|
|
|
|
Vol. 8, Issue 10, 1829-1844, October 1997
Department of Biology, Yale University, New Haven, Connecticut 06520-8103
Submitted May 15, 1997; Accepted July 1, 1997| |
ABSTRACT |
|---|
|
|
|---|
Rom2p is a GDP/GTP exchange factor for Rho1p and Rho2p GTPases; Rho
proteins have been implicated in control of actin cytoskeletal rearrangements. ROM2 and RHO2 were
identified in a screen for high-copy number suppressors of
cik1
, a mutant defective in microtubule-based processes in Saccharomyces cerevisiae. A
Rom2p::3XHA fusion protein localizes to sites of polarized
cell growth, including incipient bud sites, tips of small buds, and
tips of mating projections. Disruption of ROM2 results
in temperature-sensitive growth defects at 11°C and 37°C.
rom2
cells exhibit morphological defects. At permissive temperatures, rom2
cells often form
elongated buds and fail to form normal mating projections after
exposure to pheromone; at the restrictive temperature, small budded
cells accumulate. High-copy number plasmids containing either
ROM2 or RHO2 suppress the
temperature-sensitive growth defects of cik1
and
kar3
strains. KAR3 encodes a
kinesin-related protein that interacts with Cik1p. Furthermore,
rom2
strains exhibit increased sensitivity to the microtubule depolymerizing drug benomyl. These results suggest a role
for Rom2p in both polarized morphogenesis and functions of the
microtubule cytoskeleton.
| |
INTRODUCTION |
|---|
|
|
|---|
The cytoskeleton is the infrastructure of the cell; it aids in
determining cell shape and participates in many dynamic cellular processes. Two major components of all eukaryotic cytoskeletons are
microfilaments, composed of actin subunits, and microtubules, made up
of tubulin heterodimers. The two systems are involved in distinct
processes within the cell. This is particularly evident in the budding
yeast Saccharomyces cerevisiae. The primary functions of the
yeast actin cytoskeleton are in secretion, cell growth and polarized
morphogenesis, resulting in bud and mating projection formation (Adams
and Pringle, 1984
; Kilmartin and Adams, 1984
; Novick and Botstein,
1985
; Read et al., 1992
). Yeast microtubules are dispensable
for secretion and cell growth; instead, they are required for nuclear
positioning, chromosome segregation during mitosis and meiosis, and
nuclear fusion during mating (karyogamy; Adams and Pringle, 1984
;
Kilmartin and Adams, 1984
; Huffaker et al., 1988
; Jacobs
et al., 1988
; Snyder et al., 1991
; reviewed in
Page and Snyder, 1993
).
Studies of the regulation of cytoskeletal function and rearrangement in
a wide variety of eukaryotes have provided insight into the mechanisms
controlling the organization of microfilaments and, to a lesser degree,
microtubules. A family of highly conserved ras-homologous small
GTPases, known as Rho proteins, have emerged as key molecular switches
that regulate organization of the actin cytoskeleton (reviewed in Hall,
1994
; Ridley, 1995
).
Rho proteins cycle between a GTP-bound active state and a GDP-bound
inactive state with the assistance of several important classes of
regulatory proteins. One type of Rho regulator is the GDP/GTP-exchange
factor (GEF), which stimulates release of GDP from the Rho protein,
allowing subsequent binding of GTP and thereby Rho activation (Hart
et al., 1991
). The Rho protein is returned to the GDP-bound
inactive state by a Rho-specific GTPase-activating protein (GAP) that
stimulates the inherent GTPase activity of the Rho protein (Ridley,
1995
, and references therein). Additional Rho regulation involves
Rho-GDP dissociation inhibitors that bind Rho proteins in their
GDP-bound form and prevent exchange for GTP, thus locking them in the
inactive state (Ohga et al., 1989
; Fukumoto et
al., 1990
).
Five genes encoding members of the Rho family have been identified in
S. cerevisiae, including CDC42, RHO1,
RHO2, RHO3, and RHO4. All have been
implicated in controlling polarized cell morphogenesis during bud
and/or mating projection formation (Madaule et al., 1987
;
Adams et al., 1990
; Johnson and Pringle, 1990
; Matsui and Toh-e, 1992
; Li et al., 1995
; Imai et al., 1996
).
Cdc42p and Rho1p are essential and localize to sites of polarized cell
growth, which are regions where actin patches accumulate (Ziman
et al., 1993
; Yamochi et al., 1994
). Rho1p has
recently been shown to regulate both cell wall biosynthesis and protein
kinase C (Pkc1p) signaling (Drgonova et al., 1996
; Qadota
et al., 1996
).
Members of the different classes of Rho regulators have also been
identified in S. cerevisiae. CDC24 encodes a GEF for Cdc42p, and ROM1 and ROM2 encode GEFs for Rho1p (Zheng
et al., 1994
; Ozaki et al., 1996
; Schmidt
et al., 1997
). BEM3 encodes a GAP for Cdc42p, and
BEM2 and SAC7 encode GAPs for Rho1p (Zheng
et al., 1993
; Peterson et al., 1994
; Schmidt
et al., 1997
). Genetic evidence suggests that Rom2p and
Bem2p also regulate Rho2p activity (Kim et al., 1994
; Ozaki
et al., 1996
; Schmidt et al., 1997
; this study).
Finally, a Rho-GDP dissociation inhibitor that binds Rho1p is encoded
by RDI1 (Masuda et al., 1994
).
