![]() |
|
|
Vol. 9, Issue 1, 131-141, January 1998

Physiologisch-chemisches Institut der Universität Tübingen, 72076 Tübingen, Germany
Submitted June 16, 1997; Accepted October 6, 1997| |
ABSTRACT |
|---|
|
|
|---|
Cdc48p from Saccharomyces cerevisiae and its highly conserved mammalian homologue VCP (valosin-containing protein) are ATPases with essential functions in cell division and homotypic fusion of endoplasmic reticulum vesicles. Both are mainly attached to the endoplasmic reticulum, but relocalize in a cell cycle-dependent manner: Cdc48p enters the nucleus during late G1; VCP aggregates at the centrosome during mitosis. The nuclear import signal sequence of Cdc48p was localized near the amino terminus and its function demonstrated by mutagenesis. The nuclear import is regulated by a cell cycle-dependent phosphorylation of a tyrosine residue near the carboxy terminus. Two-hybrid studies indicate that the phosphorylation results in a conformational change of the protein, exposing the nuclear import signal sequence previously masked by a stretch of acidic residues.
| |
INTRODUCTION |
|---|
|
|
|---|
The Saccharomyces cerevisiae cell division cycle gene
CDC48 has been characterized by a cold-sensitive mutant
(cdc48-1, Moir et al., 1982
) that arrests at
16°C as large budded cells with long aberrant microtubules spreading
from an unseparated spindle pole body (Fröhlich et
al., 1991
). Cdc48p and its mammalian homologue p97/VCP
(valosin-containing protein) play a central role in homotypic fusion.
Isolated vesicles from yeast endoplasmic reticulum fuse after the
addition of ATP and purified Cdc48p (Latterich et al., 1995
). The fusion of rat Golgi-derived vesicles forming larger vesicles
or cisternae requires, in addition to ATP, the addition of either VCP
alone, or of N-ethylmaleimide-sensitive factor (NSF), soluble N-ethylmaleimide-sensitive factor attachment
proteins (SNAPs), and protein p115 (Acharya et al., 1995
;
Rabouille et al., 1995
). NSF and Cdc48p/VCP belong to the
superfamily of AAA proteins and share a duplicated region of 230 amino
acid residues (AAA box).
After subcellular fractionation, Cdc48p is found exclusively in the
nuclear and microsomal fractions, while the 177,000 × g supernatant is essentially free of Cdc48p. Cdc48p is found
mostly in the soluble fraction only if the cells have been broken by shaking with glass beads. VCP from porcine liver is mainly found in the
microsomal fraction, soluble VCP (177,000 × g
supernatant) is detected only if the tissue has been frozen before cell
fractionation (Fröhlich et al., 1991
). The protein
appears to be predominantly membrane attached in these cells. In
contrast, Xenopus oocytes contain soluble p97, which is
found in the 100,000 × g supernatant of both the
nucleus and of enucleated cells (Peters et al., 1990
).
Egerton et al. (1992)
found a tyrosine phosphorylation of
VCP in cultivated murine T cells after stimulation of the T cell antigen receptor. The tyrosine at position 805 (of 806 residues) contributed to about 90% of the total phosphorylation (Egerton and
Samelson, 1994
). The corresponding position (834 of 835 residues) of
Cdc48p is also a tyrosine residue.
We demonstrate cell cycle-dependent localization of both Cdc48p and human VCP. We identify a nuclear targeting sequence of Cdc48p and demonstrate that Cdc48p is tyrosine phosphorylated in vivo in a cell cycle-dependent manner. We show that nuclear import of Cdc48p is regulated by the phosphorylation and propose a molecular mechanism for the regulation.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Materials
Enzymes and chemicals used for immunofluorescence, Western
blotting, molecular biology, and cell fractionation were obtained from
Boehringer (Mannheim, Germany) or Sigma Chemical (Munich, Germany).
Fluorescein-labeled sheep anti-rabbit IgG (F(ab
)2 fragment) and
anti-mouse IgG, rhodamine-labeled sheep anti-rabbit IgG
(F(ab
)2 fragment) and alkaline phosphatase-labeled sheep anti-rabbit
IgG were from Boehringer; Cy3-labeled goat anti-mouse IgG was from Dianova (Hamburg, Germany); alkaline phosphatase-labeled goat anti-mouse IgG was from Sigma; mouse anti-phosphotyrosine antibodies 4G10 was from Upstate Biochemicals (New York, NY); mab 3-365-10 from
Professor Anderer (Tübingen, Germany; Steinhilber et
al., 1990
), and rabbit anti-valosin antiserum (gift from M.J.
Brownstein, Bethesda, MD; Koller and Brownstein, 1987
) were used.
Phosphotyrosine phosphatase was obtained from Boehringer. Oligonucleotides were from MWG Biotech (Ebersberg, Germany). The Site-Directed Mutagenesis Kit was obtained from Stratagene (Heidelberg, Germany). For the two-hybrid assay the MATCHMAKER Two-Hybrid System from CLONTECH (Palo Alto, CA) was used. Bacto-Tryptone, Bacto-Peptone, and yeast extract were obtained from Difco Laboratories (Detroit, MI).
Strains and Culture Conditions
Temperature-sensitive Saccharomyces cerevisiae
strains used were LH369 (cdc1-1), LH395
(cdc19-1), and LH127 (cdc20-1) (all described by
Hartwell et al., 1973
). KFY161 (MAT a lys2 his4) was used as a wild-type strain. Strain KFY247 MAT a/MAT
cdc48::URA3/ CDC48
his4-619/his4-619
leu2-3,112/leu2-3,112
ura3-52/ura3-52 was used for cloning of
mutagenized cdc48 alleles in vector YEp52. Allele
cdc48::URA3 was constructed by replacing a 1,160 base pair (bp) ClaI fragment containing the promoter region
and 40% of the open reading frame of CDC48 by
URA3. The transformed strains were sporulated on 2%
potassium acetate plates, and the spores were segregated on YEP medium
containing 4% glucose or 4% galactose.
