QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

Vol. 20, Issue 3, 1048-1057, February 1, 2009

This Article Abstract Full Text (PDF) Supplemental Materials All Versions of this Article: E08-04-0438v1 20/3/1048    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Hosiner, D. Articles by Schüller, C. Search for Related Content PubMed PubMed Citation Articles by Hosiner, D. Articles by Schüller, C.

Arsenic Toxicity to Saccharomyces cerevisiae Is a Consequence of Inhibition of the TORC1 Kinase Combined with a Chronic Stress Response

Dagmar Hosiner^*,, Harri Lempiäinen^,,, Wolfgang Reiter^||, Joerg Urban, Robbie Loewith, Gustav Ammerer^||, Rudolf Schweyen^*, David Shore^,, and Christoph Schüller^||

^||Department of Biochemistry, and *Department of Genetics, Max F. Perutz Laboratories, University of Vienna, A-1030 Vienna, Austria; and Department of Molecular Biology and National Center for Competence in Research (NCCR) Program ‘Frontiers in Genetics’, University of Geneva, Geneva 4, 1211 Switzerland

Submitted April 30, 2008; Revised November 25, 2008; Accepted December 1, 2008
Monitoring Editor: Charles Boone

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The conserved Target Of Rapamycin (TOR) growth control signaling pathway is a major regulator of genes required for protein synthesis. The ubiquitous toxic metalloid arsenic, as well as mercury and nickel, are shown here to efficiently inhibit the rapamycin-sensitive TORC1 (TOR complex 1) protein kinase. This rapid inhibition of the TORC1 kinase is demonstrated in vivo by the dephosphorylation and inactivation of its downstream effector, the yeast S6 kinase homolog Sch9. Arsenic, mercury, and nickel cause reduction of transcription of ribosome biogenesis genes, which are under the control of Sfp1, a TORC1-regulated transcriptional activator. We report that arsenic stress deactivates Sfp1 as it becomes dephosphorylated, dissociates from chromatin, and exits the nucleus. Curiously, whereas loss of SFP1 function leads to increased arsenic resistance, absence of TOR1 or SCH9 has the opposite effect suggesting that TORC1 has a role beyond down-regulation of Sfp1. Indeed, we show that arsenic activates the transcription factors Msn2 and Msn4 both of which are targets of TORC1 and protein kinase A (PKA). In contrast to TORC1, PKA activity is not repressed during acute arsenic stress. A normal level of PKA activity might serve to dampen the stress response since hyperactive Msn2 will decrease arsenic tolerance. Thus arsenic toxicity in yeast might be determined by the balance between chronic activation of general stress factors in combination with lowered TORC1 kinase activity.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The transition metal arsenic has a long history of human exploitation as both a poison and a medicine. In more recent times Ehrlich's discovery of the antisyphilitic drug arsphenamine (also known as salvarsan) by systematic chemical modification of arsenic derivatives marked the beginning of modern pharmaceutical research. Arsenic trioxide (ATO) is used today in cancer treatment (Evens et al., 2004; Lu et al., 2007; Wang and Chen, 2008).

Exposure to arsenic evokes a broad spectrum of cellular reactions in Saccharomyces cerevisiae (Tamas and Wysocki, 2001; Haugen et al., 2004; Jin, 2008; Thorsen et al., 2007) and in higher eukaryotes (Salnikow and Zhitkovich, 2008). A number of mechanisms exist for detoxification, probably because arsenic has always been widespread in the environment. These involve reduction of influx through the aquaglyceroporin Fps1p (Wysocki et al., 2001; Thorsen et al., 2006); sequestration into the vacuole in the form of glutathione conjugates, metallothionein, and other metal/protein complexes; and active extrusion (Ghosh et al., 1999). In yeast, genome-wide analysis of the transcription patterns in response to arsenic revealed a complex network of transcription factors controlling the expression of several hundred genes (Haugen et al., 2004; Wysocki et al., 2004; Thorsen et al., 2007). Mitogen-activated protein kinases mediate protective responses involving AP-1- and AP-1-like transcription factors in higher eukaryotes and in fungi (Cavigelli et al., 1996; Rodriguez-Gabriel and Russell, 2005; Thorsen et al., 2006).

The mechanisms by which arsenic might influence signaling pathways other than MAP kinase systems are beginning to emerge. In addition to specific responses (e.g., oxidative stress), arsenic leads to the up-regulation of general stress genes, many of which are targets of the Msn2 and Msn4 transcriptional activators. Msn2 and Msn4 are partially redundant transcriptional activators responsible for the induction of genes in response to several types of stress (Martinez-Pastor et al., 1996; Görner et al., 1998; Gasch, 2007). Activity and phosphorylation status of Msn2 is regulated by protein kinase A (PKA) as a crucial nutrient and carbon source mediator (Santangelo, 2006) and the action of phosphatase PP1. Interestingly however, among all adverse environmental conditions only acute glucose starvation causes dephosphorylation of Msn2 by inactivation of PKA and activation of PP1 (Görner et al., 1998, 2002; De Wever et al., 2005; Garmendia-Torres et al., 2007).

Arsenic also causes the rapid down-regulation of many genes that promote growth, a large number of which encode ribosomal proteins (RPs). Ribosome biogenesis is a major consumer of cellular energy and RNA polymerase II activity (Warner, 1999). Consequently, the regulation of ribosomal protein gene transcription constitutes a key mechanism by which protein synthesis and cell growth is regulated in response to the environment. Recent work has begun to reveal trans-acting factors involved in RP gene activation and regulation. The forkhead-like protein Fhl1 and an interacting factor Ifh1 constitute one axis of RP gene regulation (Martin et al., 2004; Schawalder et al., 2004; Wade et al., 2004; Rudra et al., 2005). A second regulator that localizes to RP gene promoters is the split Zn-finger transcription factor Sfp1 (Fingerman et al., 2003; Jorgensen et al., 2004; Marion et al., 2004). RP gene expression is regulated by PKA through both Fhl1 (Martin et al., 2004) and Sfp1 (Jorgensen et al., 2004). Sfp1 is strongly regulated by the target of rapamycin (TOR) kinase, a conserved serine/threonine kinase of the phosphatidylinositol kinase–related kinase family that functions in all eukaryotes as a central growth regulator (Wullschleger et al., 2006). Yeast and other eukaryotes have two TOR-containing complexes, TORC1 and TORC2, which have different targets and distinct physiological functions (Loewith et al., 2002). Rapamycin inhibits TORC1 activity by the formation of a ternary complex with the peptidyl-prolyl cis-trans isomerase Fpr1 (FKBP12; Heitman et al., 1991). Inhibition of TORC1 causes a loss of Sfp1 from RP gene promoters and its movement from the nucleus to the cytoplasm (Marion et al., 2004). Furthermore, the Sch9 protein kinase, a yeast S6 kinase homolog, has been implicated as a major and direct downstream target of TORC1 for control of both stress- and growth-related transcription (Pedruzzi et al., 2003; Jorgensen et al., 2004; Kaeberlein et al., 2005; Urban et al., 2007), and indeed TOR activity has also been shown to modulate Msn2 intracellular localization (Beck and Hall, 1999; Santhanam et al., 2004).