Although the biochemical functions of Rho regulators have been
well-characterized in both yeast and mammalian cells, much less is
known about their cellular distribution and how they are controlled.
The only direct Rho regulator whose subcellular distribution has been
determined is S. cerevisiae Cdc24p, which localizes over the
entire cell periphery (Pringle et al., 1995
). This pattern contrasts that of the Cdc24p target Cdc42p, which concentrates at sites
of polarized cell growth (Ziman et al., 1993
). Whether other
regulators localize and function at sites of Rho protein activity is an
important but unresolved issue.
We have identified ROM2 in a screen for high-copy
suppressors of cik1
, a mutant defective in
microtubule-based processes (Page and Snyder, 1992
). During the course
of our work, ROM2 was also identified by two other groups,
as a high-copy suppressor of both a cold-sensitive rho1
strain (Ozaki et al., 1996
) and a temperature-sensitive
tor2 strain (Schmidt et al., 1997
).
TOR2 encodes a phosphatidylinositol kinase homologue
required for initiation of translation in response to nutrient
concentrations (Barbet et al., 1996
; DiComo and Arndt, 1996
)
and is also involved in polarization of the actin cytoskeleton (Schmidt
et al., 1996
). To further elucidate the function of
ROM2, we localized its protein product and analyzed the
phenotypes resulting from a rom2 null mutation. Our findings
demonstrate that Rom2p is concentrated at sites of polarized growth in
a cell-cycle-dependent manner, the first such localization for a
regulator of Rho proteins. Phenotypic and genetic analysis suggests
that Rom2p is involved in both cell morphogenesis and microtubule
function. Possible mechanisms for such roles are discussed.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Yeast Strains, Media, and Standard Methods
Yeast strains used in this study are listed in Table
1. Yeast genetic methods
and growth media were as described in Guthrie and Fink (1991)
. Rich
medium consisted of yeast extract, peptone, and dextrose, supplemented
with adenine (YPDA). Yeast transformations were by the lithium acetate
method of Ito et al. (1983)
. Where indicated, benomyl
(DuPont, Wilmington, DE) dissolved in dimethyl sulfoxide was added to
YPDA medium to final concentrations of 10, 20, and 30 µg/ml. For the
ROM2 overexpression experiments, cells containing
YEp24-ROM2 or YEp24 plasmids were first grown on SC medium
lacking uracil prior to incubation on benomyl plates; this increases
the benomyl sensitivity of these strains relative to those grown
initially in YPDA medium.
|
Construction of Epitope-tagged Rom2p Strains
A strain containing the ROM2::3XHA allele
(Y1722) was constructed by using the polymerase chain reaction (PCR)
epitope-tagging method of Schneider et al. (1995)
. The
primers
5
-GCTACGAGGATTATCGCGGGTATGATACAGTTGCGTCGTTAGATTTCTGGGGTAGGGAACAAAAGCTGG-3
and
5
-GCTTTTTTATTCTAAAGAAAATAAGGAAAGTCTATATACGTTGCTATCCTATAGGGCGAATTGG-3
were used to amplify an ~1.5-kb region of pMPY-3xHA. The PCR product contains the URA3 gene flanked by direct repeats encoding
three copies of the hemagglutinin (HA) epitope and contains 53 bp of sequence from the 3
end of the ROM2 gene at one end and the
ROM2 translation termination codon and 45 bp of downstream
sequence at the other end. This DNA fragment was used to transform
yeast strain Y1721; transformants were selected on synthetic complete medium lacking uracil. For three strains, PCR analysis confirmed correct integration immediately upstream of the ROM2 stop
codon. These strains were incubated on plates containing medium with 5-fluoroorotic acid to select for cells that had lost the
URA3 gene through recombination between the two 3XHA coding
regions. This event, as confirmed by PCR and immunoblot
analysis, leaves a single in-frame copy of the 3XHA-encoding sequence
at the carboxyl-terminal coding end of the ROM2 gene.
Yeast Immunoblot Analysis
Cells were grown in 10 ml of YPDA to early-logarithmic phase
(OD600 = 0.5) and washed, and pellets were frozen at
70°C for 2 h. After thawing on ice, cells were lysed by using
glass beads in 100 µl of lysis buffer (1% Nonidet P-40, 0.5% sodium
deoxycholate, 0.1% SDS, 150 mM NaCl, 50 mM
Tris(hydroxymethyl)aminomethane hydrochloride, pH 7.5) containing
protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 1 µg/ml
leupeptin, 1 µg/ml pepstatin, 10 µg/ml soybean trypsin inhibitor,
and 10 µg/ml L-1-tosylamide-2-phenylethyl chloromethyl ketone). Lysates were centrifuged for 10 min at 14,000 × g to remove unlysed cells and cell debris. Cell lysates were
then mixed at a 4:1 (vol/vol) ratio with fivefold-concentrated Laemmli
sample buffer (Sambrook et al., 1989
) and boiled for 5 min
before loading onto 8% polyacrylamide gels containing SDS. After
electrophoretic separation, proteins were blotted onto Immobilon-P
(Millipore, Bedford, MA) and probed with monoclonal anti-HA antibodies
(12CA5 from BABCO, Richmond, CA); reactive bands were detected using alkaline phosphatase-conjugated anti-mouse antibodies (Ambersham, Arlington Heights, IL) and the CDP Star detection reagent (Boehringer Mannheim, Indianapolis, IN).
Fluorescence Microscopy
Indirect immunofluorescence was performed as described by
Gehrung and Snyder (1990)
and Pringle et al. (1991)
.