For the two-hybrid assay, S. cerevisiae strain SFY526
(MATa ura3-52 his3-200 ade2-101
lys2-801 trp1-901 leu2-3, 112 canr gal4-542 gal80-538
URA3::GAL1-lacZ, CLONTECH;
Bartel et al., 1993
) was used. Unless stated otherwise,
yeast cells were grown with shaking in liquid YEPD medium at 28°C.
Mutagenesis was performed using Escherichia coli XLmutS and E. coli XL1-Blue from Stratagene (La Jolla, CA).
Yeast expression vector YEp52 (Broach et al., 1983
) was used
for the GAL1 promoter regulated-expression of
cdc48 alleles. Plasmid pcD1 containing the porcine VCP gene
was a gift from M.J. Brownstein (Bethesda, MD).
The human amnion-derived cell line WISH (ATTC CCL 25) was grown as an adherent monolayer in DMEM medium containing 10% (vol/vol) fetal calf serum (Sigma), 2 mM glutamine, and 2000 U/ml each of penicillin and streptomycin.
For immunofluorescence microscopy, WISH cells were inoculated at a
density of 105/cm2 on sterilized siliconized
coverslips and incubated for 24 h at 37°C in an atmosphere of
air containing 10% CO2. Rat hepatocytes were isolated and
cultured as described previously (Gebhardt and Jung, 1982
).
Synchronization of Temperature-Sensitive cdc20 Mutants
An exponentially growing culture of cdc20 mutants was transferred to a 37°C water bath and incubated for 3 h. The cells were then transferred to a 28°C water bath (t = 0) and incubated for various periods. An aliquot was taken every 15 min and processed for detection of phosphotyrosine, for immunofluorescence investigation, or for cell fractionation as described below.
Synchronization of WISH Cells
WISH cells were inoculated at a density of 2.5 × 104/cm2 on sterilized siliconized coverslips and incubated for 30 h at 37°C in an atmosphere of air containing 10% CO2. After addition of 10 mM thymidine in growth medium to a final concentration of 1 mM, cells were further incubated for 12 h. The cell cycle block was released by washing three times with growth medium containing 1 µM deoxycytidine and incubation in the same medium (Madeo, Fröhlich, and Probst, unpublished method). To determine the proportion of mitotic cells indicating the degree of synchrony, cells were fixed with ice- cold ethanol:acetic acid:water (5:3:2) and the chromatin was stained with 0.025% crystal violet in 1% acetic acid for 5 min. While exponentially grown nonsynchronized cultures contained 2-3% mitotic cells, the synchronized cultures contained 25-30% mitotic cells 9 h after release of the thymidine block (Figure 5A). For Western blotting, cells were harvested by incubation with 0.05% trypsin (1-10 min) and boiled with 1% SDS for 15 min.
Cell Fractionation
Aliquots (500 ml) of synchronized cdc20 cultures were
collected at different times after reshifting the temperature to 28°C (see above). For subcellular fractionation, cells were digested with
Zymolyase and the spheroplasts were harvested, washed twice, and
homogenized by 40 strokes in a Dounce homogenizer as described by
Gasser (1983)
. The homogenate was centrifuged at 9,700 × g for 10 min to remove cell debris, nuclei, and
mitochondria. The supernatant was centrifuged at 49,000 × g for 30 min to sediment the microsomal fraction, and the
resulting supernatant was centrifuged at 177,000 × g
for 90 min. The final supernatant was referred to as the cytoplasmic
fraction. The procedure of Ide and Saunders (1981)
was used for the
isolation of yeast nuclei. Cells were digested with Zymolyase, and the
spheroplasts were lysed and fractionated on a preformed Percoll
gradient. Nuclei form a prominent band in the middle of the gradient.
Contamination was calculated as the specific concentration (correlated
to protein) of a marker molecule in relation to its concentration in
the expected fraction. Alcohol dehydrogenase served as the marker for
cytosol, and DNA (determined by microfluorometry, Cesarone et
al., 1979
) served as the marker for nuclei. Cross-contamination of
the microsomal fraction with both markers, and of the nuclear fraction
with alcohol dehydrogenase, was below 2%. Cdc48p was determined by
Western blotting as described previously (Fröhlich et
al., 1991
). Anti-Cdc48p antiserum was diluted 1:1,250, and
alkaline phosphatase- labeled anti-rabbit IgG antiserum was diluted
1:10,000. The Laemmli system (1970) with a 6% acrylamide separation
gel was used for SDS-PAGE.
Cell extracts were obtained after vortexing the harvested cells with an equal volume of glass beads for 1.5 min. An equal volume of Tris-EDTA buffer was added, and the extract was centrifuged for 15 min in an Eppendorf centrifuge. The supernatant was used for Western blotting. For hydrolysis of phosphotyrosine, 50 µl of a cell extract from an exponentially growing wild- type strain and 1 µl (8 mU) of phosphoyrosine phosphatase were shaken for 3 h at 37°C.
Immunological Techniques
For immunofluorescence, yeast cells were treated as described by
Kilmartin and Adams (1984)
with modifications. Cells were fixed for 20 min with 4.4% formaldehyde. After application to polylysine-coated
slides, the samples were air dried instead of being treated with
methanol/acetone.
Coverslips with adherent WISH cells were washed with ice-cold
phosphate-buffered saline (PBS), treated with 4% formaldehyde (vol/vol
in PBS) for 30 min at room temperature (22°C), washed three times
with ice-cold PBS, and permeabilized at
20°C by sequential treatment with 100%, 50%, and 25% methanol (vol/vol in
ddH2O) for 5 min each.
Cdc48p from Saccharomyces cerevisiae and VCP from porcine
liver were purified to homogeneity (checked by SDS-PAGE with silver staining and by Western blotting) as described (Fröhlich et
al., 1995
). The proteins were used to immunize rabbits.
