![]() |
|
|
Vol. 9, Issue 10, 2767-2784, October 1998
Department of Cell Biology and Anatomy, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21205
Submitted March 18, 1998; Accepted July 24, 1998| |
ABSTRACT |
|---|
|
|
|---|
We are studying the intracellular trafficking of the multispanning membrane protein Ste6p, the a-factor transporter in Saccharomyces cerevisiae and a member of the ATP-binding cassette superfamily of proteins. In the present study, we have used Ste6p as model for studying the process of endoplasmic reticulum (ER) quality control, about which relatively little is known in yeast. We have identified three mutant forms of Ste6p that are aberrantly ER retained, as determined by immunofluorescence and subcellular fractionation. By pulse-chase metabolic labeling, we demonstrate that these mutants define two distinct classes. The single member of Class I, Ste6-166p, is highly unstable. We show that its degradation involves the ubiquitin-proteasome system, as indicated by its in vivo stabilization in certain ubiquitin-proteasome mutants or when cells are treated with the proteasome inhibitor drug MG132. The two Class II mutant proteins, Ste6-13p and Ste6-90p, are hyperstable relative to wild-type Ste6p and accumulate in the ER membrane. This represents the first report of a single protein in yeast for which distinct mutant forms can be channeled to different outcomes by the ER quality control system. We propose that these two classes of ER-retained Ste6p mutants may define distinct checkpoint steps in a linear pathway of ER quality control in yeast. In addition, a screen for high-copy suppressors of the mating defect of one of the ER-retained ste6 mutants has identified a proteasome subunit, Hrd2p/p97, previously implicated in the regulated degradation of wild-type hydroxymethylglutaryl-CoA reductase in the ER membrane.
| |
INTRODUCTION |
|---|
|
|
|---|
Eukaryotic membrane and soluble proteins that are destined for
transit through the secretory pathway are subject to a surveillance system known as "ER quality control" that retains aberrant proteins in the endoplasmic reticulum (ER) (Bonifacino and Lippincott-Schwartz, 1991
; Hammond and Helenius, 1995
). ER quality control ensures that only
newly synthesized polypeptides that are correctly folded or assembled
may exit the ER and proceed to their final destination. Misfolded or
unassembled proteins that are ERretained have been shown, in some
cases, to be transiently bound to chaperones and can subsequently be
degraded by an ER-associated degradation (ERAD) mechanism, which
involves the ubiquitin-proteasome system (Brodsky and McCracken, 1997
;
Kopito, 1997
). Examples of misfolded mammalian proteins that are
substrates for ER quality control and ERAD include mutant forms of
CFTR,
1 antitrypsin, and the low-density lipoprotein receptor, which are associated with the diseases cystic fibrosis, emphysema, and familial hypercholesterolemia, respectively (Amara et al., 1992
; Thomas et al., 1995
; Ward et
al., 1995
). The fate of ER-retained proteins varies; not all
retained proteins are rapidly degraded. For instance, a
temperature-sensitive mutant viral protein, VSV G ts045, is retained in
the ER at nonpermissive temperature but is metabolically stable (Doms
et al., 1987
). Upon a shift-down to permissive temperature,
which presumably favors its proper folding, VSV G tsO45 is able to exit
the ER. The factors that determine the precise fate (degradation vs.
stabilization) of an ER-retained protein are not presently known.
An understanding of the cellular components that recognize misfolded
proteins is lacking. Transmembrane proteins are of particular interest
in this regard due to their multicompartmental topology. Mutations that
affect either the cytosolic, transmembrane, or lumenal domains of a
polytopic membrane protein can cause misfolding and thereby recruit the
ER quality control system (Kopito, 1997
). One of the best characterized
examples of a membrane protein whose trafficking is monitored and
impeded by the ER quality control system is the mutant protein,
CFTR
F508. The
F508 mutation, which results in the disease cystic
fibrosis, generates a temperature-sensitive folding defect that leads
to prolonged association of the mutant CFTR with the ER chaperone
calnexin (Pind et al., 1994
). Calnexin may prevent the
premature exit of mutant CFTR from the ER, perhaps by attempting to
fold the protein. It is notable that calnexin, whose functional domain
resides in the ER lumen, can detect the misfolding of CFTR
F508,
since the
F508 mutation alters the nucleotide binding domain (NBD)
of CFTR, a region predicted to be cytosolically oriented. Ultimately,
the ER-retained CFTR
F508 is ubiquitinated and degraded by the 26S
proteasome (Jensen et al., 1995
; Ward et al.,
1995
). Elucidation of the fate of nascent CFTR
F508 has provided a
framework for understanding the steps of quality control in mammalian
cells, namely ER retention, chaperone binding, ubiquitination, and
degradation via the proteasome. For certain proteins an additional step
of "reverse translocation" from the ER to the cytosol may precede
degradation by the proteasome, as recently suggested by studies of the
major histocompatibility complex (MHC) class I protein (Wiertz
et al., 1996
; Hughes et al., 1997
).