In this study we investigated the function of the TORC1 and PKA signaling pathways and their downstream targets Sfp1, Sch9, and Msn2/4, in the arsenic stress response of the budding yeast S. cerevisiae. We report that repression of RP genes after trivalent arsenic exposure is correlated with and most likely a consequence of rapid inactivation of TORC1 (within several minutes), whereas PKA activity is sustained. Inhibition of TORC1 leads to reduced Sfp1 activity and RP gene transcription, which nevertheless serves to promote cell growth under conditions of continuous low-level arsenic exposure. Conversely, our data suggest that a second consequence of reduced TORC1 activity, namely the chronic Msn2/4-dependent induction of stress-related genes, is a major contributor to arsenic toxicity.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Plasmids and Yeast Strains
Strains used in this study are summarized in Table 1. To generate the DH303 isogenic series, fragments obtained by PstI digestion of pJJ246 containing the TRP1 gene and EcoRI/SalI digestion from plasmid pJJ217 (Jones and Prakash, 1990) containing the HIS3 genes were integrated by homologous recombination into DH303, DH303 msn2, and DH303 msn4.pHSE2-LacZ has been described previously (Sorger and Pelham, 1987).

For individual microarrays the intensity of the two fluorescent channels were normalized to the mean of ratio of medians of all unflagged features using the Genepix Pro4.1 normalization option. Values of not found features were excluded from further analysis. Mean ratios were calculated for features with at least four values. Genes labeled as dubious ORFs in SGD were also removed from analysis. The remaining values were normalized. The filtered values used for further analysis are available as supplementary file. Cluster analysis (Eisen et al., 1998; Nadon and Shoemaker, 2002; http://rana.stanford.edu/software) was performed using the cluster3 and visualized with TreeView (Saldanha, 2004; http://jtreeview.sourceforge.net). Significant associations to either gene ontology (GO)-terms or transcription factors were obtained with the T-Profiler (http://www.t-profiler.org/; Boorsma et al., 2005). Values of genes associated with the most significant terms were visualized by Cluster analysis using complete linkage and correlation as similarity metric. The hierarchical cluster results were confirmed by K-means clustering. For analysis of the effect of the absence of transcription factors for As(III) gene regulation the ratios of the wild type versus the mutant were calculated and the log2-transformed values and graphically included in the cluster analysis by setting their column weight value to zero.

Green Fluorescent Protein Fluorescence Microscopy
Green fluorescent protein (GFP) was visualized directly in living cells carrying plasmids pADH1MSN2-GFP or pADH1MSN4-GFP and EYsfp1 P_sfp1-GFP without fixation on object slides (at 30°C). Stress conditions were applied as specified for individual experiments. DAPI (2 µg/ml) added 10 min before microscopy was used to localize nuclei. In living cells DAPI also stains other nucleic acids apart from nuclear DNA, resulting in a characteristic background. Images were recorded on a Zeiss Axioplan 2 fluorescence microscope (Thornwood, NY) with a Spot Pursuit camera (Visitron Systems, Puchheim, Germany). Quantification of Sfp1-GFP localization was done by counting 50 cells from three independent experiments (p < 2 x 10^–4).

Chromatin Immunoprecipitation
For immunoprecipitations 20 µl rabbit IgG (Sigma, I5006) coupled magnetic Epoxy beads (Dynabeads M-270; Dynal Biotech, Invitrogen) was added, and tubes were rotated for 3 h at 4°C. Immunoprecipitates were washed with lysis buffer. Both an aliquot of sonicated cleared extract (input) and the immunoprecipitated material were de-cross-linked in TE (Tris-EDTA) plus 1% SDS for at least 8 h at 65°C. Quantitation of immunoprecipitated DNA was obtained by real-time PCR using SYBR Green detection (Bianchi et al., 2004) on an Applied Biosystems ABI Prism 7700 machine (Foster City, CA). Primers used were RPL2B-5' (CAGAGAGGTCGTCCCAGTCT) and RPL2B-3' (GCAGAATCCACCAGGAGTGT) for RPL2B promoter and HL228 (GAATTGAGAGTTGCCCCAGA) and HL229 (AGAAGGCTGGAACGTTGAAA) for the ACT1 gene. For each data point, results were obtained from at least two and up to four experiments.

Chemical Fragmentation
Chemical fragmentation analysis was performed as described (Urban et al., 2007) with the following exceptions. Experiments were done in W303-1A strain background transformed with plasmid pRS416 containing SCH9-5HA (pJU676). Cultures were grown to midlog phase at 30°C in SC-Ura (pH 6.0, 2% glucose, and 0.2% Gln), inhibitors (or drug vehicles) were added for 30 min before harvesting. Antibody 12CA5 was used for the detection of SCH9-5HA.

Analysis of Sfp1 Phosphorylation
Overnight cultures of strain YHL89 (SFP1-TAP) were diluted in YPAD, grown to midlog phase, and harvested by centrifugation, and the pellets immediately frozen in liquid nitrogen. Pellets were resuspended in an equal volume of lysis buffer (100 mM HEPES-KOH, pH 8.0, 10% glycerol, 10 mM EGTA, 0.1 mM EDTA, 0.4% NP-40, 600 mM NaOAc, 1 mM PMSF, 1 mM DTT, 1x protease inhibitor cocktail [Roche, Indianapolis, IN] and 0.1x phosphatase inhibitor mix [PPi: 10 mM NaF, 10 mM NaN3, 10 mM p-nitrophenylphosphate, 10 mM Na₂P₂O₄, and 10 mM β-glycerophosphate]). Cells were lysed by vortexing two times for 1 min with zirconia/silica beads using a Minibeadbeater-8 machine (Biospec Products, Bartlesville, OK). Cell lysates were cleared by centrifugation (10 min, 3000 rpm, +4°C) and diluted with lysis buffer to a protein concentration of 5 mg/ml. For immunoprecipitations 40 µl rabbit IgG (Sigma, I5006) coupled magnetic Epoxy beads (Dynabeads M-270; Dynal Biotech, Invitrogen) were added, tubes were rotated for 3 h at 4°C, and then the beads were washed three times with lysis buffer. Proteins were eluted with 1x SDS-PAGE sample buffer and incubated at 65°C for 10 min and separated by SDS-PAGE. The quantitative ProQ Diamond Phospho-protein Gel Stain (Invitrogen) and SYPRO Ruby protein stain (Bio-Rad, Hercules, CA) in-gel stains were used in accordance with the manufacturer's protocol. The fluorescent intensity of protein bands was visualized and quantified using an Ettan DIGE Imager (GE Healthcare) and accompanying ImageQuant TL software (GE Healthcare). For quantification, Sfp1 phospho-protein levels were normalized to total Sfp1 protein levels and to the background on each lane and presented as relative phosphorylation normalized to untreated wild-type sample.