Cells were fixed in 3.7% formaldehyde for 30 min, washed twice, and
resuspended in 1.2 M sorbitol and 50 mM potassium phosphate buffer, pH
6.8 (solution A). Spheroplasts were prepared by incubating fixed cells in solution A containing 5 µg/ml Zymolyase 100T, 0.03% glusulase, and 0.2% 2-mercaptoethanol at 37°C for 30 min. Spheroplasts were washed, resuspended in solution A, and placed onto
poly(L-lysine)-coated slides. Rom2p::3XHA was
detected by primary antibody incubation overnight at 4°C with mouse
12CA5 antibodies diluted in 0.15 M NaCl, 0.05 M sodium phosphate, pH
7.4, and 0.1% bovine serum albumin (BSA; PBS/BSA), and secondary
antibody incubation was for 2 h at room temperature with
CY3-conjugated goat anti-mouse antibodies (Jackson ImmunoResearch, West
Grove, PA) diluted in PBS/BSA. After both primary and secondary
antibody incubations, slides were washed with PBS/BSA twice and PBS/BSA
containing 0.1% Nonidet P-40 once. Finally, slides were mounted in
70% glycerol, 2% n-propyl gallate, and 0.25 µg/ml
Hoechst 33258.
Cells with mating projections were prepared from midlogarithmic-phase
cultures (OD600 = 1.2) of MATa stains
grown in 5 ml of YPDA, washed twice with sterile double-distilled
H20, and incubated for 2 h in 5 ml of YPDA containing
5 µg/ml
-factor (Sigma, St. Louis, MO) before formaldehyde
fixation. Spheroplasts of cells with mating projections were prepared
as described above but with incubation in spheroplast solution at
37°C for only 10 min.
The distribution of filamentous actin (F-actin) was analyzed by incubating fixed cells suspended in PBS with an equal volume of rhodamine- or fluorescein isothiocyanate-conjugated phalloidin (Molecular Probes, Eugene, OR; 3.3 µM, dissolved in methanol) for 2 h at room temperature in the dark. Stained cells were washed once, resuspended in PBS, and placed onto poly(L-lysine)-coated slide for fluorescence microscopy.
Disruption of ROM2 and RHO2
Deletion of the entire open reading frames (ORFs) of the
ROM2 and RHO2 genes was performed by the
PCR-based method described by Baudin et al.
(1993)
. A heterozygous
rom2
::HIS3/ROM2 strain (Y1241) was
generated by using the primers
5
-CAGTGCTCTATTACTGCTGACTTAATTGGACAATTCATCTCTTTTCCTGCGGTTACTCTTGGCCTCCTCTAG-3
and
5
-GTTATGCTTTTTATTCTAAAGAAAATAAGGAAAGTCTATATACGTTGCTATCGCCTCGTTCAGAATG-3
to amplify the HIS3 gene from pRS303. The resulting PCR
product, containing the HIS3 gene flanked on one side by 52 bp of sequence from the region directly upstream of the predicted
ROM2 initiator codon and on the other side by 47 bp of
sequence from the region directly downstream of the ROM2
termination codon, was used to transform Y270. Transformants with
correct replacement of the ROM2 genomic locus with the
HIS3 gene were confirmed by PCR analysis and sporulated, and
tetrads were dissected and analyzed.
A heterozygous rho2
::TRP1/RHO2
strain (Y1693) was generated by using the primers
5
-GACATCAATTGCTGAAACGTTCTGCTTTGGTTGTGCTTTTGATCCCGTACTGGAGAGGGCCAAGAGGGAG-3
and
5
-GTTTTTCCCTCCCTTGCTAAAAAGATAATGTATCATTTCAGTGTAAGTTTTTTGGCCTGCAGGCAAGTGCAC3
to amplify the TRP1 gene from pRS304. The resulting PCR
product, containing the TRP1 gene flanked on one side by 50 bp of sequence for the region directly upstream of the RHO2
initiator codon and on the other side by 52 bp of sequence from the
region directly downstream of the RHO2 termination codon,
was used to transform Y270. Transformants were confirmed and analyzed
as described above.
Identification of Multicopy Suppressors of cik1
ts
A YEp24-based 2 µ S. cerevisiae genomic library
(Carlson and Botstein, 1982
) was transformed into a MATa
cik1
::LEU2 strain (Y1728), spread
onto plates containing synthetic complete medium lacking uracil
(plasmid selection), and incubated for 12 h at the permissive
temperature (room temperature) before shifting to the restrictive
temperature (37°C) for 2 d. Of greater than 8000 total
transformants, 34 that grew at the restrictive temperature were
recovered. The plasmids from these strains were rescued into Escherichia coli, and 26 allowed growth at 37°C when
reintroduced into Y1728 or a cik1
::TRP1
strain (Y1705). Based on restriction digest analysis, these
plasmids contained eight distinct sequence groups. Primers flanking the
YEp24 site of genomic DNA insertion were used to generate sequence from
both ends of the insert. BLAST searches with these sequences identified
regions from the S. cerevisiae genome that were encoded by
these plasmids. Subcloning techniques were then employed to identify
the cik1
suppressing (cis) gene from each
group (see summary in Table 3). In each case, plasmids containing the
single ORF indicated in Table 3 were competent for suppression; control
plasmids lacking the ORF failed to suppress the temperature-sensitive
growth defect.
