are the means ± SE of data from three separate experiments. *p < 0.05 compared with controls.

TIAR Silencing Prevents the JunD-mediated Repression of ZO-1 Translation
Levels of TIAR were reduced by transfection with siTIAR as described previously (Mazan-Mamczarz et al., 2006), and the firefly luciferase reporter containing ZO-1 3'-UTR were constructed (Figure 8A) and used for an in vivo assays for ZO-1 translation as described previously (Vasudevan and Steitz, 2007). To distinguish translational output from mRNA turnover, most luciferase assays were normalized to luciferase-reporter RNA levels to obtain the translation efficiency. As shown in Figure 8B, overexpression of JunD inhibited ZO-1 translation as indicated by a decrease in ZO-1 ARE luciferase reporter gene activity. TIAR silencing by transfection with siTIAR totally prevented the JunD-induced inhibition of ZO-1 translation. The levels of ZO-1 translation efficiency in siTIAR-transfected cells overexpressing JunD were similar to those observed in control cells. Consistently, in TIAR-silenced cells, the decrease in levels of ZO-1 protein induced by JunD was also abolished (Figure 8, C and D). In contrast, transfection of control siRNA did not reduce TIAR expression and failed to alter the inhibitory effect of increased JunD on ZO-1 translation and its protein levels. Together, these results indicate that increased JunD represses ZO-1 translation by enhancing the interaction of TIAR with the ZO-1 3'-UTR in intestinal epithelial cells.

View larger version (24K): [in this window] [in a new window]   Figure 8. Effect of TIAR silencing on ZO-1 3'-UTR–regulated translation in cells overexpressing JunD. (A) Schematic of plasmids. a, control (pGL3-Luc); b, chimeric firefly Luc-ZO-1 3'UTR (pGL3-Luc-ZO-1ARE). (B) Changes in ZO-1 translation efficiency after JunD overexpression. After Caco-2 cells were transfected with the Null vector (control) or JunD expression vector (JunD) for 24 h, they were transfected with siTIAR or C-siRNA for additional 24 h and then transfected with the pGL3-Luc or pGl3-Luc-ZO-1ARE. Transfected cells were harvested and assayed for luciferase activity 24 h after transfection with the pGL3-Luc (served as negative control) or pGl3-Luc-ZO-1ARE. Data were normalized to the pGL3-Luc and Renilla-driven luciferase activity and expressed as the means ± SE of data from three separate experiments. *p < 0.05 compared with controls. +, p < 0.05 compared with cells transfected with JunD alone or JunD plus C-siRNA. (C) Representative immunoblots of TIAR and ZO-1 proteins in cells described in B. Levels of TIAR and ZO-1 proteins were measured by Western blot analysis, and equal loading was monitored by immunoblotting of actin. (D) Quantitative analysis derived from densitometric scans of immunoblots of ZO-1 as described in C. Values are the means ± SE from three separate experiments, and relative levels of ZO-1 protein were corrected for protein loading as measured using densitometry of actin. *p < 0.05 compared with controls. +, p < 0.05 compared with cells transfected with JunD alone or JunD plus C-siRNA.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The results reported in the present study clearly indicate that there is a functional CREB binding site within the proximal region of the ZO-1 promoter and that JunD represses ZO-1 transcription through direct interaction with this CREB site. Several pieces of evidence from the current studies demonstrate that this CREB sequence is crucial for ZO-1 repression by JunD in IECs. First, deletion of this proximal CREB sequence from the ZO-1-promoter (5-Luc) almost prevented JunD-induced repression of ZO-1 promoter activity. Second, ZO-1 repression by overexpression of JunD was abolished when this CREB site within its proximal promoter region was eliminated by making a two-base change. Third, ChIP assay revealed that JunD bound to the proximal region of the ZO-1 promoter in vivo. Finally, CREB point mutation of the ZO-1 promoter also prevented the repression of ZO-1 transcription by increased endogenous JunD after polyamine depletion. The CREB binding site differs from the classical AP-1 binding site by insertion of a single base pair in the middle, and it primarily interacts with CREB-binding proteins (Montminy et al., 1986). However, it was reported that some CREB-binding proteins such as CREB-II can form heterodimers with Jun proteins but not Fos proteins and that these heterodimers share DNA binding specificity with CREB homodimers and interact with the CREB but not with the AP-1 site (MacGregor et al., 1990). Although the exact mechanism underlying the interaction of JunD with CREB within the ZO-1 promoter remains unknown, these experiments establish that the sequence located at proximal region of the ZO-1 promoter is a functional CREB binding site and that JunD represses ZO-1 through this CREB.