A growing body of evidence indicates that an ER quality control
system exists in Saccharomyces cerevisiae. Mutant forms of the soluble proteins pro-
-factor (McCracken and Brodsky, 1996
) and
CPY (CPY*) (Hiller et al., 1996
) and the membrane protein Sec61-2p (Sommer and Jentsch, 1993
) are ER- retained and subsequently degraded in a proteasome-dependent manner. For mutant
-factor and
CPY*, like the mammalian MHC Class I protein, reverse translocation from the ER lumen into the cytosol appears to be a prerequisite for
degradation (Pilon et al., 1997
; Plemper et al.,
1997
). A yeast cell-free system has been developed recently that
recapitulates the phenomenon of ERAD in vitro and can be used to
biochemically identify the cellular components involved in this process
(McCracken and Brodsky, 1996
; Werner et al., 1996
). Both in
vivo and in vitro studies are beginning to reveal new mechanisms
associated with ER quality control and ERAD in yeast.
Because of the tractability of yeast to genetic and biochemical
dissection, we decided to use Ste6p, the a-factor
transporter in yeast, as a model protein for defining the events
involved in the processes of ER quality control and ERAD. Ste6p is a
member of the ATP-binding cassette (ABC) superfamily of transporters (Berkower and Michaelis, 1996
). Examples of eukaryotic ABC proteins include CFTR, the multidrug resistance protein encoded by MDR (P-glycoprotein), the multidrug-resistance-associated protein MRP, the sulfonyl urea receptor SUR, and other transporters
involved in human disease (Taglicht and Michaelis, 1998
). Most ABC
proteins are composed of two homologous halves, each of which contains six transmembrane domains and an NBD. The major portions of Ste6p and
other ABC transporters, in particular their NBDs, are predicted to be
cytosolically disposed (Kuchler et al., 1989
; Geller
et al., 1996
). Studies from this laboratory and others have
shown that Ste6p exhibits a complex intracellular trafficking pattern (Berkower et al., 1994
; Kölling and Hollenberg, 1994
).
After its transit via the secretory pathway to the plasma membrane, Ste6p undergoes rapid and constitutive endocytosis, followed by delivery to the vacuole where it is degraded. Ubiquitination is necessary for the endocytosis of Ste6p (Kölling and Losko, 1997
) and, surprisingly, both the vacuolar proteases and the proteasome influence its degradation in the vacuole (Loayza and Michaelis, 1998
).
The metabolic half-life of Ste6p is ~20 min. Despite its presumed
site of function at the plasma membrane, Ste6p does not accumulate
there due to its constitutive endocytosis (Berkower et al.,
1994
; Kölling and Hollenberg, 1994
).
In the present study, we sought to isolate mutant forms of Ste6p that
are defective in exit from the ER. Such mutants are expected to allow
genetic dissection of the ER quality control pathway in yeast. We
identified two distinct classes of ER-retained ste6 mutants.
The Class I mutant, Ste6-166p, contains a C-terminal truncation and is
ER-retained but rapidly degraded. We provide evidence that the
degradation of this mutant protein involves the ubiquitin-proteasome
machinery, as is the case for the mutant form of CFTR discussed above.