Phospho Msn2 Analysis
Phosphorylation status of Msn2 was determined by Western blots using a purified antiserum raised against phosphorylated peptides and loading of Msn2 was confirmed with an anti-Msn2 serum, both described by De Wever et al. (2005).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
A Role for TORC1 and Sfp1 in the Transcriptional Response to Arsenic Stress
Whole genome mRNA transcript profiles after treatment with trivalent arsenic [hereafter referred to as As(III)] were in some aspects, such as bulk repression of RP genes and classes of stress genes, similar to those from rapamycin-treated cells both from reported profiles (Hardwick et al., 1999) and our data. This result implicated the TOR nutrient-signaling pathway as a potential As(III) target. To further strengthen this interpretation arsenic stress profiles were generated after 30-min treatment with 0.5 mM As(III) and compared with those of 200 ng/ml rapamycin (Figure 1A). This concentration of As(III) caused only a slight increase in doubling time in exponential cultures. Transcript profiling experiments were done in the two strain backgrounds of the two isogenic sets used (see Table 1). Notably, BY4741 cells have a higher basal resistance against arsenic and gave a more pronounced response of induced genes (139 genes > 4-fold and 523 > 2-fold) than W303-1A (49 > 4-fold and 202 > 2-fold; see Figure 1A and Supplemental Files). In contrast, a similar number of genes was down-regulated in both strains (338 > 2-fold in BY4741 and 312 in W303-1A). T-Profiler analysis (Boorsma et al., 2005) revealed significantly enriched GO terms (Tables 2 and 3), indicating the induction of regulons of the transcription factors Hsf1, Yap1, Rpn4, and Msn2/4, as well as repression of most ribosomal protein genes. The transcript patterns were also in agreement with previous studies (Haugen et al., 2004; Thorsen et al., 2007). Clustering analysis of our As(III) with rapamycin data further suggested similar regulation of genes associated with characteristic GO terms such as translation and stress response (Figure 1A, right panels). Significant GO terms were verified by GO-term enrichment (http://db.yeastgenome.org/cgi-bin/GO/goTermFinder.pl/; Supplemental Table ST1).

View larger version (37K): [in this window] [in a new window]   Figure 1. Transcript profile of arsenic stress. (A) Comparison of transcript profiles from arsenic-stressed (0.5 mM As(III) 30 min) BY4741 and W303-1A cells to rapamycin-treated cells (30 min, 200 ng/ml). Hierarchical clustering of those genes changed at least once <–4- or >4-fold. Right panel shows genes associated to GO terms "translation" and "response to stress". Supplemental Figure S2B shows a comparison of reported microarray data of rapamycin-treated cells. (B) Regulation of 137 ribosomal protein genes by arsenic (0.5 mM As(III)), mercury (30 µM Hg(II)), and nickel (1.5 mM Ni(II)) in wild-type compared with sfp1 mutant cells; all treatments were for 30 min. The BY/BYsfp1 lane shows the color coded quotient of treated wild type and sfp1 mutant. Data to view clustering figures with TreeView are available as Supplemental Files. (C) Tor1 mutant strains have a growth defect during chronic arsenic stress. tor1 is a derivative from W303-1A, the kinase-dead tor1-KD and the rapamycin-insensitive TOR1-1 are derivatives from TB50a. Growth was recorded after a 3-5-d incubation at 30°C.

From these profiles we noted that Sfp1 was also required for full induction of some genes. Strikingly, the levels of Hsf1-dependent heat shock genes were threefold reduced on average (Supplemental Figure S1A). However, Hsf1 function for heat stress signaling was not compromised in the sfp1 mutant. Thus, as predicted activity of a heat-shock element (HSE)-driven lacZ reporter under heat stress was unaffected by the absence of Sfp1, whereas induction by arsenic stress was abolished in the mutant (our unpublished results). Furthermore, we also noticed reduced induction of Yap1- and Rpn4-dependent genes in sfp1 mutant cells (Supplemental Figure S1, B and C, respectively). The mechanism(s) underlying these effects are at present unknown but could be specific to an arsenic stress signal or an indirect consequence of Sfp1 loss.

Because the microarray data suggested a role of TORC1 in the arsenic stress response, we looked at the survival of different Tor1 mutants using colony-forming ("drop") assays on plates containing As(III). We found that mutants lacking full Tor1 function either in a strain deleted for TOR1 (W303 tor1) or a tor1-kDa mutant with impaired kinase activity (Tor1^D2275A), had lower viability in the presence of As(III) (Figure 1C). In contrast, the TOR1–1 allele, which confers rapamycin resistance, did not significantly change arsenic sensitivity. From this, one may conclude that TORC1 activity is necessary for an appropriate adaptive response to As(III).

Arsenic Stress Promotes Sfp1 Chromatin Dissociation, Dephosphorylation, and Cytosolic Relocalization
In unstressed cells growing in nutrient rich medium Sfp1 is concentrated in the nucleus and is associated with RP gene promoters (Jorgensen et al., 2002; Marion et al., 2004). Inhibition of TORC1 kinase by rapamycin causes release of Sfp1 from promoters and its cytoplasmic redistribution (Marion et al., 2004). We therefore investigated if As(III) exposure triggers a similar response. To follow Sfp1 localization, we used cells expressing a GFP-tagged version of Sfp1 from the endogenous SFP1 locus. Within 20 min after arsenic addition we observed a clear reduction of the nuclear fluorescence signal (Figure 2 A and Supplemental Figure S2A). Quantification showed that arsenic and rapamycin caused a similar cytoplasmic accumulation of Sfp1-GFP. To address the Sfp1 phosphorylation status in vivo, we used an in-gel phosphoprotein stain to measure the phosphorylation of a partially purified Sfp1 TAP-tagged protein. Arsenic caused a clear reduction of Sfp1 phosphorylation to about 75% (Figure 2B, bottom), which was visible 15 min after arsenic addition and persisted for at least 30 min. Using chromatin immunoprecipitation (ChIP), we determined the association of a Sfp1 TAP-tag fusion protein with the RPL2B promoter. Arsenic treatment reduced the Sfp1-TAP ChIP signal within 15 min to levels similar to what was observed after rapamycin treatment (Figure 2C). Arsenic and rapamycin thus have similar effects both on chromatin binding and subcellular location of Sfp1.