|
| |
RESULTS |
|---|
|
|
|---|
ROM2
ROM2 was identified in a screen for high-copy
suppressors of the temperature-sensitive growth defect of a
cik1
strain. Cik1p complexes with the kinesin-related
microtubule motor Kar3p, and together they are required for proper
chromosome segregation and karyogamy (Meluh and Rose, 1990
; Page and
Snyder, 1992
; Page et al., 1994
; see below). ROM2
is predicted to encode a 1356-amino acid protein with a region of
homology to the human oncogene-encoded dbl protein (Figure
1A), a GEF for human Cdc42 (Hart et
al., 1991
). This dbl-homology domain is common to Rho-GEFs and
contains the GDP/GTP exchange activity (Hart et al., 1994
;
Zheng et al., 1994
; Ozaki et al., 1996
). The
Rom2p amino acid sequence also predicts the presence of a
pleckstrin-homology domain, also common to Rho-GEFs and implicated in
protein-protein or protein-phosphatidylinositol derivative
interactions (Musacchio et al., 1993
; Lemmon et
al., 1996
). Rom2p has recently been identified as a GEF for the
yeast Rho1 protein (Ozaki et al., 1996
).
|
Rom2p Localizes to Sites of Polarized Cell Growth
To gain further insight into the function of Rom2p, we determined
its subcellular localization. The genomic locus of ROM2 was
tagged with the HA epitope coding sequence (Schneider et
al., 1995
; see MATERIALS AND METHODS). A sequence encoding three
copies of the HA epitope was integrated into the carboxyl-terminal
coding sequence of ROM2, just prior to the translational
stop codon. The resulting ROM2::3XHA allele is
functional for ROM2 activity as growth rates at all
temperatures, and bud morphology, are similar between
ROM2::3XHA and wild-type cells (see below).
Immunoblot analysis using anti-HA monoclonal antibodies
detects a protein of approximately 165 kDa in cellular extracts from
ROM2::3XHA strains but not from ROM2
untagged strains (Figure 1B). This corresponds well to the predicted
153-kDa size of the Rom2 protein plus the triple HA epitope.
To determine the subcellular localization of the Rom2::3XHA
fusion protein, indirect immunofluorescence using anti-HA monoclonal antibodies was performed (Pringle, et al., 1991
; Santos and
Snyder, 1997
). As shown in Figure 2,
Rom2p::3XHA exhibits a cell-cycle-dependent localization
pattern. The majority of unbudded cells exhibit diffuse staining
throughout the cell with a few small weakly stained patches (~60% of
unbudded cells, Figure 2A; total cells counted = 100). The
remainder of unbudded cells contain a concentrated patch of bright
staining at the cell cortex (Figure 2, B and H). Colocalization of
Rom2p::3XHA and actin by using anti-HA antibodies and
fluorescein isothiocyanate-conjugated phalloidin, respectively,
indicates that this patch represents the presumptive site of bud
emergence (our unpublished results). Rom2p::3XHA is
concentrated at the bud tips of cells with emerging or small buds
(>70% of tiny or small budded cells; Figure 2, C and D); some
cytoplasmic patches are observed in these cells as well. In cells with
larger buds, staining is more diffuse within the bud but is still
concentrated toward the distal end (Figure 2E). Late in the cell cycle,
when the nucleus has migrated to the bud neck (Figure 2F) and during anaphase (Figure 2G), Rom2p::3XHA localizes to cytoplasmic
patches in both the mother and bud. This pattern continues through the end of mitosis and cytokinesis (Figure 2H). A strain containing Rom2p
with three copies of the myc epitope fused to its carboxyl terminus exhibits identical cell-cycle-dependent staining
patterns with anti-myc antibodies (our unpublished
observation). Unlike F-actin and Rho1p, Rom2p::3XHA was not
evident at the bud neck during cytokinesis (Adams and Pringle, 1984
;
Kilmartin and Adams, 1984
; Yamochi et al., 1994
). These
staining patterns were not detected in ROM2 untagged cells
at any stages of the cell cycle (Figure 2, I-L). Thus, the Rom2
protein localizes to sites of polarized bud growth, similarly to Rho1p
and Cdc42p (Ziman et al., 1993
; Yamochi et al.,
1994
).
|
Rom2p Localizes to the Tips of Mating Projections
Cdc24p is required for mating projection formation and Cdc42p
localizes to the projection tip (Field and Schekman, 1980
; Ziman et al., 1993
). As yet, the localization and function of
other Rho proteins and their regulators in mating cells have not been determined. Concentration of Rom2p::3XHA at sites of
vegetative polarized cell growth suggests the possibility that it may
also localize to such sites in cells exposed to mating pheromone.
Exponentially growing liquid cultures of ROM2 and
ROM2::3XHA MATa strains were treated with
-factor (5 µg/ml, final concentration) for 2 h and then fixed
for indirect immunofluorescence analysis. Staining of
ROM2::3XHA cells with anti-HA antibodies reveals
concentration of Rom2p::3XHA at the tips of mating
projections (Figure 3B, arrowheads). In
addition, these cells demonstrate a diffuse or granular cytoplasmic localization of Rom2p::3XHA; the cytoplasmic staining was
stronger than that observed for unbudded vegetative cells. No staining above background was detected for untagged ROM2 cells
treated with mating pheromone (Figure 3A). Therefore, Rom2p localizes to polarized cell growth sites both in vegetative and mating
pheromone-treated cells.