Our results also indicate that JunD regulates ZO-1 expression posttranscriptionally, by inhibiting ZO-1 mRNA translation. Overexpression of JunD not only caused a shift of ZO-1 mRNA toward nontranslating or low-translating fractions of polysome profiles (Figure 6B), but it also inhibited the translation of a heterologous ZO-1 3'-UTR reporter (Figure 8B). In addition, increased JunD also caused a global inhibition of translation (Figure 6A). To the best of our knowledge, this is the first report showing that JunD plays an important role in translational regulation. A rapidly growing body of literature demonstrates the essential contribution of posttranscriptional events in gene expression programs, particularly by altering mRNA turnover and translation, two processes that critically contribute to maintaining intestinal mucosal homeostasis (Patel et al., 1998; Li et al., 2001, 2002; Zou et al., 2006; Xiao et al., 2007b). Such control mechanisms typically involve the association of transcripts with specific RNA-binding proteins (RBPs). Among the RBPs that regulate gene expression posttranscriptionally are RBPs that modulate mRNA turnover (HuR, NF90, AUF1, BRF1, TTP, and KSRP) and RBPs that modulate translation (TIAR, TIA-1, HuR, and NF90). The best characterized cis-acting elements regulating mRNA stability and translation are U- and AREs that are usually located in the 3'-UTR of many labile mRNAs (Garneau et al., 2007). Likewise, different RBPs selectively recognize and bind to AREs of target mRNAs, leading to changes in transcript half-life and translation rate (Zou et al., 2006; Mazan-Mamczarz et al., 2006; Abdelmohsen et al., 2007; Xiao et al., 2007b).

Our results also show that JunD represses ZO-1 translation by increasing the interaction of TIAR with the ZO-1 3'-UTR that contains AU- and U-rich stretches, as shown in Figure 7. Our observations are consistent with studies demonstrating that TIAR binds to AU-rich elements commonly found in the 3'-UTRs of labile mRNAs and plays a general role as translational repressor in response to various intracellular and extracellular stress (Gueydan et al., 1999; Kawai et al., 2006; Mazan-Mamczarz et al., 2006). Although HuR and AUF1 also bind to the ZO-1 3'-UTR, these interactions were not altered by JunD overexpression. How JunD influences TIAR binding to the ZO-1 3'-UTR remains an open question, but it is not due to changes in whole-cell TIAR levels (Supplemental Figure 3). We have preliminary evidence that supports the involvement of importin 1, an adaptor protein that transports RBPs from the cytoplasm to the nucleus (Zou et al., 2008). Increased JunD inhibited expression of importin 1 and increased TIAR abundance in the cytoplasm, thus leading to an increase in TIAR binding to ZO-1 mRNA. The exact mechanisms by which JunD modulates importin 1 expression and TIAR subcellular distribution are the focus of our ongoing studies.

The translation data presented in Figure 8 indicate that TIAR levels critically influence repression of ZO-1 translation by JunD. Although the exact mechanism by which TIAR represses mRNA translation remains to be elucidated, TIAR is shown to promote the association of noncanonical preinitiation complexes onto mRNAs (Gueydan et al., 1999; Anderson and Kedersha, 2002; Yu et al., 2003; Kandasamy et al., 2005). In response to stress, it is proposed that stress-activated kinases phosphorylate eukaryotic initiation factor (eIF) 2 and thereby reduce the eIF2-GTP-tRNA^Met that is required to load tRNA_i^Met onto the 40S ribosomal subunit to initiate protein synthesis. Under such conditions, TIAR is assumed to enhance the assembly of translationally inactive pre-initiation complexes (containing the small ribosomal subunit but lacking eIF2 and eIF5) and aggregate in stress granules (Anderson and Kedersha, 2002).

The data obtained in the present study further suggest that the JunD-mediated repression of ZO-1 expression is physiologically significant because increasing the levels of endogenous JunD by depleting cellular polyamines has a similar effect on ZO-1 expression and epithelial barrier function. Polyamines are important for maintaining intestinal epithelial integrity and their intracellular levels are tightly regulated under physiological and pathological conditions (Wang and Johnson, 1991). Polyamine depletion disrupts epithelial barrier function (Guo et al., 2003; 2005), but the exact mechanisms by which polyamine depletion increases paracellular permeability remain poorly understood. The results presented in Figures 4 and 5 show that depletion of cellular polyamines increased JunD but inhibited ZO-1, whereas JunD silencing restored ZO-1 to near normal levels and promoted the barrier function in polyamine-deficient cells. These findings provide novel evidence that polyamine depletion impairs intestinal epithelial barrier function in part by repressing ZO-1 expression through JunD.