Specificity of the antisera was checked by Western blots of whole cell
protein extracts in which only single bands were recognized. The bands were indistinguishable in molecular weight from the purified antigens used to raise the antibodies. Furthermore, the bands were located at
the same positions as those in Western blots stained with monoclonal anti-valosin antibodies from Koller and Brownstein (1987)
. For immunofluorescence experiments, the antisera were affinity purified with purified Cdc48p or VCP, respectively, according to the protocol of
Pringle et al. (1989)
. Preincubation of the antisera with
purified Cdc48p or VCP eliminates the intracellular signals, proving
their specificity. The corresponding preimmune sera show no staining of
the cells.
For immunofluorescence, rabbit anti-Cdc48p antiserum was diluted 1:32,
rabbit anti-VCP antiserum was diluted 1:35, mouse anti-phosphotyrosine antibodies 4G10 were diluted 1:100, fluorescein-labeled sheep anti-rabbit IgG (F(ab
)2 fragment) was diluted 1:70,
rhodamine-labeled sheep anti-rabbit IgG
(F(ab
)2 fragment) was diluted 1:50, fluorescein-labeled sheep anti-mouse IgG (F(ab
)2 fragment) was diluted 1:100,
and Cy3-labeled goat anti-mouseIgG was diluted 1:600. As a control, the
anti-Cdc48p or anti-VCP antiserum was incubated with a tenfold molar
excess of purified Cdc48p or VCP for 1 h at room temperature, centrifuged for 15 min at 20,000 × g, diluted, and
immediately used for immunofluorescence. DNA was stained by a 5- min
treatment with 1 µg/ml diaminophenylindole in yeast cells and with 1 µg/ml bisbenzimide in mammalian cells.
Western blotting was performed as described previously (Fröhlich
et al., 1991
). For the detection of phosphotyrosine, 5% bovine serum albumin was used for blocking. Anti-Cdc48p antiserum was
diluted 1:1,250; anti-phosphotyrosine antiserum was diluted 1:1,000;
alkaline phosphatase-labeled anti-rabbit IgG and anti-mouse IgG
antibodies were diluted 1:10,000.
Plasmid Construction and Site-directed Mutagenesis
The 3
end of CDC48 up to the internal
SalI site at base 40 was replaced by an oligonucleotide pair
(5
-AGCTTCCATGGGTGAAGAACACAAGCCATTGTTGGACGCTTCTGGTG-3
/3
-TCGACACCAGAAGCGTCCAACAATGGCTTGTGTTCTTCACCCATGGA5
), introducing a NcoI site at the START codon and a
HindIII site directly before the open reading frame without
altering the coded protein. A HindIII site was introduced 5
of the terminator region of CDC48 by site-directed
mutagenesis (oligonucleotide
5
-GAAAAAAGGGAAGCTTTAGGACCTCG-3
). The resulting
HindIII fragment containing the complete CDC48
gene was cloned into HindIII- digested YEp52 (plasmid
YEp52/CDC48). CDC48 was tagged by inserting a double-
stranded oligonucleotide (5
-AGCTTATGTACCCATACGATGTTCCAGATTACGCTAGCTTGGGTGGTCC-3
/3
CATGGGACCACCCAAGCTAGCGTAATCTGGAACATCGTATGGGTACATA-5
) between the HindIII site before and the NcoI-site
at the START codon. The resulting protein contains an insertion of 14 amino acid residues (Flu epitope) after the amino-terminal methionine, increasing its molecular mass by 1,513 Da. The tag has no apparent effect on protein function.
The codon of tyrosine834 of CDC48 was mutagenized to a phenylalanine codon (plasmid YEp52/cdc48Y834F) or a glutamic acid codon (plasmid YEp52/cdc48Y834E), respectively, and the nuclear localization sequence was destroyed (plasmid YEp52/cdc48nonuc) in plasmid YEp52/CDC48. The acidic domain was deleted in plasmid YEp52/cdc48Y834F (plasmid YEp52/cdc48Y834F/noacid). For site-directed mutagenesis, the Chameleon Site Directed Mutagenesis Kit from Stratagene was used. All mutations were confirmed by DNA sequencing (Table 1).
|
Two-Hybrid Assay
A NcoI fragment of CDC48 coding for the 56 amino-terminal amino acid residues of Cdc48p, a HinfI
fragment coding for the 291 amino-terminal residues of Cdc48p, and
HindII/DraI fragments coding for the 153 carboxy-terminal residues of Cdc48p, Cdc48pY834F, and
Cdc48pY834E were isolated, their recessed 3
-ends were
filled in with Klenow enzyme, and the fragments were ligated into
vectors pGAD424 or pGBT9 (CLONTECH) digested with SmaI. An
EcoRI/PvuII fragment of CDC48 coding
for residues 173-578 (central part) was ligated into pGBT9 digested
with EcoRI and SmaI. For the detection of
interaction, combinations of a pGAD424 and a pGBT9-based plasmid were
cotransformed into yeast strain SFY526 (Bartel et al.,
1993
), and transformants were selected on minimal medium (0.67% yeast
nitrogen base, 2% glucose) supplemented with amino acids and bases
lacking leucine and tryptophan. After 4 d of growth, yeast
colonies were transferred onto Whatman No. 1 filters, disrupted by
freezing in liquid nitrogen and thawing, and
-galactosidase activity
was visualized by soaking the filter with a solution of 0.334 mg X-Gal
and 2.7 µl
-mercaptoethanol per ml Z buffer (100 mM sodium
phosphate, pH 7.0, 10 mM KCl, 1 mM MgSO4) and incubation at
30°C.
| |
RESULTS |
|---|
|
|
|---|
Cell Cycle-dependent Localization of Cdc48p in Synchronized Yeast Cells
In exponentially grown S. cerevisiae wild-type cells (strain KFY161), immunofluorescence microscopy with anti-Cdc48p antiserum shows a stained nucleus in approximately 30% of the cells. The other cells have an unstained nucleus and a stain in the rest of the cell that is strongest in the vicinity of the nucleus (Figure 1A).