View larger version (27K): [in this window] [in a new window]   Figure 2. Regulation of Sfp1 by As(III) stress. (A) Localization of Sfp1-GFP. Cells carrying a SFP1-GFP genomic fusion gene were grown to exponential phase and treated with 0.5 mM As(III) and rapamycin (200 ng/ml) for 20 min. GFP-fluorescence images were taken from cells without fixation. Bar, 25 µm. Evaluation of Sfp1-GFP localization is indicated in the bar graph. (B) In-gel phosphoprotein stain of Sfp1 phosphorylation. Sfp1-TAP was purified and separated and stained as described in Materials and Methods. Bottom panel shows phosphorylation of Sfp1 normalized to Sfp1 protein levels at the indicated time points as an average of three independent experiments. (C) Binding of Sfp1 to RP gene promoter in As- and rapamycin-treated cells. Sfp1 recruitment to RPL2B promoter was analyzed by ChIP in a strain carrying a TAP-tagged endogenous allele of SFP1. Samples from unstressed cells (t = 0 min), from As(III)-(0.5 mM) and rapamycin-(200 ng/ml) treated cells at the indicated time points (t = 15 min or 30 min). (D) Growth properties of the indicated SFP1 mutant strains, together with their isogenic parent wild-type strains on arsenic plates. Fivefold serial dilutions of overnight cultures were spotted onto rich (YPD) or synthetic medium (SC-URA) plates containing the indicated amounts of As(III). Growth was recorded after a 3-5-d incubation at 30°C.

TORC1 Kinase Is Inhibited by Arsenic
In an attempt to find an explanation for the apparently contradictory results obtained with sfp1 and tor1 deletion strains, we investigated whether the TORC1 kinase activity is changed by As(III) treatment. We measured the in vivo phosphorylation state of a C-terminal fragment of Sch9, which has been shown recently to be a bona fide TORC1 substrate (Urban et al., 2007). Arsenic addition caused a rapid dephosphorylation of Sch9, similar to that observed after rapamycin treatment (Figure 3A). Although we cannot rule out the possibility that As(III) induces the activity of phosphatase(s) directed against Sch9, these data were consistent with the notion that As(III) causes a rapid inactivation of the TORC1 kinase pathway. Because Sch9 is a primary target of TORC1, we investigated its function during chronic arsenic stress (Urban et al., 2007). Cells lacking Sch9 were sensitive to As(III) (Figure 3B). Significantly, two TORC1-independent "phospho-mimetic" mutants of Sch9 (SCH9-3E and SCH9-2D3E; Urban et al., 2007) conferred resistance to As(III) (Figure 3B). The resistance phenotype of these mutants is consistent with a function of Tor1 separate from Sfp1 regulation during arsenic stress as shown above.

View larger version (71K): [in this window] [in a new window]   Figure 3. TORC1 kinase inhibition by arsenic. (A) Inhibition of TORC1 kinase activity by As(III). Chemical fragmentation analysis of the C-terminus of Sch9 demonstrates dephosphorylation in response to rapamycin (Rap, 200 ng/ml) and As (As(III), 200 or 500 µM) and hyperphosphorylation in response to cycloheximide (CHX, 25 µg/ml). Treatment times are indicated. (B) Growth properties of the indicated SCH9 mutant strains, together with their isogenic parent wild-type strains on As(III) plates. The sch9 mutants were stabilized by the simultaneous deletion of GLN3 and GAT1. Fivefold serial dilutions of overnight cultures were spotted onto containing the indicated amounts of As(III). Growth was recorded after a 3-5-d incubation at 30°C. Relevant strain backgrounds (W303-1A, BY4741) are indicated. (C) Sfp1-GFP localization of cells treated with 40 µM HgCl2 and 1.5 mM NiCl2 for 20 min. Bar, 25 µm. (D) Chemical fragmentation analysis of Sch9 after 20-min treatment at 30°C with to 40 µM HgCl2 and 1.5 mM NiCl2.

Msn2 and Msn4 Are Activated by Arsenic Stress
Arsenic stress could also be an inhibitor of PKA activity, because Sfp1 is both TORC1 and PKA regulated (Jorgensen et al., 2004; Marion et al., 2004). Furthermore, the transcription factors Msn2 and Msn4 are also inhibited by PKA (Smith et al., 1998), and both As(III) and rapamycin induce a cluster of Msn2/4 target genes (Figure 1A, Tables 2 and 3 and Supplemental Files). We confirmed this role of Msn2/4 for gene activation by transcript profiling of a msn2msn4 double deletion strain. Induction of 57 of the total 202 As(III)-induced genes was reduced by more than 1.4-fold in the msn2msn4 mutant (Figure 4A, compare W303 with W303m24). Twenty-four of these 57 genes (P < 2 x 10^–16) were previously reported to be up-regulated by Msn2 overexpression (Chua et al., 2006), indicating that many of these are direct target genes of Msn2/4. To test if Msn2/4 were directly activated by arsenic stress, we investigated the intracellular localization of Msn2- and Msn4-GFP fusion proteins. In unstressed cells both Msn2 and Msn4 are predominantly cytoplasmic, but both Msn2- and Msn4-GFP rapidly accumulated in the nucleus for at least 20 min after As(III) stress (Figure 4B), similar to other stress types (Görner et al., 1998).

View larger version (41K): [in this window] [in a new window]   Figure 4. Function of Msn2/4 and the PKA pathway in arsenic response. (A) Hierarchical clustering (Eisen et al., 1998) of 56 As(III)-induced genes, which were influenced more than 1.4-fold by the absence of Msn2 and Msn4 in the msn2msn4 double mutant strain. (B) Localization of Msn2-GFP in arsenic-stressed cells. W303 msn2msn4 cells transformed with pADH1-MSN2-GFP and pADH1-MSN4-GFP were grown to exponential phase in synthetic medium and treated for 20 min with 1 mM As(III) at 30°C. GFP-fluorescence images were taken from cells without fixation. Bar, 25 µm. (C) Phosphorylation status of PKA sites of Msn2. W303-1A cells were grown in YPD medium to exponential phase and stressed by addition of 1 mM As(III). Samples for total protein extracts were taken at 15-min intervals and analyzed on Western blots with phosphorylation-specific antibodies directed against S620, S582, and S288. Msn2 and Kar2 levels served as a loading control.

To analyze the importance of Msn2/4 for growth in the presence of arsenic, we tested mutants lacking Msn2, Msn4 or both (Figure 5A). Deletion of either MSN2 or MSN4 had no effect on sensitivity, whereas the msn2msn4 double mutant displayed increased tolerance. Therefore, Msn2/4 reduce growth during arsenic stress. This was supported by the enhanced arsenic sensitivity upon overexpression of either MSN2 or MSN4 under the control of the ADH1 promoter. Mutants lacking the PKA regulatory subunit (bcy1) have constitutively high PKA activity and low activity of Msn2/4. These mutants displayed higher resistance to arsenic. Comparing the arsenic resistance of the msn2msn4 double mutant strain to a mutant additionally lacking PKA activity (tpk1tpk2tpk3 msn2/4) demonstrates a role of PKA in parallel to its function as a regulator of Msn2/4 (Figure 5B). This might involve the inhibitory action of PKA on the Rim15 kinase and its downstream transcription factor Gis1 (Roosen et al., 2005).