|
Rom2p Is Required for Proper Cell Growth and Bud Morphology
To further understand the function of Rom2p, the entire
ROM2 genomic locus was replaced with a HIS3
marker (see MATERIALS AND METHODS). Two independent heterozygous
rom2
::HIS3/ROM2 strains were
sporulated and 20 tetrads were dissected for each. Tetrad analysis
demonstrated 2:2 segregation for the HIS marker, and His+ segregants grew slower at 23°C. His+
segregants failed to grow at both 37°C and 11°C, but
His
strains were viable at both temperatures (Figure
4). Therefore, although ROM2
is not essential at 23°C, it is required for growth at both elevated
and lowered temperatures. High-copy plasmids containing either
RHO1 or RHO2, but not CDC42, suppress
the temperature-sensitive growth defect of rom2
strains
at 37°C (our unpublished results). This is consistent with Rom2p
serving as the GEF specific for Rho1p and Rho2p, as described
independently by others (Ozaki et al., 1996
; Schmidt
et al., 1997
).
|
Cell morphology of rom2
strains was analyzed at both
permissive and restrictive temperatures by using
differential-interference contrast microscopy. The actin cytoskeleton
was also examined in these cells by rhodamine-conjugated phalloidin
staining and fluorescence microscopy (Figure
5). At the permissive temperature of
30°C, haploid rom2
strains differ in morphology from
wild-type strains (four different rom2
segregants were
analyzed; the results for one representative strain is quantified;
Table 2). A significant number of cells (7%) with elongated buds are present (a cell with an
elongated bud was scored as one in which the bud length is greater than
twice the bud width, Table 2). Also, large-budded cells appear more
oval or drop-shaped than those of ROM2 strains (Figure 5B).
After shifting rom2
strains to 37°C for 3 h, the proportion of cells with small buds is substantially higher than wild-type strains (49% for rom2
cells as compared with
26% for isogenic wild-type cells) and many cells with elongated buds
are again observed (Figure 5D and Table 2). Cells with elongated buds
are not detected at either temperature in wild-type strains. F-actin
polarization in most rom2
cells resembles that of
ROM2 cells (Figure 5, A-D, rhodamine-phalloidin), in
that actin patches accumulate at the incipient bud site
and throughout the bud of small budded cells (Adams
and Pringle, 1984
; Kilmartin and Adams, 1984
). However, in mutant cells
with unusually elongated large buds, F-actin remains concentrated
toward the bud tip instead of localizing throughout the bud (Figure 5B,
arrowhead). At both temperatures, rom2
cells appear
slightly larger than wild-type cells (Figure 5, A-D). All
morphological defects of rom2
strains are suppressed by
introduction of wild-type ROM2 on a plasmid (our unpublished
results). The accumulation of small-budded cells and appearance of
elongated buds at the restrictive temperature are similar to the
results of Ozaki et al. (1996)
describing a rom1
rom2
strain containing a
PGAL1-ROM2 plasmid under Rom2p-depletion conditions at 30°C. The morphological defects of rom2
strains at the permissive temperature, as well as those of the
homozygous rom2
/rom2
diploid discussed
below, have not been described previously.
|
|
The appearance of abnormal bud morphology is even more striking in
rom2
/rom2
diploids (four homozygous diploid
strains analyzed; the results for one representative strain are
presented in Table 2). Approximately 30% of all budded cells at both
30°C and 37°C have elongated buds with F-actin staining
concentrated toward the distal tip of the bud (Figure 5, F and H,
arrowheads; Table 2). The number of small-budded cells increases upon
shifting to 37°C for 3 h (46% compared with 33% for wild-type
cells), but many of these are also elongated. Elongated buds are not
detected for ROM2/ROM2 wild-type diploids (Figure 5, E and
G; Table 2). Chains and clusters of cells are common in
rom2
/rom2
cultures, suggesting a possible
defect in cytokinesis. In summary, Rom2p is required to
maintain proper polarized bud growth at the restrictive temperature, as
evidenced by the accumulation of small-budded cells. The presence of
cells with elongated buds suggests that Rom2p may also play
a role in regulation of the switch from apical to isotropic bud growth
(reviewed by Lew and Reed, 1995
; see DISCUSSION).
Rom2 Is Important for Projection Formation during Mating
Mating projection formation was also analyzed in four different
rom2
MATa cells. After a 2-h exposure to
mating pheromone at 30°C, approximately 70% of wild-type
MATa cells form mating projections of lengths greater
than half the diameter of the cell (Figure
6A). In contrast, less than 20% of
rom2
MATa cells under the same
conditions form such projections. Mutant cells become much larger than
wild-type cells and either form very small broad projections or do
not form projections at all (Figure 6B). The actin
cytoskeleton is polarized properly in the rom2
cells with
detectable projections, as seen by rhodamine-phalloidin staining
and fluorescence microscopy (our unpublished observations). Therefore,
in addition to maintaining polarized cell growth during budding, Rom2p
is also required for proper mating projection formation in response to
pheromone.
|
Involvement of ROM2 in the Microtubule Cytoskeleton
We originally identified ROM2 in a screen for high-copy
suppressors of the temperature-sensitive growth defect of a
cik1
strain (see MATERIALS AND METHODS; results
summarized in Table 3).
Interestingly, we also found RHO2 as a cik1
suppressing (CIS) gene, along with two other known loci,
MID2 and MAT
-BUD5 (see Chant
et al., 1991
; Herskowitz et al., 1992
), and three
previously uncharacterized genes, CIS1, CIS2, and
CIS3. Mid2p is a transmembrane protein with a putative
Ca2+ binding domain; mid2
mutants are
sensitive to exposure to mating pheromone (Ono et al.,
1994
). CIS1 is predicted to encode a protein with no
significant homology to known proteins. CIS2 is predicted to
encode a protein with homology to
-glutamyltransferases from a
variety of organisms (22% amino acid identity to human
-glutamyltransferase; Sakamuro et al., 1988
).