|
The dependency of the localization of Cdc48p from the stages of the cell division cycle was determined in synchronized cells. We used cdc20 mutant strain LH127 for cell synchronization because we found it to start proliferation fast and reproducibly after a reshift to the permissive temperature and to appear morphologically intact even after several hours at restrictive temperature. After 3 h incubation at 37°C, almost 100% of the cells are arrested with large buds (G2/M arrest) (Figure 1F). When the temperature is reshifted to 28°C (t = 0 min), cells begin to grow synchronously after a delay of 30 min. Up to t = 60 min, Cdc48p appears within the cytosol (Figure 1B). At t = 75 min, shortly before cell budding (G1/S-transition), most of the Cdc48p is concentrated in the nucleus of 90% of the cells (Figure 1C). After cell budding, Cdc48p redistributes and is again dispersed within the cytosol.
This cell cycle-dependent localization was demonstrated also by subcellular fractionation. Synchronized cultures of strain LH127 were harvested at different times (0 min, 15 min, 30 min, 45 min, 60 min, 75 min) after reshift to the permissive temperature (28°C), subcellular fractions were isolated and their Cdc48p content was determined by Western blotting (Figure 1G). The nuclear fraction shows an increase of Cdc48p from cells harvested at 0 min to cells harvested at 30 min followed by a decrease at later times. The microsomal fraction shows a complementary distribution with a decrease of Cdc48p from 0 min to 30 min followed by an increase. It should be noted that the cells are not fixed during the fractionation procedure, which includes an incubation (digest of the cell wall) of 60 min at 30°C, allowing intracellular processes to continue. The samples therefore do not correspond to the immunofluorescence samples harvested at the same time.
The localization of Cdc48p was investigated in cell division cycle
mutants with an arrest point close to the time of Cdc48p relocalization. cdc1-1 and cdc19-1 mutants arrest
as unbudded cells (some cdc1-1 cells terminate with a tiny
bud). In contrast to most cell division cycle mutants, both
cdc1 and cdc19 mutant cells do not enlarge after
the termination of cell cycle development (Hartwell et al.,
1973
). After 3 h at the restrictive temperature (37°C), 85% of
the cdc1 cells show most Cdc48p to be outside the nucleus
(Figure 1D). When the temperature is shifted back to 28°C, Cdc48p
accumulates in the nucleus of 80% of the cells within 2 h (Figure
1E), but the cells do not continue to proliferate.
In 95% of the cdc19 mutant cells arrested at 37°C for 4.5 h, a strong stain of Cdc48p appears in the nucleus (not shown).
Identification of a Nuclear Localization Signal in Cdc48p
Cdc48p contains a sequence near the amino terminus corresponding almost perfectly to a bipartite nuclear localization consensus and with high similarity to the SV40 large T antigen nuclear localization signal (Table 2). To investigate whether this sequence is responsible for the nuclear localization of Cdc48p, three of the five basic amino acid residues of the second part of the motive were changed to nonbasic residues (allele cdc48nonuc). When expressed from a GAL1 promoter in a cdc48::URA3-disrupted segregant, the mutant gene only allows germination if it is overexpressed (galactose medium), while a GAL1-regulated wild-type allele allows germination even under repressing conditions (glucose medium). On glucose media, the mutant strain grows more slowly than the wild type. Immunofluorescence localization with anti-Cdc48p antiserum shows a strong cytoplasmic staining and no detectable nuclear staining in 90% of the cells (Figure 2A).
|
|
Cdc48p Tyrosine834 Mutants
The cell cycle-dependent relocalization of Cdc48p requires a
regulation by a cell cycle-related signal. The inducible tyrosine phosphorylation of VCP at the tyrosine residue near the carboxy terminus observed by Egerton et al. (1992)
and Egerton and
Samelson (1994)
is a potential molecular switch for the relocalization. To investigate the effect of the corresponding residue in Cdc48p, we
mutated the tyrosine residue to a phenylalanine residue
(cdc48Y834F) to simulate the nonphosphorylated
form, and to a glutamic acid residue
(cdc48Y834E) introducing a negative charge to
mimic a phosphorylated tyrosine residue. When expressed from a
GAL1 promoter in a cdc48::URA3 disruptant, both mutant genes restore spore germination and growth, but
while the cdc48Y834E strain grows as fast as a
wild-type strain, both on galactose- and on glucose-containing media,
the cdc48Y834F strain has a doubled generation
period (176 min vs. 90 min) on glucose media. Immunofluorescence
localization shows Cdc48pY834F to exclude the nucleus of
90% of the cells (Figure 2B), while Cdc48pY834E is
strongly concentrated in the nuclei of all cells (Figure 2C). After
subcellular fractionation most of Cdc48pY834E is found in
the nuclear fraction, and most of Cdc48pY834F is found in
the microsome fraction (not shown).
Deletion of the Acidic Domain Near the Tyrosine Phosphorylation Site Restores Nuclear Localization in cdc48Y834F Mutants
The carboxy-terminal part of Cdc48p contains a stretch of acidic residues (residues 828-832) close to the site of tyrosine phosphorylation (E828EDDDLYS*). To determine its role in nuclear localization, it was deleted in the cdc48Y834F construct, resulting in the double-mutated allele cdc48Y834F/noacid. In contrast to the cdc48Y834F single mutant, the double mutant grows like wild type even on glucose medium. The Cdc48Y834F/noacid protein is visible in similar staining intensity in the cytosol and in the nucleus of 95% of the cells (Figure 2D).