In contrast, Class II mutants, represented by two alleles, Ste6-13p
and Ste6-90p, aberrantly accumulate in the ER but show little
degradation over time. We speculate that the two possible outcomes
represented by these two classes of ste6 mutants define two
distinct steps in a linear pathway of ER quality control in yeast. In
this study, we also report the isolation of the HRD2 gene,
which encodes a subunit of the 19S proteasome cap (Tsurumi et
al., 1996
), as an allele-specific multicopy suppressor of the
mating defect associated with two of the ste6 alleles
described in this study. Hrd2p is also known to play a role in the
regulated degradation of the hydroxymethylglutaryl (HMG)-CoA reductase
in the ER membrane (Hampton et al., 1996
). An
interesting possibility is that the 26S proteasome may be involved in
the decision to retain misfolded or even normal proteins, in addition
to participating in their degradation.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Strains, Media, and Growth Conditions
Yeast strains used in this study are listed in Table
1. The strain SM2729, which
bears the ste6-90 mutation at the chromosomal STE6 locus, was created by the two-step gene replacement
method. First, SnaBI-linearized pSM955 (see below) was
transformed into SM1058, and Ura+ transformants were
selected. Second, segregants that had recombined out the plasmid
were selected on 5-FOA. These were screened first for a mating defect
to identify candidates with the ste6-90 mutation and second
by Western analysis for those with the triply iterated hemagglutinin
epitope (HA) tag integrated in the genome. The gene replacement was
confirmed by Southern blot. The strain SM2782, which contains the
ste6-13 mutation at the STE6 locus, was
constructed using an identical strategy, starting with pSM954
linearized with SnaBI. Plate and liquid dropout media were
prepared as previously described (Michaelis and Herskowitz, 1988
;
Kaiser et al., 1994
). All yeast transformants were obtained
by standard plasmid transformation techniques (Ito et al.,
1983
; Elble, 1992
). Cultures were grown at 30°C except where
indicated.
|
Plasmid Constructions
Plasmids used in this study are listed in Table
2. Vectors were described
by Sikorski and Hieter (1989)
. To detect Ste6p by immunofluorescence,
immunoprecipitation, or immunoblotting, we used
plasmids that expressed the STE6 gene tagged with the hemagglutinin (HA) epitope tag. The STE6 allele
referred to as STE6::HAe (ecto-tagged) contains
the epitope near the 5'-end of the gene, in the first extracellular
loop of Ste6p, between amino acids 68 and 69 (Berkower et
al., 1994
). The STE6 allele referred to as
STE6::HAc (C-terminally tagged) contains the
epitope after the last amino acid of the Ste6p (Paddon et
al., 1996
). The plasmids, pSM1080 and pSM1081, which contain
ecto-tagged ste6-90,166 and ste6-166 (see
below), were constructed as follows. The 3'-end of the STE6
gene was amplified by PCR with two oligonucleotides, oSM161 and either
oSM294 (to create pSM1080) or oSM295 (to create pSM1081). The sequence
of the 5'-oligo oSM161 is 5'-CATTAAAATACGTAGGAATCC- 3' and
contains the wild-type STE6 sequence, including a
SnaBI site unique in the gene. The oligos oSM294 and oSM295
contain the mutations ste6-90,166 and ste6-166,
respectively. Both oligos create a HindIII site immediately
downstream of the stop codon corresponding to the ste6-166
mutation, which allowed subcloning of the PCR fragment into pSM693, a
vector that contains STE6::HAe. The sequence of
oSM294 is: 5'- GACCTCAAAGCTTATTCACTATACATTATAACCATTGTTAGTAGAGCAGG-3', and of oSM295 is 5'-GACCTCAAAGCTTATTCACTATGCGTTATAACC-3'.
|
Plasmid pSM955 was used to generate a strain with the
ste6-90 mutation integrated at the STE6 locus.
It harbors a SpeI-HindIII STE6
fragment containing the 3'-end of the gene with the triple HA tag at
the C terminus and the changes representing the ste6-90 mutation cloned into a YIp URA3 vector (pRS306 [Sikorski
and Hieter, 1989
]). The plasmid pSM1083 was recovered from the
mutagenesis of pSM683 and contains the ste6-166 mutation. A
SalI-HindIII fragment from pSM1083 subcloned
into a 2µ URA3 vector (pSM217) yielded pSM1082. To
ascertain that one mutation conferred the hyperinstability and ER
localization phenotypes associated with ste6-166, a
Bsu36I-NotI fragment was subcloned into a fresh
pSM683 plasmid, sequenced, and found to contain the
ste6-166 mutation reported in RESULTS. The resulting
plasmid pSM1126 expressed a form of Ste6p that exhibited all the mutant
phenotypes associated with the original plasmid obtained from the
mutagenesis. Similarly, the high-copy plasmids pSM1086 and pSM1087,
which contain the ste6-13 and ste6-90
mutations, respectively, were constructed by transferring the
Bsu36I-NotI fragments into a fresh
STE6-containing plasmid pSM672, which contains the HA tag at
the C terminus. The low-copy plasmids pSM1084 and pSM1144, containing
the ste6-90 and ste6-13, respectively, were constructed by subcloning the SalI-NotI inserts
from pSM1086 and pSM1087 into pRS316, a CEN URA3 vector. The
phenotypes resulting from the expression of Ste6p from the
reconstructed plasmids are the same as those of the original mutant
isolates.