View larger version (80K): [in this window] [in a new window]   Figure 5. Growth of Msn2/4 mutants on As(III) solid medium representing chronic arsenic stress. Cultures were grown to saturation and spotted in 5- or 10-fold dilution series. (A) Comparison of DH303 series cells. (B) Hyperactive PKA (bcy1) confers resistance to As(III). PKA targets beside Msn2 are involved in As(III) resistance. (C) Double deletion of Msn2 and Msn4 alleviates the arsenic sensitivity of tor1 mutants. Plates were photographed after 2–4 d at 30°C.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Arsenic in the form of trivalent arsenite As(III) causes major metabolic adjustments and evokes a highly complex transcriptional response. We analyze here the contribution of the nutrient signaling protein kinases Target Of Rapamycin Complex 1 (TORC1) and PKA to the cellular arsenic response. We show rapid inactivation of TORC1 kinase but not of PKA. This effect modulates the activity of downstream factors such as Sch9, Sfp1, and Msn2/4 and has complex consequences for cell growth and survival in response to chronic arsenic exposure. Interestingly, our genetic data suggest that As(III) toxicity is caused in part by interference between signaling pathways.

Arsenic Inhibits TORC1
Our biochemical evidence indicates clearly that arsenic inhibits the rapamycin-sensitive TORC1 kinase. First, cells treated with rapamycin and the metalloid arsenic share a similar global transcriptional pattern. Second, interaction of the TORC1 mediator Sfp1 with a ribosomal protein gene promoter was reduced by As(III) to the same low level as observed after rapamycin treatment. Third, coincident with As(III) exposure, Sfp1 phosphorylation was decreased, and its localization was shifted from almost exclusively nuclear to a more cytoplasmic distribution. Fourth, we found that the phosphorylation status of Sch9, a bone fide in vivo target of TORC1 (Urban et al., 2007), was rapidly reduced upon As(III) stress. Moreover, cells treated with mercury and nickel ions also displayed a similar shift of localization of Sfp1 and reduced Sch9 phosphorylation and RP gene repression, indicating that the response to arsenic observed here is part of a more general metal ion stress response.

The mechanism by which arsenic inhibits TORC1 activity is currently not known to us. Arsenic could, for example, affect the stability of the TORC1 complex and/or upstream signaling components. In S. cerevisiae, TOR signaling has been proposed to respond to metabolic signals originating from nitrogen and carbon sources (Schmidt et al., 1998; Beck and Hall, 1999; Kuruvilla et al., 2001; Crespo et al., 2002). Glutamine deprivation inhibits TORC1 (Crespo et al., 2002). Arsenic stress causes cells to channel sulfur into increased glutathione biosynthesis, as suggested by phenotypic profiling (Haugen et al., 2004) and later by direct measurement (Thorsen et al., 2007). The glutamate incorporated into glutathione is connected to glutamine pools by glutamate synthase (GOGAT) encoded by GLT1. It remains to be shown if increased glutathione consumption by the formation of As(GS)₃ conjugates results in a significant drop of glutamine levels. On the other hand, glutathione deprivation by arsenic might also cause other side effects such as oxidative stress, which also reduces TORC1 activity (Urban et al., 2007).

The Complex Role of TORC1 in Arsenic Resistance
The down-regulation of RP gene expression signifies a major shift of cellular activity because it consumes a large proportion of the synthetic capacity of rapidly growing cells (Warner, 1999). Many different stress conditions cause reduction of RP gene synthesis (Jorgensen et al., 2004; Marion et al., 2004), presumably to save resources and to allow a shift of the gene transcription capacity of RNA Pol II to genes encoding proteins with protective functions, such as heat-shock proteins (HSPs). This was also observed earlier for arsenic (Chang et al., 1989). The other side of the coin is that high RP gene transcription facilitates ribosome biogenesis, high capacity for protein synthesis and thus enhanced proliferation, when resources are available (Hartwell et al., 1974; Hartwell and Unger, 1977; Warner, 1999; Jorgensen et al., 2004). Therefore, dynamic control of RP gene transcription is important in a competitive environment. Our data indicate that inhibition of TORC1 by As(III) leads to the rapid inactivation of Sfp1 and a consequent reduction of RP gene expression. A similar loss of RP gene promoter binding is observed for Ifh1 upon As(III) treatment (data not shown), again paralleling the effect of rapamycin (Schawalder et al., 2004). Interestingly, Sfp1 null mutants showed a higher capacity to survive under conditions of chronic arsenic stress. This result might be viewed as contradictory to the lower resistance seen with the TOR1 null mutants. However, we see in microarrays that RP gene expression does not change in Sfp1 mutants. Therefore, these mutant cells are desensitized against RP gene repression. We speculate that in the wild-type strains chronic arsenic stress might drive many cells toward a terminal arrest condition caused in part by reduced RP gene expression. The arsenic sensitive phenotype of tor1 mutant cells might be due to other targets of TORC1 such as Sch9. Furthermore, the transient inhibition of Sfp1 due to TORC1 inhibition as here reported with arsenic stress might be part of a general adaptive response. Consistent with this, overexpression of Sfp1 was detrimental to growth under arsenic stress. Nevertheless, increased survival of SFP1 deletion mutants under chronic arsenic stress comes with the cost of a significantly reduced growth rate.

Unlike SFP1 deletion, the absence of either Tor1 or Sch9 rendered cells more sensitive to arsenic. Consistent with an active role of the Tor1-Sch9 axis in counteracting As(III) stress, the phosphomimetic Sch9 mutants (SCH9-3E, SCH9-2D3E), whose activity is TORC1 independent, confer As(III) resistance. Because all three proteins (Sfp1, Tor1, and Sch9) function to activate RP genes, these observations indicate that Tor1 and Sch9 have function(s) related to the response to As(III) that are not shared with Sfp1. We suggest that one such function is the inhibition of Msn2/4, because deletion of these two genes completely reverses the As(III)-sensitivity phenotype of tor1 cells (Figure 6). Consistent with this idea, previous work has implicated TORC1 as a negative regulator of Msn2/4 (Beck and Hall, 1999), at least partly acting through Sch9, which has recently been shown to down-regulate several Msn2/4 target genes (Urban et al., 2007) and also directly regulates Rim15, a protein kinase involved in Msn2/4 regulation (Wanke et al., 2008). TORC1 may well have other functions that promote growth in the presence of As(III). For example, TORC1 is involved in vacuolar-sorting functions (Aronova et al., 2007) and might be important for vacuolar sequestration of glutathione conjugates resulting from As(III) exposure (Ghosh et al., 1999). In any event, our genetic data indicate that inhibition of TORC1 signaling has two counteracting consequences regarding cell growth under conditions of chronic As(III) stress: inhibition of Sfp1 and derepression of Msn2/4. Although the former promotes growth at sublethal doses of As(III), continued expression of the stress factors Msn2/4 blocks growth. Moreover, arsenic might also trigger a general stress response, activating Msn2/4 and inactivating TORC1 in parallel. This scenario is in line with our genetic data showing that msn2/4 and tor1 mutants are independent. However, the fact that rapamycin as a rather specific inhibitor of TORC1 also activates Msn2, favors a sequential model in which TORC1 acts upstream to inactivate Msn2/4.