In summary, these results indicate that JunD negatively regulates ZO-1 expression and is implicated in controlling the intestinal epithelial barrier function. Increased JunD not only represses ZO-1 transcription but also inhibits its translation, thus leading to an increase in epithelial paracellular permeability. A search for mechanisms whereby JunD modulates ZO-1 transcription revealed that there is a functional CREB binding site within the proximal region of the ZO-1 promoter and that mutation of this CREB site totally blocks ZO-1 repression by JunD. The present study also indicates that overexpression of JunD increases TIAR binding to the ZO-1 3'-UTR, although it does not alter the whole-cell levels of TIAR protein. The silencing of TIAR prevented the JunD-induced inhibition of ZO-1 translation, suggesting that JunD regulates ZO-1 translation by modulating the abundance of [TIAR-ZO-1 mRNA] complexes. Because JunD expression is highly regulated under physiological conditions, these findings suggest that the repression of ZO-1 is a highly dynamic process underlying the function of the intestinal epithelial barrier.

	ACKNOWLEDGMENTS

 
This work was supported by a Merit Review grant (to J.-Y.W.) from the Department of Veterans Affairs and by National Institutes of Health grants DK-57819, DK-61972, and DK-68491 (to J.-Y.W.). J.-Y.W. is a Research Career Scientist, Medical Research Service, U.S. Department of Veterans Affairs. M. G. is supported by the National Institute on Aging-Intramural Research Program, National Institutes of Health.

	Footnotes

 
This article was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E08-02-0175) on June 18, 2008.

These authors contributed equally to this work.

Present address: Chongqing Children's Hospital, Chongqing Medical University, Chongqing City, Chongqing 400014, China.

Address correspondence to: Jian-Ying Wang (jwang{at}smail.umaryland.edu)

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Abdelmohsen, K. et al. (2007). Phosphorylation of HuR by Chk2 regulates SIRT1 expression. Mol. Cell 25, 543–557.[CrossRef][Medline]

Anderson, P., and Kedersha, N. (2002). Visibly stressed: the role of eIF2, TIA-1, and stress granules in protein translation. Cell Stress Chaperones 7, 213–221.[CrossRef][Medline]

Bakiri, L., Lallemand, D., Bossy-Wetzel, E., and Yaniv, M. (2000). Cell cycle-dependent variations in c-Jun and JunB phosphorylation: a role in the control of cyclin D1 expression. EMBO J 19, 2056–2068.[CrossRef][Medline]

Bhattacharya, S. N., Habermacher, R., Martine, U., Closs, E. I., and Filipowicz, W. (2006). Stress-induced reversal of microRNA repression and mRNA P-body localization in human cells. Cold Spring Harb. Symp. Quant. Biol 71, 513–521.[CrossRef][Medline]

Chen, J., Rao, J. N., Zou, T., Liu, L., Marasa, B. S., Xiao, L., Zeng, X., Turner, D. J., and Wang, J. Y. (2007). Polyamines are required for expression of Toll-like receptor 2 modulating intestinal epithelial barrier integrity. Am. J. Physiol. Gastrointest. Liver Physiol 293, G568–G576.[Abstract/Free Full Text]

Fanning, A. S. (2006). ZO proteins and tight junction assembly. In: Tight Junctions, L. Gonzalez-Mariscal, New York: Landes Bioscience, 64–65.

Fanning, A. S., Jameson, B. J., Jesaitis, L. A., and Anderson, J. M. (1998). The tight junction protein ZO-1 establishes a link between the transmembrane protein occludin and the actin cytoskeleton. J. Biol. Chem 273, 29745–29753.[Abstract/Free Full Text]

Fanning, A. S., Little, B. P., Rahner, C., Utepbergenov, D., Walther, Z., and Anderson, J. M. (2007a). The unique-5 and -6 motifs of ZO-1 regulate tight junction strand localization and scaffolding properties. Mol. Biol. Cell 18, 721–731.[Abstract/Free Full Text]

Fanning, A. S., Lye, M. F., Anderson, J. M., and Lavie, A. (2007b). Domain swapping within PDZ2 is responsible for dimerization of ZO proteins. J. Biol. Chem 282, 37710–37716.[Abstract/Free Full Text]

Funke, L., Dakoji, S., and Bredt, D. S. (2005). Membrane-associated guanylate kinases regulate adhesion and plasticity at cell junctions. Annu. Rev. Biochem 74, 219–245.[CrossRef][Medline]

Garneau, N. L., Wilusz, J., and Wilusz, C. J. (2007). The highways and byways of mRNA decay. Nat. Rev. Mol. Cell Biol 8, 113–126.[CrossRef][Medline]