-Glutamyltransferases catalyze the transfer of glutamate residues to
and from various peptide substrates, such as glutathione (Meister
et al., 1981
); because tubulin has been shown to be
posttranslationally glutamylated (Edde et al., 1990
),
perhaps glutamylation of yeast tubulin by CIS2 affects microtubule function. Finally, CIS3 is predicted to encode a
protein with homology to S. cerevisiae Hsp150p (29% amino
acid identity; Russo et al., 1992
). Further characterization
of these genes will be described elsewhere.
To determine whether the different suppressors are specific for
cik1 mutants or whether they suppress a defect resulting
from loss of function of the Kar3p-Cik1p complex, we tested the
ability of 2 µ plasmids containing CIS genes to suppress
the temperature sensitivity of a kar3
strain (Table 3).
ROM2 and RHO2 plasmids allow both
cik1
and kar3
strains to grow on solid
medium at the restrictive temperature of 37°C; whereas vector alone
or plasmids encoding one of two other S. cerevisiae
Rho-related proteins, Cdc42p and Rho1p, do not (Figure
7). This genetic interaction of
ROM2 and RHO2 with a microtubule-motor complex
suggests involvement of these proteins in functions of the microtubule
cytoskeleton.
|
We analyzed whether strains lacking Rom2p or Rho2p displayed
microtubule-related defects. rom2
and rho2
strains were tested for altered sensitivity to the
microtubule-depolymerizing drug benomyl; failure to grow or enhanced
growth in the presence of benomyl is a common characteristic of strains
containing mutations in genes encoding structural or regulatory
components of microtubules (e.g., Huffaker et al., 1988
;
Hoyt et al., 1991
; Li and Murray, 1991
; Reijo et
al., 1994
; Pellman et al., 1995
; Saunders et
al., 1997
). Wild-type ROM2 strains grow on solid rich
medium containing as much as 30 µg/ml of benomyl; in contrast, an
isogenic rom2
strain fails to grow in the presence of
benomyl concentrations of 20 and 30 µg/ml, and a rho2
strain displays a slight increase in benomyl sensitivity, failing to
grow on plates containing 30 µg/ml (Figure
8; four mutant segregants were tested for
each strain); these concentrations are similar to those that inhibit
growth of several
-tubulin mutants (Reijo et al., 1994
).
This represents the first phenotype described for a RHO2
disruption strain. A strain containing the temperature-sensitive
rho1-104 allele has been shown previously to exhibit
wild-type levels of benomyl sensitivity (Wang and Bretscher, 1995
). In
addition, wild-type strains containing a high-copy ROM2
plasmid display increased resistance to benomyl compared with strains
containing vector alone (the presence of the ROM2 plasmid
allows colony formation in the presence 20 µg/ml benomyl at
102- to 103-fold lower cell concentrations than
cells containing vector; see MATERIALS AND METHODS; our unpublished
results). Thus, phenotypic analysis supports Rom2p involvement in
microtubule stability and/or function.
|
Interestingly, it has been reported that strains lacking Bem2p, a
GAP for Rho1p and Rho2p, also display increased sensitivity to benomyl
(Kim et al., 1994
; Wang and Bretscher, 1995
; Figure 8).
Because the GEF activity of Rom2p should oppose the GAP activity of
Bem2p, we tested whether a BEM2 deletion could partially
suppress the growth defect of rom2
on benomyl. A double
rom2
bem2
mutant was constructed by mating
a rom2
::HIS3 strain (Y1242) with a bem2
::URA3 strain (Y930) and
sporulating the resulting double heterozygous diploid. Tetrad
dissection yielded His+ Ura
and
His
Ura+ segregants that grew slowly as
compared with His
Ura
wild-type segregants.
His+ Ura+ segregants grew even slower, often
taking several days to form a colony at room temperature (20 tetrads
analyzed; our unpublished results). These rom2
bem2
double mutants fail to grow on the lowest
concentration of benomyl tested (10 µg/ml; Figure 8; 4 His+Ura+ segregants tested). Therefore,
disrupting both a GEF and a GAP for the Rho1p/Rho2p GTPase cycle
exacerbates the defect seen in the single mutants (see DISCUSSION).
Microtubule structures from strains containing either a ROM2
deletion or a 2 µ ROM2 plasmid were also examined.
Exponentially growing cells, as well as those from cultures treated
with 5 µg/ml
-factor (which arrests cells in G1 phase)
or 100 mM hydroxyurea (which arrests cells in S phase with a short
spindle and the nucleus migrated to the bud neck), were analyzed by
indirect immunofluorescence with anti-tubulin antibodies. No
significant difference in microtubule staining pattern, length, or
number was detected at any temperature compared with wild-type or
vector control cells for any of the samples (our unpublished
observations). Additionally, nuclear migration and spindle orientation
were analyzed in the different cells by 4,6-diamidino-2-phenylindole
and anti-tubulin staining, respectively. Again, no significant defect
in these processes was observed (our unpublished observation).