Tyrosine Phosphorylation in Cdc48p Is Dependent on the Cell Cycle Phase
Wild-type cells and the Cdc48p tyrosine834 mutants were investigated for tyrosine phosphorylation by Western blotting with specific antibodies (Figure 3A). Only two of the four antibodies tested gave a signal with stimulated Jurcat cells used as a positive control. The two positively tested antibodies were used for the following experiments and always gave similar results. Exponentially grown wild-type cells show a strong phosphotyrosine band with the same electrophoretic mobility as Cdc48p. The band is by far the strongest in the molecular mass range of 50-200 kDa. The band completely vanishes if the cell extract is preincubated with phosphotyrosine phosphatase, excluding an unspecific reaction of the antisera. The signal is barely detectable in stationary cells. No phosphotyrosine signal is detectable in extracts of the cdc48Y834F mutant strain, while the cdc48Y834E mutant shows a weak signal with the anti-phosphotyrosine antibody, approximately 1 order of magnitude less intense than the wild type. When Cdc48p is tagged with the 1.5-kDa Flu epitope, the band is shifted to higher molecular mass (Figure 3B), proving the identity of the phosphotyrosinylated protein.
|
In subcellular fractions of wild-type cells, the nuclear fraction shows the strongest signal with anti-phosphotyrosine antibodies, but a weak signal is also detectable in the microsomal fraction. In subcellular fractions of the cdc48Y834E mutant strain, only the nuclear fraction gives a signal with anti-phosphotyrosine antibodies (not shown).
In synchronized cdc20 cells, a tyrosine-phosphorylated Cdc48p is only detected in cells harvested 60-75 min after release from the cell cycle arrest, corresponding to the phase of nuclear localization of Cdc48p (Figure 3C).
Investigation of Intramolecular Interactions within Cdc48p Using the Two-Hybrid System
To investigate whether the effect of the tyrosine phosphorylation
on nuclear targeting works via a direct interaction of the carboxy-terminal region containing the phosphorylation site with the
nuclear localization sequence close to the amino terminus, the
two-hybrid system was used. Fragments of the CDC48 gene were fused to the DNA-binding and the activating domain of the
GAL4 transcription activator and coexpressed in yeast strain
SFY526, and the induction of a GAL1-regulated
lacZ gene was monitored by
-galactosidase filter assay
(Table 3). No interaction of the
carboxy-terminal fragment of 153 amino acid residues with either the
56- or 291-residue amino-terminal fragment was observed. As a side
effect, we found that the amino-terminal 56 amino acid residues fused
to the DNA-binding domain alone activate the expression of the
indicator gene; this effect is also present, although weaker, when the
amino-terminal 291 aa residues of Cdc48p are fused to the DNA-binding
domain.
|
However, both the amino-terminal and the carboxy-terminal fragment show interaction with the central part of Cdc48p (residues 173-578). The interaction of the carboxy-terminal part depends on amino acid 834: if the tyrosine residue is replaced by a phenylalanine, the interaction is significantly stronger, while no interaction is detectable if the residue has been changed to a glutamic acid.
Localization of VCP and Phosphotyrosine Residues in Human WISH Cells
Intracellular distribution of VCP, the mammalian Cdc48p homologue, was studied in the WISH cell line (human amnion derived, HeLa markers present) by immunofluorescence microscopy. WISH cells grow in adherent monolayers and have not lost contact inhibition; therefore cell division can be observed in a fairly physiological system.
During the interphase, cells are flattened, forming attenuated pseudopodia-like extensions. After bisbenzimide staining, the nucleus is clearly visible as a lentiform disk. A ring of small granules surrounding the nucleus is distinguishable from the cellular background in immunofluorescence with anti-VCP antiserum (Figure 4A).
|
As soon as the cells enter mitosis (detectable by a marked rounding of the cells and condensation of DNA into chromosomes), the distribution of the VCP signal changes rapidly. The intensity of the cytoplasmic staining increases. A bright spot, larger than the cytoplasmic granules, appears on each side of the metaphase plate (Figure 4, B and C). Simultaneous staining against tubulin indicated that these spots correspond to the location of the centrosomes (not shown). VCP remains at the centrosomes during anaphase (Figure 4D) and cytokinesis. The signal begins to fade during telophase, leaving only the circumnuclear granular distribution characteristic of interphase cells. Similar patterns are observable in cultivated rat hepatocytes (not shown).
Affinity-purified and untreated sera gave identical staining patterns. Neither of the VCP patterns described above were observed in control experiments when preimmune sera were used instead of anti-VCP sera (not shown). The complete absence of a centrosomal staining in interphase cells should exclude potential fixation artifacts.
An immunofluorescence investigation of cultivated WISH cells with anti-phosphotyrosine antibodies showed a very similar pattern to that of anti-VCP antisera (Figure 4). In mitotic cells the centrosomal region showed the most intense signal with both antibodies in a comparable intensity. The cytosolic granular staining was relatively weaker with the anti-phosphotyrosine antibody than with the anti-VCP antibody. Some cell-cell contacts stained with anti-phosphotyrosine antibody but not with anti-VCP antiserum (Figure 4C).
WISH cells synchronized by thymidine treatment were investigated for phosphotyrosinylated proteins in a Western blot (Figure 5B). A band with the mobility of VCP is visible in extracts harvested 9-10 h after release of the thymidine block, corresponding to the period of the highest mitotic activity (25-30% cells in mitosis, Figure 5A).
|
| |
DISCUSSION |
|---|
|
|
|---|
Both the CDC48 protein in yeast and its homologue VCP in
mammalian cells are relocalized during the course of the cell cycle. In
both types of cells, the proteins are located at vesicular structures
within the cytoplasm, most probably the ER, during most of the cell
cycle. However, in human WISH cells and rat hepatocytes, VCP is
concentrated at the centrosomes during the entire mitosis, while in
yeast cells Cdc48p accumulates within the nucleus for a short period at
START. The temporary concentration of VCP at the centrosomes, in
addition to the defect in spindle pole body duplication of arrested
cdc48 mutants, suggests a role of VCP/Cdc48p in the
proliferation of the spindle-organizing center. The divergent behavior
of the highly similar proteins may be due to the different localization
of their respective targets. While the centrosomes are freely
accessible in the cytosol of mammalian cells, the yeast spindle pole is
integrated in the nuclear envelope, which remains intact during the
whole cell cycle. We assume that Cdc48p can only reach its target site
at the spindle pole body from within the nucleus. The accumulation of
the protein within the nucleus may eliminate the need for a specific
targeting of Cdc48p to the spindle pole body. A similar behavior has
been described for Dsk2p, which is involved in spindle pole duplication
and is found inside the nucleus, but not attached to the spindle pole
body (Biggins et al., 1996
). The defined moments of
relocalization during the cell cycle are in accordance with the role
for Cdc48p and VCP proposed by us: the centrosome is duplicated during
mitosis, while the spindle pole body is duplicated in late G1.