View larger version (34K): [in this window] [in a new window]   Figure 6. Schematic model of connections between signaling pathways and substrates.

In any case, PKA activity stays in a range that does not hinder down-regulation of RP genes. Hyperactive PKA prevents cytoplasmic accumulation of Sfp1 and also activates Fhl1/Ihf1, thus promoting RP gene transcription (Martin et al., 2004; Schawalder et al., 2004; Schmelzle et al., 2004). Because in strains with zero PKA activity the shift of Sfp1 localization is not disturbed (Warner, 1999; Marion et al., 2004), PKA activity below a threshold is most probably a precondition for inhibition of Sfp1. Sustained PKA activity is beneficial during chronic As(III) stress. It prevents hyperactivation of Msn2/4, which is detrimental for cell growth (Durchschlag et al., 2004). This is supported by the increased As(III) resistance of mutants lacking Msn2 and Msn4. Second, additional repression of RP gene expression by reduced PKA activity through inactivation of Fhl1-Ifh1 might cause a pronounced shut-down of RP gene transcription, leading to irreversible stasis. In line with this notion, we find enhanced resistance of mutants with constitutive high PKA activity (bcy1) and increased arsenic stress sensitivity in cells with low (or no) PKA activity. Part of this phenotype can be attributed to inactivation of Msn2 and Msn4 by high PKA, but also to other targets, because its inactivation increases sensitivity in cells lacking Msn2 and Msn4 (tpk1/2/3msn2/4 vs. msn2/4). In fact, PKA and TORC1 kinases also regulate the Rim15 kinase, which is required for entry into the stationary phase (Pedruzzi et al., 2003).

Our results indicate a strong contribution of RP gene transcription in the arsenic stress response and a delicate balance of responses regulated by PKA and TOR (Figure 6). Dynamic regulation of RP gene expression has a role in the adaptation of growth and division according to environmental conditions. Arsenic seems to drive this response system into a dead-end situation where chronic activation of stress genes leads to severe growth inhibition. Our data indicate that although PKA may have an important influence on RP gene transcription under some conditions, TORC1 activity plays a key role even when PKA levels are high (Marion et al., 2004; Zurita-Martinez and Cardenas, 2005; Chen and Powers, 2006), arguing against models in which PKA acts downstream of TOR to regulate ribosome biogenesis (Schmelzle et al., 2004). One key question that remains is the mechanism by which arsenic inhibits TORC1. The answer to this may have important implications for understanding the effects of As(III) on humans, given the high degree of conservation of TORC1.

	ACKNOWLEDGMENTS

 
We thank Peter W. Piper (University of Sheffield, Sheffield, United Kingdom) for the HSE-LacZ plasmid, Veerle de Wever for technical advice, and Nicolas Roggli for assistance with artwork. This work was supported by the Herzfelder Foundation (C.S.), the Austrian Science Fund (P19966 [GenBank] -B12 to C.S.), the WWTF and SYSMO/Translucent (R.S.), the Swiss National Fund (31DY00-108708 to D.S.), the Canton of Geneva (R.L. and D.S.), the European Science Foundation EUROCORES program (03-DYNA-F-32 to D.S. and G.A.), and FP6-STREP QUASI (G.A.).

	Footnotes

 
This article was published online ahead of print in MBC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E08-04-0438) on December 10, 2008.

These authors contributed equally to this work.

Address correspondence to: David Shore (david.shore{at}molbio.unige.ch) or Christoph Schüller (christoph.schueller{at}univie.ac.at)

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Aronova, S., Wedaman, K., Anderson, S., Yates, J., 3rd, and Powers, T. (2007). Probing the membrane environment of the TOR kinases reveals functional interactions between TORC1, actin, and membrane trafficking in Saccharomyces cerevisiae. Mol. Biol. Cell 18, 2779–2794.[Abstract/Free Full Text]

Beck, T., and Hall, M. N. (1999). The TOR signalling pathway controls nuclear localization of nutrient-regulated transcription factors. Nature 402, 689–692.[CrossRef][Medline]

Bianchi, A., Negrini, S., and Shore, D. (2004). Delivery of yeast telomerase to a DNA break depends on the recruitment functions of Cdc13 and Est1. Mol. Cell 16, 139–146.[CrossRef][Medline]

Boorsma, A., Foat, B. C., Vis, D., Klis, F., and Bussemaker, H. J. (2005). T-profiler: scoring the activity of predefined groups of genes using gene expression data. Nucleic Acids Res 33, W592–W595.[Abstract/Free Full Text]

Cavigelli, M., Li, W. W., Lin, A., Su, B., Yoshioka, K., and Karin, M. (1996). The tumor promoter arsenite stimulates AP-1 activity by inhibiting a JNK phosphatase. EMBO J 15, 6269–6279.[Medline]

Chang, E. C., Kosman, D. J., and Willsky, G. R. (1989). Arsenic oxide-induced thermotolerance in Saccharomyces cerevisiae. J. Bacteriol 171, 6349–6352.[Abstract/Free Full Text]

Chen, J. C., and Powers, T. (2006). Coordinate regulation of multiple and distinct biosynthetic pathways by TOR and PKA kinases in S. cerevisiae. Curr. Genet 49, 281–293.[CrossRef][Medline]

Chua, G., Morris, Q. D., Sopko, R., Robinson, M. D., Ryan, O., Chan, E. T., Frey, B. J., Andrews, B. J., Boone, C., and Hughes, T. R. (2006). Identifying transcription factor functions and targets by phenotypic activation. Proc. Natl. Acad. Sci. USA 103, 12045–12050.[Abstract/Free Full Text]

Crespo, J. L., Powers, T., Fowler, B., and Hall, M. N. (2002). The TOR-controlled transcription activators GLN3, RTG1, and RTG3 are regulated in response to intracellular levels of glutamine. Proc. Natl. Acad. Sci. USA 99, 6784–6789.[Abstract/Free Full Text]

De Wever, V., Reiter, W., Ballarini, A., Ammerer, G., and Brocard, C. (2005). A dual role for PP1 in shaping the Msn2-dependent transcriptional response to glucose starvation. EMBO J 24, 4115–4123.[CrossRef][Medline]

Durchschlag, E., Reiter, W., Ammerer, G., and Schüller, C. (2004). Nuclear localization destabilizes the stress-regulated transcription factor Msn2. J. Biol. Chem 279, 55425–55432.[Abstract/Free Full Text]