Mating Assays
Quantitative mating assays were performed as previously
described (Berkower and Michaelis, 1991
), using the MAT
mating tester SM1068. Qualitative patch-mating tests were performed as
follows: The ste6
strain SM2544 was transformed with
URA3-based plasmids carrying the wild-type or mutant
versions of the STE6 gene. Transformants were patched on a
synthetic complete plate lacking uracil (SC-URA) plate and were
allowed to grow for 2 d. The patches were then replica printed
onto SD plates spread with a lawn of the MAT
tester
SM1068. Diploid formation was monitored after 2 d of growth on the
diploid-selective plates at 30 or 37°C.
Screen to Identify ER-retained ste6 Mutants
The in vitro hydroxylamine mutagenesis of pSM683 (CEN URA3
STE6::HAe) or pSM500 (2µ LEU2
STE6::HAc) was performed as previously described (Kaiser
et al., 1994
). The mutagenized DNA was transformed into
Escherichia coli strain DH5
. A population of transformant colonies was used to make a DNA preparation that was transformed into
the yeast strain SM1563 (ste6-
1::LEU2) or
SM1646 (ste6-
2::URA3). Transformants were
initially screened for their mating capacity by a colony
replica-plating assay. Of ~7500 transformants screened, we found 190 down-mater transformants that displayed various levels of mating
defects. Of these, 32 isolates were screened by pulse-chase labeling
for aberrant metabolic stability, yielding one mutant, ste6-166. From a separately mutagenized plasmid (pSM500),
another set of 35 down-mater mutants was obtained and screened by
immunofluorescence for aberrant localization of Ste6p to the ER,
yielding two mutants, ste6-13 and ste6-90. As
described in RESULTS, ste6-13 and ste6-90 contain changes in two adjacent amino acids. The mutagen hydroxylamine usually generates single-transition mutations. The double mutations may
have arisen due to extended treatment conditions (Sikorski and Boeke,
1991
).
Mapping and Sequence Analysis of ste6-13, ste6-90, and ste6-166
The mating defect, aberrant localization, and aberrant stability associated with the ste6-13, ste6-90, and ste6-166 alleles all mapped downstream of the Bsu36I site in the STE6 gene, which lies at position 3532, 338 nucleotides upstream of the 3'-end of the coding sequence. For all three mutants, a Bsu36I-NotI fragment that contains the last 338 base pairs (bp) of the STE6 coding sequence and the 3'-untranslated region was cloned into a fresh STE6-containing plasmid and shown to confer all three phenotypes. The region between the Bsu36I site and the stop codon of STE6 was sequenced and found to bear the mutations described in RESULTS.
Antibodies
The 12CA5 mouse anti-HA monoclonal antibody was purchased from Babco (Richmond, CA). The rabbit anti-Kar2p antibody was a gift from M. Rose (Princeton University, Princeton, NJ). The 9E10 mouse anti-myc monoclonal antibody was obtained from the monoclonal antibody facility, Johns Hopkins University School of Medicine. Secondary rhodamine- or FITC-conjugated antibodies were purchased from Boehringer Mannheim (Indianapolis, IN), and the HRP-conjugated sheep anti-mouse secondary antibody was purchased from Amersham (Arlington Heights, IL).
Indirect Immunofluorescence
Cells were prepared as previously described (Berkower et
al., 1994
). Cultures were grown overnight to an OD600
of 0.5-1.0, and 5 OD600 units were harvested and
resuspended in 5 ml of KP buffer (0.1 M potassium phosphate, pH 6.5). A
volume of 0.6 ml of a 37% formaldehyde solution (J.T. Baker,
Phillipsburg, NJ) was added dropwise to the cell suspension, and
fixation was allowed to occur for 40 min at 30°C with gentle
agitation. Cells were washed twice in KP buffer and once in KPS buffer
(KP buffer with 1.2 M sorbitol). For spheroplasting, 5 µl of
Zymolyase 20T (5 mg/ml) and 5 µl of
-mercaptoethanol were added to
cells resuspended in 1 ml of KPS buffer. Cells were incubated 20 min at
30°C with gentle rotation. Cells were then harvested gently (2000 rpm
in Beckman TJ-6 clinical centrifuge, 3 min) and washed once in 5 ml of
KPS buffer. Finally, the cells were resuspended in 1 ml of KPS/0.1%
Tween 20 and left at room temperature for 15 min.