Our results suggest two cellular functions of both Cdc48p and VCP: an essential role in the cell division cycle, probably at the spindle pole body respectively the centrosome, and a function in the homotypic fusion of the ER. The two functions do not necessarily imply diverse molecular activities. It seems at least as likely that the difference lies primarily in the targets, while the molecular processes may be similar.
The amino-terminal region of Cdc48p contains a functional nuclear targeting consensus sequence as we demonstrated by site-directed mutagenesis. Elimination of the sequence not only prevents nuclear import, but makes a high accumulation of the mutated protein necessary for cell growth. Cell cycle progression apparently requires the presence of Cdc48p in the nucleus. On overexpression of the mutated gene, a small amount of the protein sufficient for its cell cycle function probably enters the nucleus, perhaps due to a marginal nuclear targeting activity of either the few basic residues of the mutated targeting signal or of another stretch of basic amino acid residues (residues 69-74). VCP lacks a nuclear targeting sequence in the corresponding region (see Table 2), presumably because the centrosomes have become directly accessible during evolution, making the nuclear import unnecessary.
The relocation of both VCP and Cdc48p at a specific point in the cell
cycle requires a regulator. A good candidate is the phosphorylation of
a tyrosine residue at the penultimate carboxy-terminal position of VCP,
which is triggered by stimulation of the T cell antigen receptor in
cultivated murine T cells (Egerton et al., 1992
; Egerton and
Samelson, 1994
).
We demonstrate that Cdc48p is tyrosine phosphorylated depending on the cell cycle phase. Phosphorylation occurs during the same period as nuclear localization of Cdc48p (late G1). A mutation of the tyrosine residue of Cdc48p near the carboxy terminus to phenylalanine, mimicking a nonphosphorylated tyrosine residue, abolishes tyrosine phosphorylation. The mutation has similar effects as the exchange of the nuclear targeting sequence: loss of nuclear import and growth defects when the gene is only expressed at low levels. In contrast, a mutation of the tyrosine residue to glutamic acid, which is the best imitation of a phosphotyrosine possible with the proteinogenic amino acids, results in a concentration of the protein in the nucleus. The abnormal morphology of the nucleus in the cdc48Y834E strain may be an effect of a lack of Cdc48p at the endoplasmic reticulum, resulting either in too little homotypic fusion activity, which would otherwise "clean up the odds and ends," or in a defective protein coating of the endoplasmic reticulum membrane lacking the (otherwise rather abundant) Cdc48p. This morphological abnormality seems to have little effect on cell proliferation. The generation time is the same as that of wild-type cells.
In contrast to mammals, S. cerevisiae lacks dedicated
tyrosine kinases but contains several "dual specificity" protein
kinases which in vitro phosphorylate serine, threonine, and tyrosine
residues (Hunter and Plowman, 1997
). In vivo, tyrosine phosphorylation of S. cerevisiae has been shown in few examples, in addition
to the autophosphorylation of some protein kinases (e.g., Spk1p [Stern et al., 1991
] or Mck1p [Lim et al., 1993
])
only for Cdc28p (Booher et al., 1993
), mitogen-activated
protein kinases (Errede et al., 1993
), and immunophilin
(Wilson et al., 1995
). Thus, Cdc48p is the second example of
a physiologically tyrosine phosphorylated S. cerevisiae
protein other than a protein kinase, and, as for Cdc28p and the
mitogen-activated protein kinases, tyrosine phosphorylation is
phylogenetically conserved between yeast and vertebrates.
The regulation of nuclear import by a protein phosphorylation is a well
established phenomenon (see Vandromme et al., 1996
, for
review). However, in most cases described, the phosphorylation site (at
either serine or threonine residues) is in the vicinity of the nuclear
targeting sequence, and the effect of the phosphorylation is a
prevention of nuclear import (Moll et al., 1991
; Sidorova et al., 1995
; Tagawa et al., 1995
). The probable
explanation of this effect is a neutralization or partial shielding of
the positive charges of the nuclear targeting consensus by the negative
charges of the phosphoric acid groups. In the case of Cdc48p, the
phosphorylated site is a tyrosine residue, it is at the other end of
the protein chain, and the effect of the phosphorylation is an
induction of nuclear transport. Assuming a principally similar
mechanism for the inactivation of the nuclear targeting, the stretch of
acidic residues near the phosphorylation site might be able to mask the charge of the nuclear targeting sequence, provided that both elements are adjacent in the folded protein. A deletion of the acidic residues does indeed restore nuclear transport even in Cdc48pY834F.