Duvel, K., Santhanam, A., Garrett, S., Schneper, L., and Broach, J. R. (2003). Multiple roles of Tap42 in mediating rapamycin-induced transcriptional changes in yeast. Mol. Cell 11, 1467–1478.[CrossRef][Medline]

Eisen, M. B., Spellman, P. T., Brown, P. O., and Botstein, D. (1998). Cluster analysis and display of genome-wide expression patterns. Proc. Natl. Acad. Sci. USA 95, 14863–14868.[Abstract/Free Full Text]

Evens, A. M., Tallman, M. S., and Gartenhaus, R. B. (2004). The potential of arsenic trioxide in the treatment of malignant disease: past, present, and future. Leuk. Res 28, 891–900.[CrossRef][Medline]

Fingerman, I., Nagaraj, V., Norris, D., and Vershon, A. K. (2003). Sfp1 plays a key role in yeast ribosome biogenesis. Eukaryot. Cell 2, 1061–1068.[Abstract/Free Full Text]

Garmendia-Torres, C., Goldbeter, A., and Jacquet, M. (2007). Nucleocytoplasmic oscillations of the yeast transcription factor Msn2, evidence for periodic PKA activation. Curr. Biol 17, 1044–1049.[CrossRef][Medline]

Gasch, A. P. (2007). Comparative genomics of the environmental stress response in ascomycete fungi. Yeast 24, 961–976.[CrossRef][Medline]

Ghosh, M., Shen, J., and Rosen, B. P. (1999). Pathways of As(III) detoxification in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 96, 5001–5006.[Abstract/Free Full Text]

Görner, W., Durchschlag, E., Martinez-Pastor, M. T., Estruch, F., Ammerer, G., Hamilton, B., Ruis, H., and Schüller, C. (1998). Nuclear localization of the C2H2 zinc finger protein Msn2p is regulated by stress and protein kinase A activity. Genes Dev 12, 586–597.[Abstract/Free Full Text]

Görner, W., Durchschlag, E., Wolf, J., Brown, E. L., Ammerer, G., Ruis, H., and Schüller, C. (2002). Acute glucose starvation activates the nuclear localization signal of a stress-specific yeast transcription factor. EMBO J 21, 135–144.[CrossRef][Medline]

Hardwick, J. S., Kuruvilla, F. G., Tong, J. K., Shamji, A. F., and Schreiber, S. L. (1999). Rapamycin-modulated transcription defines the subset of nutrient-sensitive signaling pathways directly controlled by the Tor proteins. Proc. Natl. Acad. Sci. USA 96, 14866–14870.[Abstract/Free Full Text]

Hartwell, L. H., Culotti, J., Pringle, J. R., and Reid, B. J. (1974). Genetic control of the cell division cycle in yeast. Science 183, 46–51.[Free Full Text]

Hartwell, L. H., and Unger, M. W. (1977). Unequal division in Saccharomyces cerevisiae and its implications for the control of cell division. J. Cell Biol 75, 422–435.[Abstract/Free Full Text]

Haugen, A. C., Kelley, R., Collins, J. B., Tucker, C. J., Deng, C., Afshari, C. A., Brown, J. M., Ideker, T., and Van Houten, B. (2004). Integrating phenotypic and expression profiles to map arsenic-response networks. Genome Biol 5, R95.[CrossRef][Medline]

Heitman, J., Movva, N. R., and Hall, M. N. (1991). Targets for cell cycle arrest by the immunosuppressant rapamycin in yeast. Science 253, 905–909.[Abstract/Free Full Text]

Jin, Y. H., Dunlap, P. E., McBride, S. J., Al-Refai, H., Bushel, P. R., and Freedman, J. H. (2008). Global transcriptome and deletome profiles of yeast exposed to transition metals. PLoS Genet 4, e1000053.[CrossRef][Medline]

Jones, J. S., and Prakash, L. (1990). Yeast Saccharomyces cerevisiae selectable markers in pUC18 polylinkers. Yeast 6, 363–366.[CrossRef][Medline]

Jorgensen, P., Nishikawa, J. L., Breitkreutz, B. J., and Tyers, M. (2002). Systematic identification of pathways that couple cell growth and division in yeast. Science 297, 395–400.[Abstract/Free Full Text]

Jorgensen, P., Rupes, I., Sharom, J. R., Schneper, L., Broach, J. R., and Tyers, M. (2004). A dynamic transcriptional network communicates growth potential to ribosome synthesis and critical cell size. Genes Dev 18, 2491–2505.[Abstract/Free Full Text]

Jung, C., and Rothstein, A. (1965). Arsenate uptake and release in relation to the inhibition of transport and glycolysis in yeast. Biochem. Pharmacol 14, 1093–1112.[CrossRef][Medline]

Kaeberlein, M., Powers, R. W., 3rd, Steffen, K. K., Westman, E. A., Hu, D., Dang, N., Kerr, E. O., Kirkland, K. T., Fields, S., and Kennedy, B. K. (2005). Regulation of yeast replicative life span by TOR and Sch9 in response to nutrients. Science 310, 1193–1196.[Abstract/Free Full Text]

Kuepfer, L., Peter, M., Sauer, U., and Stelling, J. (2007). Ensemble modeling for analysis of cell signaling dynamics. Nat. Biotechnol 25, 1001–1006.[CrossRef][Medline]

Kuruvilla, F. G., Shamji, A. F., and Schreiber, S. L. (2001). Carbon- and nitrogen-quality signaling to translation are mediated by distinct GATA-type transcription factors. Proc. Natl. Acad. Sci. USA 98, 7283–7288.[Abstract/Free Full Text]

Loewith, R., Jacinto, E., Wullschleger, S., Lorberg, A., Crespo, J. L., Bonenfant, D., Oppliger, W., Jenoe, P., and Hall, M. N. (2002). Two TOR complexes, only one of which is rapamycin sensitive, have distinct roles in cell growth control. Mol. Cell 10, 457–468.[CrossRef][Medline]

Lu, J., Chew, E. H., and Holmgren, A. (2007). Targeting thioredoxin reductase is a basis for cancer therapy by arsenic trioxide. Proc. Natl. Acad. Sci. USA 104, 12288–12293.[Abstract/Free Full Text]

Marion, R. M., Regev, A., Segal, E., Barash, Y., Koller, D., Friedman, N., and O'Shea, E. K. (2004). Sfp1 is a stress- and nutrient-sensitive regulator of ribosomal protein gene expression. Proc. Natl. Acad. Sci. USA 101, 14315–14322.[Abstract/Free Full Text]

Martin, D. E., Soulard, A., and Hall, M. N. (2004). TOR regulates ribosomal protein gene expression via PKA and the Forkhead transcription factor FHL1. Cell 119, 969–979.[CrossRef][Medline]