For immunodetection, 15 µl of the cell suspensions were applied to polylysine-coated slides and allowed to settle for 15 min. Wells were then washed once with PBST buffer (0.04 M K2HPO4, 0.01 M KH2PO4, 0.15 M NaCl, 10 mg/ml BSA, 0.1% NaN3), and 15 µl of primary antibody diluted in PBST buffer were applied overnight at room temperature. In all immunofluorescence experiments, Ste6p was detected using the 12CA5 (anti-HA) antibody (dilution 1:2000), and Kar2p was detected using polyclonal rabbit anti-Kar2p antibodies (dilution 1:1000). Secondary incubations were performed for at least 2 h at room temperature in the dark, using a rhodamine-conjugated anti-mouse antibody to detect 12CA5 and a FITC-conjugated anti-rabbit antibody to detect Kar2p (both at a dilution of 1:500). All antibody dilutions were made in PBST buffer. Wells were washed four times with PBST buffer between primary and secondary incubations.
Slides were mounted as described by Kaiser et al.
(1994)
and visualized using a Zeiss Axiovert (Carl Zeiss,
Thornwood, NY) with a 100× objective. Images were captured on a 7100 PowerMac using the IP Lab Software (Scanalytics, Inc., Fairfax,
VA), further processed with Adobe Photoshop, and printed on a
dye-sublimation printer (Phaser 440, Tektronix, Wilsonville,
OR).
Sucrose Gradient Fractionation
The fractionation of subcellular organelles was based on
sedimentation through a sucrose step gradient essentially as described by Romano et al. (1998)
. Briefly, midlog cells expressing
wild-type (SM2915) or mutant Ste6p (SM2916 and SM2917) were harvested,
enzymatically converted to spheroplasts, and then osmotically lysed in
buffer B (0.3 M Sorbitol, 10 mM triethanolamine, 1 mM EDTA, pH 7.2, containing 1 µg/ml leupeptin and chymostatin, 2 µg/ml pepstatin and
aprotinin, and 1 mM PMSF). The lysate was homogenized, cleared twice by
centrifugation (500 × g) at 4°C to remove intact
cells and debris, and then loaded on an 11-step sucrose gradient poured
into a thin-walled SW28 ultracentrifuge tube. The gradient was composed
of 3.4 ml layers of sucrose (18-54% [wt/vol] in 4% increments)
layered over a 65% (wt/wt) sucrose pad (1.7 ml) with each step
containing 10 mM HEPES, pH 7.5, and 1 mM MgCl2. The
gradients were centrifuged at 100,000 × g for 2.5 h at 4°C in a SW28 rotor (Beckman, Fullerton, CA). Equivalent
fractions (3.4 ml) were collected from the gradient after puncturing at
the bottom of the ultracentrifuge tube with a 20-gauge needle.
All fractions were assayed for protein concentration and the
distribution of marker enzyme activities as described by Romano et al. (1998)
. The relevant distribution of HA-tagged
wild-type and mutant Ste6p in gradient fractions was determined by
immunoblotting. Briefly, equivalent volumes (20 µl)
of each sucrose gradient fraction were solubilized with 6× sample
buffer (150 mM Tris, pH 6.6, 6% SDS, 30%
-mercaptoethanol, 0.06%
bromophenol blue), separated by SDS-PAGE (12.5%), and transferred at
200 mA onto nitrocellulose (Schleicher & Schuell, Keene, NH) for
15 h at 4°C. Blots were blocked, probed with anti-HA (1:5000),
followed with HRP-conjugated goat anti-mouse secondary antibody
(1:10,000), and immune complexes were detected by exposure to film
after enhanced chemiluminescence detection (Boehringer Mannheim).