Nuclear transport of the double mutated protein is incomplete, indicating that the deletion has additional effects besides unmasking the nuclear targeting sequence, e.g., resulting in some misfolded protein accumulating in the cytosol. Two-hybrid experiments do not show
a direct affinity of the parts of Cdc48p containing the nuclear
targeting signal and the carboxy-terminal region, but both regions
interact with the central part of the protein. The interaction of the
carboxy terminus is dependent on residue 834: in the wild-type form, it
shows little interaction with the central part of the protein; in case
of the nonphosphorylatable phenylalanine, the interaction is stronger,
while no interaction is found if residue 834 is a glutamic acid,
mimicking a phosphotyrosine. We suggest that in the nonphosphorylated
form of Cdc48p, attachment of the region of the nuclear targeting
signal and of the carboxy terminus to the core of the protein brings
them close to one another, resulting in a masking of the targeting
sequence by the stretch of acidic residues. Tyrosine phosphorylation
may result in a conformational change releasing the carboxy terminus
and exposing the targeting sequence (Figure
6). While direct data about the
three-dimensional structure of Cdc48p is not available, the idea of a
conformational change induced by the phosphorylation is supported by
the observation that the phenylalanine mutant form shows an additional
band in the protein degradation pattern compared with the wild-type and glutamic acid forms of Cdc48p (not shown), probably due to exposition of an otherwise protected target for proteolysis.
|
Our observation that some tyrosine phosphorylation can be detected in
Cdc48pY834E, but not in Cdc48pY834F, is another
indication of a structural difference between the phosphorylated and
nonphosphorylated form of Cdc48p. Egerton and Samelson (1994)
found
some tyrosine phosphorylation of VCP at residues other than tyrosine
804. At least for Cdc48p, these additional phosphorylation events
apparently only take place if residue 834 carries a negative charge,
indicating an exposition of previously hidden residues due to an
altered conformation.
It could be argued that the attachment of Cdc48p to cytoplasmic membranes might prevent its nuclear import, and that phosphorylation of tyrosine834 or its exchange to a glutamic acid residue might result in a release from the membranes. However, subcellular fractionation of a Cdc48pY834E strain shows that membrane attachment of the protein is not affected. While 80% of Cdc48pY834E is found in the nuclear fraction, only traces are found in the 170,000 × g supernatant while 20% of Cdc48pY834E is attached to the microsomes.
If tyrosine phosphorylation of Cdc48p is assumed to be the signal for
nuclear targeting, the question arises what is the function of the
tyrosine phosphorylation in mammalian VCP. Probably, the signal
performs the corresponding role, directing the protein to the
centrosomes. The colocalization of VCP with the antiphosphotyrosine signal in mitotic WISH cells could be interpreted as an indication, although it does not necessarily mean that both antibodies recognize the same protein. However, while components of both the centrosome (Wickramasinghe and Albertini, 1992
) and the spindle pole body (Donaldson and Kilmartin, 1996
; Friedman et al., 1996
) are
phosphorylated in a cell cycle-dependent manner, no
tyrosine-phosphorylated protein has yet been described in these
organelles.
VCP is the major tyrosine-phosphorylated protein in proliferating cells
(Egerton et al., 1992
). A Western blot of synchronized WISH
cells indicates that the tyrosine-phosphorylated form of VCP is almost
restricted to mitosis, which supports the idea that phosphorylation of
VCP and its centrosomal localization might be linked.
Different anti-phosphotyrosine antibodies seem to recognize only a fraction of tyrosine-phosphorylated proteins, probably due to effects of neighboring residues, which makes them more protein specific. This additional specificity or the high abundance of Cdc48p may also be the reason why we have not detected any other tyrosine-phosphorylated protein in our Western blotting of yeast.
| |
ACKNOWLEDGMENTS |
|---|
We thank Martin Latterich for stimulating discussions. Martin Sauerbeck and Peter Bohley generously provided us with cultivated WISH cells, and Rolf Gebhardt provided cultivated rat hepatocytes. We thank Michael J. Brownstein for sending us the porcine VCP gene and monoclonal antibodies against valosin. We are grateful to Stephan Sigrist for his donation of phosphotyrosine antibodies and for his help in printing the figures, to Wolfgang Hilt for the opportunity to use his micromanipulator, and to John Gatfield and Harold Taylor for critical reading of the manuscript. This work was supported by the Deutsche Forschungsgemeinschaft and the Fonds der Chemischen Industrie.
| |
FOOTNOTES |
|---|
* Current address: Institut für organische Chemie der Universität Würzburg, Am Hubland, 97074 Würzburg, Germany.
Current address: Max-Planck-Institut für
Biochemie, Am Klopferspitz 18a, 82152 Martinsried, Germany.
Corresponding author: Physiologisch-chemisches
Institut der Universität Tübingen, Hoppe-Seyler-Stra