Martinez-Pastor, M. T., Marchler, G., Schüller, C., Marchler-Bauer, A., Ruis, H., and Estruch, F. (1996). The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p are required for transcriptional induction through the stress response element (STRE). EMBO J 15, 2227–2235.[Medline]

Nadon, R., and Shoemaker, J. (2002). Statistical issues with microarrays: processing and analysis. Trends Genet 18, 265–271.[CrossRef][Medline]

Pedruzzi, I., Dubouloz, F., Cameroni, E., Wanke, V., Roosen, J., Winderickx, J., and De Virgilio, C. (2003). TOR and PKA signaling pathways converge on the protein kinase Rim15 to control entry into G0. Mol. Cell 12, 1607–1613.[CrossRef][Medline]

Rodriguez-Gabriel, M. A., and Russell, P. (2005). Distinct signaling pathways respond to arsenite and reactive oxygen species in Schizosaccharomyces pombe. Eukaryot. Cell 4, 1396–1402.[Abstract/Free Full Text]

Roosen, J., Engelen, K., Marchal, K., Mathys, J., Griffioen, G., Cameroni, E., Thevelein, J. M., De Virgilio, C., De Moor, B., and Winderickx, J. (2005). PKA and Sch9 control a molecular switch important for the proper adaptation to nutrient availability. Mol. Microbiol 55, 862–880.[CrossRef][Medline]

Rudra, D., Zhao, Y., and Warner, J. R. (2005). Central role of Ifh1p-Fhl1p interaction in the synthesis of yeast ribosomal proteins. EMBO J 24, 533–542.[CrossRef][Medline]

Saldanha, A. J. (2004). Java Treeview—extensible visualization of microarray data. Bioinformatics 20, 3246–3248.[Abstract/Free Full Text]

Salnikow, K., and Zhitkovich, A. (2008). Genetic and epigenetic mechanisms in metal carcinogenesis and cocarcinogenesis: nickel, arsenic, and chromium. Chem. Res. Toxicol 21, 28–44.[CrossRef][Medline]

Santangelo, G. M. (2006). Glucose signaling in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev 70, 253–282.[Abstract/Free Full Text]

Santhanam, A., Hartley, A., Duvel, K., Broach, J. R., and Garrett, S. (2004). PP2A phosphatase activity is required for stress and Tor kinase regulation of yeast stress response factor Msn2p. Eukaryot. Cell 3, 1261–1271.[Abstract/Free Full Text]

Schawalder, S. B., Kabani, M., Howald, I., Choudhury, U., Werner, M., and Shore, D. (2004). Growth-regulated recruitment of the essential yeast ribosomal protein gene activator Ifh1. Nature 432, 1058–1061.[CrossRef][Medline]

Schmelzle, T., Beck, T., Martin, D. E., and Hall, M. N. (2004). Activation of the RAS/cyclic AMP pathway suppresses a TOR deficiency in yeast. Mol. Cell. Biol 24, 338–351.[Abstract/Free Full Text]

Schmidt, A., Beck, T., Koller, A., Kunz, J., and Hall, M. N. (1998). The TOR nutrient signalling pathway phosphorylates NPR1 and inhibits turnover of the tryptophan permease. EMBO J 17, 6924–6931.[CrossRef][Medline]

Smith, A., Ward, M. P., and Garrett, S. (1998). Yeast PKA represses Msn2p/Msn4p-dependent gene expression to regulate growth, stress response and glycogen accumulation. EMBO J 17, 3556–3564.[CrossRef][Medline]

Sorger, P. K., and Pelham, H. R. (1987). Purification and characterization of a heat-shock element binding protein from yeast. EMBO J 6, 3035–3041.[Medline]

Tamas, M. J., and Wysocki, R. (2001). Mechanisms involved in metalloid transport and tolerance acquisition. Curr. Genet 40, 2–12.[CrossRef][Medline]

Thorsen, M. et al. (2006). The MAPK Hog1p modulates Fps1p-dependent arsenite uptake and tolerance in yeast. Mol. Biol. Cell 17, 4400–4410.[Abstract/Free Full Text]

Thorsen, M., Lagniel, G., Kristiansson, E., Junot, C., Nerman, O., Labarre, J., and Tamas, M. J. (2007). Quantitative transcriptome, proteome and sulfur metabolite profiling of the Saccharomyces cerevisiae response to arsenite. Physiol. Genomics 30, 35–43.[Abstract/Free Full Text]

Urban, J. et al. (2007). Sch9 is a major target of TORC1 in Saccharomyces cerevisiae. Mol. Cell 26, 663–674.[CrossRef][Medline]

Wade, J. T., Hall, D. B., and Struhl, K. (2004). The transcription factor Ifh1 is a key regulator of yeast ribosomal protein genes. Nature 432, 1054–1058.[CrossRef][Medline]

Wang, Z. Y., and Chen, Z. (2008). Acute promyelocytic leukemia: from highly fatal to highly curable. Blood 111, 2505–2515.[Abstract/Free Full Text]

Wanke, V., Cameroni, E., Uotila, A., Piccolis, M., Urban, J., Loewith, R., and De Virgilio, C. (2008). Caffeine extends yeast lifespan by targeting TORC1. Mol. Microbiol 69, 277–285.[CrossRef][Medline]

Warner, J. R. (1999). The economics of ribosome biosynthesis in yeast. Trends Biochem. Sci 24, 437–440.[CrossRef][Medline]

Wullschleger, S., Loewith, R., and Hall, M. N. (2006). TOR signaling in growth and metabolism. Cell 124, 471–484.[CrossRef][Medline]

Wysocki, R., Chery, C. C., Wawrzycka, D., Van Hulle, M., Cornelis, R., Thevelein, J. M., and Tamas, M. J. (2001). The glycerol channel Fps1p mediates the uptake of arsenite and antimonite in Saccharomyces cerevisiae. Mol. Microbiol 40, 1391–1401.[CrossRef][Medline]

Wysocki, R., Fortier, P. K., Maciaszczyk, E., Thorsen, M., Leduc, A., Odhagen, A., Owsianik, G., Ulaszewski, S., Ramotar, D., and Tamas, M. J. (2004). Transcriptional activation of metalloid tolerance genes in Saccharomyces cerevisiae requires the AP-1-like proteins Yap1p and Yap8p. Mol. Biol. Cell 15, 2049–2060.[Abstract/Free Full Text]

Zurita-Martinez, S. A., and Cardenas, M. E. (2005). Tor and cyclic AMP-protein kinase A: two parallel pathways regulating expression of genes required for cell growth. Eukaryot. Cell 4, 63–71.[Abstract/Free Full Text]

This Article Abstract Full Text (PDF) Supplemental Materials All Versions of this Article: E08-04-0438v1 20/3/1048    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Hosiner, D. Articles by Schüller, C. Search for Related Content PubMed PubMed Citation Articles by Hosiner, D. Articles by Schüller, C.