Gerald, D., Berra, E., Frapart, Y. M., Chan, D. A., Giaccia, A. J., Mansuy, D., Pouysségur, J., Yaniv, M., and Mechta-Grigoriou, F. (2004). JunD reduces tumor angiogenesis by protecting cells from oxidative stress. Cell 118, 781–794.[CrossRef][Medline]

Gueydan, C., Droogmans, L., Chalon, P., Huez, G., Caput, D., and Kruys, V. (1999). Identification of TIAR as a protein binding to the translational regulatory AU-rich element of tumor necrosis factor alpha mRNA. J. Biol. Chem 274, 2322–2326.[Abstract/Free Full Text]

Guo, X., Rao, J. N., Liu, L., Zou, T., Keledjian, K. M., Boneva, D., Marasa, B. S., and Wang, J. Y. (2005). Polyamines are necessary for synthesis and stability of occludin protein in intestinal epithelial cells. Am. J. Physiol. Gastrointest. Liver Physiol 288, G1159–G1169.[Abstract/Free Full Text]

Guo, X., Rao, J. N., Liu, L., Zou, T., Turner, D. J., Bass, B. L., and Wang, J. Y. (2003). Regulation of adherens junctions and epithelial paracellular permeability: a novel function for polyamines. Am. J. Physiol. Cell Physiol 285, C1174–C1187.[Abstract/Free Full Text]

Halbleib, J. M., Sääf, A. M., Brown, P. O., and Nelson, W. J. (2007). Transcriptional modulation of genes encoding structural characteristics of differentiating enterocytes during development of a polarized epithelium in vitro. Mol. Biol. Cell 18, 4261–4278.[Abstract/Free Full Text]

Hall, P. A., Coates, P. J., Ansari, B., and Hopwood, D. J. (1994). Regulation of cell number in the mammalian gastrointestinal tract: the importance of apoptosis. J. Cell Sci 107, 3569–3577.[Abstract]

Harter, J. L. (1960). Critical values for Duncan's new multiple range tests. Biometrics 16, 671–685.[CrossRef]

Hilfiker-Kleiner, D., Hilfiker, A., Castellazzi, M., Wollert, K. C., Trautwein, C., Schunkert, H., and Drexler, H. (2006). JunD attenuates phenylephrine-mediated cardiomyocyte hypertrophy by negatively regulating AP-1 transcriptional activity. Cardiovasc. Res 71, 108–117.[Abstract/Free Full Text]

Hirai, S. I., Ryseck, R. P., Mechta, F., Bravo, K., and Yaniv, M. (1989). Characterization of junD: a new member of the jun proto-oncogene family. EMBO J 8, 1433–1439.[Medline]

Hock, T. D., Liby, K., Wright, M. M., McConnell, S., Schorpp-Kistner, M., Ryan, T. M., and Agarwal, A. (2007). JunB and JunD regulate human heme oxygenase-1 gene expression in renal epithelial cells. J. Biol. Chem 282, 6875–6886.[Abstract/Free Full Text]

Kandasamy, K., Joseph, K., Subramaniam, K., Raymond, J. R., and Tholanikunnel, B. G. (2005). Translational control of beta2-adrenergic receptor mRNA by T-cell-restricted intracellular antigen-related protein. J. Biol. Chem 280, 1931–1943.[Abstract/Free Full Text]

Kawai, T., Lal, A., Yang, X., Galban, S., Mazan-Mamczarz, K., and Gorospe, M. (2006). Translational control of cytochrome c by RNA-binding proteins TIA-1 and HuR. Mol. Cell Biol 26, 3295–3307.[Abstract/Free Full Text]

Lal, A., Abdelmohsen, K., Pullmann, R., Kawai, T., Galban, S., Yang, X., Brewer, G., and Gorospe, M. (2006). Posttranscriptional derepression of GADD45alpha by genotoxic stress. Mol. Cell 22, 117–128.[CrossRef][Medline]

Li, L., Liu, L., Rao, J. N., Esmaili, A., Strauch, E. D., Bass, B. L., and Wang, J. Y. (2002). JunD stabilization results in inhibition of normal intestinal epithelial cell growth through p21 after polyamine depletion. Gastroenterology 123, 764–779.[CrossRef][Medline]

Li, L., Rao, J. N., Guo, X., Liu, L., Santora, R., Bass, B. L., and Wang, J. Y. (2001). Polyamine depletion stabilizes p53 resulting in inhibition of normal intestinal epithelial cell proliferation. Am. J. Physiol. Cell Physiol 281, C941–C953.