Metabolic Labeling and Immunoprecipitation of Ste6p
For metabolic labeling, cultures were grown for two to three doublings from OD600 0.2-0.75, after cells were diluted from a 2-d overnight culture. The cultures took 8-10 h to reach this stage. A total of 12.5 OD600 units were harvested (2.5 OD600 units per time point) and resuspended in 2.5 ml of SD medium supplemented with appropriate amino acids. Cells were incubated with shaking at 30°C for 10 min and pulse labeled for 10 min with 75 µCi of Express 35S (DuPont, Wilmington, DE). The label was chased by addition of 50 µl chase mix (1 M cysteine, 1 M methionine), and samples (0.5 ml) were collected at 0, 15, 30, 60, and 90 min. The reaction was stopped by mixing cells with 0.5 ml stop mix (40 mM cysteine, 40 mM methionine, 20 mM NaN3) in an Eppendorf tube on ice.
Total cell protein extracts for each time point were prepared as
follows: cells were washed once and resuspended in 1 ml cold H20, lysed by adding 150 µl of 2N NaOH/1 M
-mercaptoethanol, vortexed vigorously, and incubated on ice for 15 min. Trichloroacetic acid was added to 5%, and samples were left on
ice an additional 15 min. Tubes were microfuged for 10 min, and protein
pellets were resuspended in 50 µl of trichloroacetic acid sample
buffer (3.5% SDS, 0.5 M DTT, 80 mM Tris, 8 mM EDTA, 15% glycerol, 4 mg bromophenol blue).
Ste6-HAp was immunoprecipitated from total extracts using the 12CA5 (anti-HA) antibody. For immunoprecipitation of Ste6p, 25 µl of extract were brought up to 0.5 ml with dilution buffer (1% Triton X-100, 150 mM NaCl, 5 mM EDTA, 50 mM Tris, pH 7.5) and incubated on ice for 60 min. The lysate was cleared twice to remove insoluble material, and 250 µl of 12CA5 antibody dilution (final 12CA5 dilution was 1:1500) were added to the diluted protein. Incubation was allowed to proceed overnight at 4°C. Immune complexes were then pelleted using Protein A-Sepharose beads (Pharmacia Biotech, Piscataway, NJ). Immunoprecipitates were dissociated from the beads by the addition of 15 µl of 2× Laemmli sample buffer and incubation at 37°C for 20 min. Immunoprecipitates were run on SDS-PAGE and analyzed by PhosphorImager (Molecular Dynamics, Sunnyvale, CA).
For determination of Ste6p half-life, gels were analyzed by PhosphorImager. Counts corresponding to the Ste6p signal were quantified in each lane using the ImageQuant software (Molecular Dynamics), and the 0 min chase time point was used as the 100% reference value for each individual time course experiment. Plotting on semilogarithmic graphs and exponential extrapolations were done using the KaleidaGraph Software (Synergy Software, Reading, PA).
Detection of Ubiquitinated Forms of Ste6p
Unlabeled protein extracts for immunoprecipitation were prepared
using the
-mercaptoethanol/NaOH extraction procedure as described
above, except that 25 OD600 of cells were harvested and
N-ethylmaleimide (Sigma Chemical, St. Louis, MO) was
present at a concentration of 10 mM throughout the preparation. The
anti-HA antibody was used at a dilution of 1:750 in the
immunoprecipitations. Immunoprecipitates were washed as described
above, subjected to 8% SDS-PAGE (5 OD/lane), and transferred to
nitrocellulose. For Western blots, anti-HA and anti-myc antibodies were
used at dilutions of 1:10,000 and 1:3000, respectively, in the presence
of 0.1% Tween 20. Immunoblots were developed using the ECL
detection system (Amersham Life Sciences, Arlington Heights, IL).
Multicopy Suppressor Screen of ste6-90
To identify genes that could suppress the mating defect
associated with ste6-90 at high copy, a 2µ
URA3 genomic library in YEp24 (created by M. Carlson) was
transformed into SM2729, which contains the ste6-90 allele
integrated into the genome. Eighty five hundred primary transformants
(corresponding to 4-5 genomes) were screened by colony mating for
suppression of the ste6-90 mating defect. A total of 22 candidates were rescreened and submitted to plasmid linkage analysis.
Three candidates showed a higher level of mating, and suppression was
shown to be linked to the 2µ plasmid by retransformation.