Therefore, although genetic and phenotypic analysis of ROM2
suggests that, in addition to a role in actin-mediated events, Rom2p
participates in microtubule-related functions, immunofluorescence
techniques fail to detect differences in microtubule structure or
cytoplasmic microtubule function (see DISCUSSION).
| |
DISCUSSION |
|---|
|
|
|---|
A Rho Regulator Localizes to Sites of Rho Activity
Despite its importance in understanding the molecular and spatial
control of Rho-protein function, data on the subcellular localization
of Rho regulators, in any system, have been limited. We demonstrate
that the yeast Rho-GEF Rom2p localizes to sites of polarized cell
growth, both during budding and mating projection formation. The
cell-cycle-dependent localization of Rom2p is very similar to that of
Rho1p (Yamochi et al., 1994
) and represents the first
example of a Rho regulator concentrating at sites of Rho function.
Unlike Rom2p, another S. cerevisiae Rho-GEF, Cdc24p, is
distributed around the entire cell periphery (Pringle et
al., 1995
), although its target, Cdc42p, localizes to discrete
sites of polarized cell growth (i.e., incipient bud sites and the tips of small buds; Ziman et al., 1993
). Therefore, the
regulation of Cdc42p and Rho1p may differ through the spatial
organization of their GEFs. One model for control of Cdc42p function is
that Cdc24p is only active at sites of Cdc42p accumulation, specified by cortical cues (Pringle et al., 1995
). Another possibility
is that Cdc24p is not regulated in a spatial manner at all; instead it
may be competent for GEF activity throughout the cell periphery, and
Cdc42p localization would, therefore, determine where the GTPase switch
is activated.
The accumulation of both Rho1p and Rom2p at cell growth sites suggests
a different mechanism for Rho1p localized activation. These proteins
may localize to polarized growth sites independently by recognizing
polarity establishment components, such as Cdc42p. Presumably,
activation and translocation of Rom2p and release of Rho1p from
cytoplasmic Rdi1p would occur at the G1-S transition prior
to bud emergence. While this manuscript was in preparation, Schmidt
et al. (1997)
found that Tor2p directly or indirectly activates the Rho1p-GEF activity of Rom2p. Perhaps the putative phosphatidylinositol kinase activity of Tor2p leads to a local accumulation of phosphatidylinositol derivatives that interact with the pleckstrin-homology domain of Rom2p (Harlan et al.,
1994
), resulting in both polarized localization and activation of
Rom2p. Rho1p may independently localize to sites of cell wall synthesis through its interaction with the transmembrane subunits of
1,3-
-glucan synthase (Qadota et al., 1996
).
Alternatively, it is possible that Rom2p and Rho1p are interdependent
for this localization or that there exists a hierarchy, perhaps with
activated Rom2p responsible for recruiting Rho1p. Future localization
studies should determine which of these models is correct.
Although the distributions of Rho1p and Rom2p overlap, the
Rom2p::3XHA cytoplasmic patch distribution in large-budded
cells and absence from the bud neck during cytokinesis differs from that reported for HA-Rho1p. In large-budded cells, HA-Rho1p staining was very faint and diffuse but reappeared at the bud neck in cells undergoing cytokinesis (Yamochi et al., 1994
). These
differences may be due to the sensitivity of detection of each protein
or could represent actual differences in the subcellular distribution of these proteins during the later stages of the cell cycle.
Rom2p Is Required for Proper Cell Growth and Polarized Morphogenesis
We have found that disruption of the ROM2 gene in our
strain background results in slow growth at room temperature and
failure to grow at both 11°C and 37°C. Two independent groups have
found somewhat different phenotypes for rom2
strains:
Ozaki et al. (1996)
report that along with slow growth at
20°C, these strains fail to grow at temperatures above 33°C;
Schmidt et al. (1997)
report normal growth at 37°C and
impaired growth at temperatures of 30°C and lower. Presumably, these
discrepancies are the result of differences in strain backgrounds.
We demonstrate that both haploid and homozygous diploid
rom2
strains have various morphological defects at both
restrictive and permissive temperatures. Upon shift to 37°C,
rom2
strains accumulate small-budded cells with the actin
cytoskeleton polarized to the bud. A strain with a
temperature-sensitive allele of RHO1 also arrests with
small-budded cells and a polarized actin cytoskeleton (Yamochi et
al., 1994
). It is likely that the cessation of bud growth observed
in rho1 and rom2 strains at the restrictive
temperature is due to loss of 1,3-
-glucan synthase activity, which
has been shown to require GTP-bound Rho1p (Qadota et al.,
1996
), and/or altered regulation of the protein kinase C signalling
pathway (Drgonova et al., 1996
). In addition to the
small-budded phenotype, many rom2
cells have elongated
buds, even at the permissive temperature. The phenotype is most
striking in homozygous diploid cells, with bud lengths often exceeding
five times the length of its mother. This is suggestive of a defect in
the switch from apical to isotropic bud growth (see Lew and Reed,
1995
). It is possible that Rom2p is involved in redirecting growth from
the bud tip to regions throughout the bud; regulation of Rom2p
localization or function by cell cycle regulatory components might
mediate this switch. Finally, although rom2
cells exposed
to mating pheromone arrest normally, they become enlarged and fail to
form typical wild-type mating projections. This phenotype, along with
the localization of Rom2p to projection tips, demonstrates that
Rom2p-mediated cellular morphogenesis extends to mating-pheromone
differentiated cells as well.