e 4, 72076 Tübingen, Germany.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. Mori-Konya, N. Kato, R. Maeda, K. Yasuda, N. Higashimae, M. Noguchi, M. Koike, Y. Kimura, H. Ohizumi, S. Hori, et al. p97/valosin-containing protein (VCP) is highly modulated by phosphorylation and acetylation. Genes Cells, April 1, 2009; 14(4): 483 - 497. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Beirowski, E. Babetto, J. Gilley, F. Mazzola, L. Conforti, L. Janeckova, G. Magni, R. R. Ribchester, and M. P. Coleman Non-Nuclear WldS Determines Its Neuroprotective Efficacy for Axons and Synapses In Vivo J. Neurosci., January 21, 2009; 29(3): 653 - 668. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Zhao, X. Zhou, L. Wang, G. Li, H. Schindelin, and W. J. Lennarz Studies on peptide:N-glycanase-p97 interaction suggest that p97 phosphorylation modulates endoplasmic reticulum-associated degradation PNAS, May 22, 2007; 104(21): 8785 - 8790. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Klein, M. T. Barati, R. Wu, D. Gozal, L. R. Sachleben Jr., H. Kausar, J. O. Trent, E. Gozal, and M. J. Rane Akt-mediated Valosin-containing Protein 97 Phosphorylation Regulates Its Association with Ubiquitinated Proteins J. Biol. Chem., September 9, 2005; 280(36): 31870 - 31881. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Livingstone, H. Ruan, J. Weiner, K. R. Clauser, P. Strack, S. Jin, A. Williams, H. Greulich, J. Gardner, M. Venere, et al. Valosin-Containing Protein Phosphorylation at Ser784 in Response to DNA Damage Cancer Res., September 1, 2005; 65(17): 7533 - 7540. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Rancour, S. Park, S. D. Knight, and S. Y. Bednarek Plant UBX Domain-containing Protein 1, PUX1, Regulates the Oligomeric Structure and Activity of Arabidopsis CDC48 J. Biol. Chem., December 24, 2004; 279(52): 54264 - 54274. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhong, Y. Shen, P. Ballar, A. Apostolou, R. Agami, and S. Fang AAA ATPase p97/Valosin-containing Protein Interacts with gp78, a Ubiquitin Ligase for Endoplasmic Reticulum-associated Degradation J. Biol. Chem., October 29, 2004; 279(44): 45676 - 45684. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang, G. Izaguirre, S.-Y. Lin, H. Y. Lee, E. Schaefer, and B. Haimovich The Phosphorylation of Vinculin on Tyrosine Residues 100 and 1065, Mediated by Src Kinases, Affects Cell Spreading Mol. Biol. Cell, September 1, 2004; 15(9): 4234 - 4247. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ohlmeier, A. J. Kastaniotis, J. K. Hiltunen, and U. Bergmann The Yeast Mitochondrial Proteome, a Study of Fermentative and Respiratory Growth J. Biol. Chem., February 6, 2004; 279(6): 3956 - 3979. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Wojcik, M. Yano, and G. N. DeMartino RNA interference of valosin-containing protein (VCP/p97) reveals multiple cellular roles linked to ubiquitin/proteasome-dependent proteolysis J. Cell Sci., January 15, 2004; 117(2): 281 - 292. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Partridge, J. O. Lopreiato Jr., M. Latterich, and F. E. Indig DNA Damage Modulates Nucleolar Interaction of the Werner Protein with the AAA ATPase p97/VCP Mol. Biol. Cell, October 1, 2003; 14(10): 4221 - 4229. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Taxis, R. Hitt, S.-H. Park, P. M. Deak, Z. Kostova, and D. H. Wolf Use of Modular Substrates Demonstrates Mechanistic Diversity and Reveals Differences in Chaperone Requirement of ERAD J. Biol. Chem., September 19, 2003; 278(38): 35903 - 35913. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Uchiyama, E. Jokitalo, M. Lindman, M. Jackman, F. Kano, M. Murata, X. Zhang, and H. Kondo The localization and phosphorylation of p47 are important for Golgi disassembly-assembly during the cell cycle J. Cell Biol., June 23, 2003; 161(6): 1067 - 1079. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ficarro, O. Chertihin, V. A. Westbrook, F. White, F. Jayes, P. Kalab, J. A. Marto, J. Shabanowitz, J. C. Herr, D. F. Hunt, et al. Phosphoproteome Analysis of Capacitated Human Sperm. EVIDENCE OF TYROSINE PHOSPHORYLATION OF A KINASE-ANCHORING PROTEIN 3 AND VALOSIN-CONTAINING PROTEIN/p97 DURING CAPACITATION J. Biol. Chem., March 21, 2003; 278(13): 11579 - 11589. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Song, Q. Wang, and C.-C. H. Li ATPase Activity of p97-Valosin-containing Protein (VCP). D2 MEDIATES THE MAJOR ENZYME ACTIVITY, AND D1 CONTRIBUTES TO THE HEAT-INDUCED ACTIVITY J. Biol. Chem., January 31, 2003; 278(6): 3648 - 3655. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Rancour, C. E. Dickey, S. Park, and S. Y. Bednarek Characterization of AtCDC48. Evidence for Multiple Membrane Fusion Mechanisms at the Plane of Cell Division in Plants Plant Physiology, November 1, 2002; 130(3): 1241 - 1253. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-H. Yen, Y.-C. Yang, S. K. Ruscetti, R. A. Kirken, R. M. Dai, and C.-C. H. Li Involvement of the Ubiquitin-Proteasome Pathway in the Degradation of Nontyrosine Kinase-Type Cytokine Receptors of IL-9, IL-2, and Erythropoietin J. Immunol., December 1, 2000; 165(11): 6372 - 6380. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lavoie, E. Chevet, L. Roy, N. K. Tonks, A. Fazel, B. I. Posner, J. Paiement, and J. J. M. Bergeron Tyrosine phosphorylation of p97 regulates transitional endoplasmic reticulum assembly in vitro PNAS, November 16, 2000; (2000) 240278097. [Abstract] [Full Text] |
||||
![]() |
C Wadham, J. Gamble, M. Vadas, and Y Khew-Goodall Translocation of protein tyrosine phosphatase Pez/PTPD2/PTP36 to the nucleus is associated with induction of cell proliferation J. Cell Sci., January 9, 2000; 113(17): 3117 - 3123. [Abstract] [PDF] |
||||
![]() |
A. León and D. McKearin Identification of TER94, an AAA ATPase Protein, as a Bam-dependent Component of the Drosophila Fusome Mol. Biol. Cell, November 1, 1999; 10(11): 3825 - 3834. [Abstract] [Full Text] |
||||
![]() |
S.-H. Zhang, J. Liu, R. Kobayashi, and N. K. Tonks Identification of the Cell Cycle Regulator VCP (p97/CDC48) as a Substrate of the Band 4.1-related Protein-tyrosine Phosphatase PTPH1 J. Biol. Chem., June 18, 1999; 274(25): 17806 - 17812. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. M. Muller, H. H. Meyer, C. Ruhrberg, G. W. Stamp, G. Warren, and D. T. Shima The Mouse p97 (CDC48) Gene. GENOMIC STRUCTURE, DEFINITION OF TRANSCRIPTIONAL REGULATORY SEQUENCES, GENE EXPRESSION, AND CHARACTERIZATION OF A PSEUDOGENE J. Biol. Chem., April 9, 1999; 274(15): 10154 - 10162. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lavoie, E. Chevet, L. Roy, N. K. Tonks, A. Fazel, B. I. Posner, J. Paiement, and J. J. M. Bergeron Tyrosine phosphorylation of p97 regulates transitional endoplasmic reticulum assembly in vitro PNAS, December 5, 2000; 97(25): 13637 - 13642. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||