Rom2p May Play a Role in Functions of the Microtubule Cytoskeleton
CIS5, a gene identified as a high-copy suppressor of
the temperature-sensitive growth defect of a cik1
strain,
was found to be identical to ROM2. Cik1p is involved in
microtubule functions, such as chromosome segregation and karyogamy
(Page and Snyder, 1992
). Cik1p complexes with the kinesin-related Kar3
protein, a minus-end-directed microtubule motor (Meluh and Rose, 1990
; Endow et al., 1994
; Page et al., 1994
). These
proteins localize to spindle pole bodies and microtubules and are
involved in spindle assembly and/or stability in vegetative cells
(Meluh and Rose, 1990
; Page et al., 1994
). A high-copy
plasmid containing ROM2 also suppressed a
kar3
ts strain, indicating that Rom2p suppresses a
defect resulting from loss of the motor complex function, rather than
just loss of Cik1p. Interestingly, CIS4 was found to
encode Rho2p and also suppresses the kar3
ts
strain. This suppression was specific for RHO2, as no other
yeast Rho-related gene, including RHO1, on a 2 µ plasmid
demonstrated this activity.
Similar to mutants defective in microtubule stability and/or function,
rom2
strains exhibit increased sensitivity to
microtubule-depolymerizing growth conditions (i.e., cold temperature
and the presence of benomyl). Strains with disruptions in the
BEM2 gene also exhibit growth defects in the presence of
benomyl (Kim et al., 1994
; Wang and Bretscher, 1995
; this
study). Wang and Bretscher (1995)
have also observed that a
bem2
strain displays synthetic lethality with a
tub2 allele defective in nuclear microtubules. Surprisingly, disruption of both ROM2, encoding a Rho1/Rho2-GEF (Ozaki
et al., 1996
), and BEM2, encoding a Rho1/Rho2-GAP
(Zheng et al., 1993
; Peterson et al., 1994
),
results in an additive defect for both growth rate and benomyl
sensitivity. This implies that either Rho protein cycling between GDP-
and GTP-bound form is important for its function or that Rom2p and
Bem2p have downstream targets of their own involved in microtubule
function. Interestingly, the temperature-sensitive growth defect of
rom2
was partially suppressed by disruption of
SAC7, encoding a Rho1p-specific GAP (Schmidt et
al., 1997
); it will be interesting to test whether rom2
sac7
double mutants also exhibit
enhanced growth defects in the presence of benomyl.
There are at least two mechanisms by which Rom2p may participate in
microtubule function. One possibility is that Rho proteins or their
regulators affect assembly or stability of contact sites between
cytoplasmic microtubules and the actin cytoskeleton. Putative microtubule-capture sites have been implicated in proper positioning of
mitotic spindles prior to asymmetric cell divisions in such diverse
systems as Caenorhabditis elegans embryogenesis and yeast budding (Hyman 1989
; Snyder et al., 1991
; Palmer et
al., 1992
; Cheng et al., 1994
). In yeast these sites
are thought to lie, at least in part, at sites of polarized growth
(Snyder et al., 1991
; Page and Snyder, 1993
). However, we
detected no significant difference in nuclear migration or spindle
orientation in strains lacking Rom2p function. Thus, if
actin-microtubule contact sites are affected in rom2
cells, it does not result in significant defects in these particular
processes.
Another possibility, not mutually exclusive from the first, is that
Rom2p or Rho proteins may be directly or indirectly important for
microtubule stability. The differences in growth observed in
rom2
strains under conditions that destablize
microtubules is consistent with this possibility. In mammalian cells,
it has recently been reported that Rho activation is required to
stabilize wound-oriented microtubules in cultured fibroblasts and that
this stabilization occurs independently of the actin cytoskeleton (Cook and Gundersen, 1996
). Furthermore, it has been demonstrated that microtubule depolymerization, by treatment of fibroblasts with nocodazole, activates Rho (Liu et al., 1996
). The molecular
basis for these events is unknown, but it is likely that they are
controlled by Rho regulators, such as GEFs.
Conclusion
We have both cytologically and genetically characterized the
Rho-GEF Rom2p. The localization of Rom2p to sites of Rho1p activity and
the phenotypic similarities between rho1 and rom2
mutants provide further understanding of the mechanisms by which Rho
proteins are spatially regulated. The function of Rom2p in
mating-projection formation and its localization to projection tips
supports evidence that components required for polarized morphogenesis
are shared between the budding cycle and the mating pheromone-induced
differentiation program in S. cerevisiae (reviewed in Madden
et al., 1992
; Chenevert, 1994
). This conservation of
function may apply to polarized cell growth events in other eukaryotic
systems as well. Finally, we have demonstrated genetic interactions
between a Rho GTPase cycle and elements of the microtubule
cytoskeleton. These and future studies should provide insight into the
ever expanding functions of Rho proteins and their regulators.
| |
ACKNOWLEDGMENTS |
|---|
We thank J. Barrett, N. Burns, and S. Erdman for critical comments on the manuscript, and J. Barrett for strains and constructs. D. Johnston and Y. Takai provided the CDC42 and RHO1 plasmids, respectively. B.D.M. was supported by an NIH training grant. This research was supported by NIH grants GM52197 and GM36494.
| |
FOOTNOTES |
|---|
* Corresponding author: Department of Biology, P.O. Box 208103, Yale University, New Haven, CT 06520-8103.
| |
REFERENCES |
|---|
|
|
|---|
ends encode secreted and intracellular forms of yeast invertase.
Cell
28, 145-154[Medline].
-tubulin.
Science
247, 83-85
-tubulin mutations on microtubule formation and function.
J. Cell Biol.
106, 1997-2010