Two of the three plasmids, pSM1266 and pSM1267, contained an
overlapping genomic region from chromosome VIII, with pSM1267
containing a smaller insert. The third plasmid was not pursued due to
the weakness of the suppression. The identification of the suppressing
activity on the insert carried by pSM1267 was performed as follows: a
TthIIIA deletion of the plasmid, which removes the YHR027C
and PPA1 open reading frames (ORFs), was shown to eliminate
the suppressing activity of pSM1267. The two remaining ORFs were
inactivated by fill-in with SacII (to introduce a frameshift in YHR027C), or AflII (to introduce a frameshift in
PPA1). The SacII-filled in plasmid lost
suppressing activity, mapping the suppression activity to the YHR027C
ORF. This ORF was previously designated HRD2 (for HMG-CoA
reductase degradation) by Hampton et al. (1996)
.
| |
RESULTS |
|---|
|
|
|---|
Three Ste6p Mutant Proteins, Ste6-13p, Ste6-90p, and Ste6-166p, Exhibit Aberrant ER Localization
We sought to identify mutant forms of Ste6p that exhibited a
defect in exit from the ER. To do so, we generated a collection of
ste6 mutants by in vitro plasmid mutagenesis,
transformed these into a ste6
strain, and carried out
a primary screen for mutants with reduced mating activity. Among the
"down-maters," we performed immunofluorescence and pulse-chase
metabolic labeling as secondary screens to identify mutants in which
Ste6p exhibited an altered pattern of localization or metabolic
stability, respectively (see MATERIALS AND METHODS), since both assays
can identify trafficking aberrations of Ste6p. Of 67 mating-defective
mutants, 3 exhibited an ER retention phenotype, as described below.
The mating defect of the mutants varies over a broad range. The
ste6-90 and ste6-166 alleles support only very
low levels of mating (0.4 and 0.05% of wild-type, respectively),
whereas the ste6-13 allele displays an intermediate
phenotype (42% of wild-type) (Figure 1).
By immunofluorescence, all three mutant proteins exhibit a perinuclear
ER-staining pattern, in contrast to the punctate Golgi-staining pattern
of wild-type Ste6p (Figure 2, compare
panels B, C, and D to A) (Berkower et al., 1994
; Loayza and
Michaelis, 1998
). The position of the ER was confirmed by coimmunofluorescence with the well-established ER marker Kar2p (Figure
2, bottom panels). Thus, it appears that all three mutant proteins are
defective for efficient exit from the ER. Their low level of functional
activity, as measured by the mating assay, may result from aberrant
trafficking, abnormal structure, or both. The residual mating activity
conferred by these mutant proteins is likely to result from a low level
of mutant protein exiting the ER.
|
|
To independently confirm the ER localization of the Ste6p mutant
alleles, we carried out subcellular fractionation. Total cell lysates
from cells expressing wild-type or two mutant forms of Ste6p (Ste6-13p
and Ste6-90p) were subjected to sucrose gradient fractionation and
assayed for marker enzymes. As shown in Figure 3, cytosol does not enter the gradient as
indicated by the high concentration of protein at the top of the three
gradients. Several enzymatic activities fractionate with light
membranes in the upper half of the gradient (fractions 1-5). These
include vacuolar (
-D-mannosidase), trans-Golgi network (Kex2p), and Golgi activities (GDPase).
Both the ER marker activity (NADPH cytochrome c reductase)
and plasma membrane marker activity (ATPase) fractionate with heavy
membranes in the lower half of the gradient. The ER marker NADPH
cytochrome c reductase activity peaks in fractions 8, whereas plasma membrane ATPase activity peaks in fraction 9.
|
We determined by immunoblotting that wild-type
Ste6p is localized to the upper half of the gradient, consistent with
our previous report that the steady-state localization of Ste6p is to a
membrane compartment that contains Kex2p (Loayza and Michaelis, 1998
). The distributions of the Ste6-13p and Ste6-90p, however, were distinct from that of wild-type Ste6p. These mutant forms of Ste6p were
localized to the bottom half of their respective gradients, both with
peaks in fraction 8. This fractionation pattern is most similar to that
of NADPH cytochrome c reductase and supports our contention
that Ste6-13p and Ste6-90p are ER-retained. Taken together, the
immunofluorescence and the fractionation pattern of Ste6-13p and
Ste6-90p show a steady-state localization in the ER that could be
viewed either as a strong kinetic delay in exit from the ER or as
active retention. In either case, a small fraction of the mutant
proteins could exit or escape the ER and account for the signal
detected in the lighter portion of the gradient. Due to the rapid
turnover of Ste6p-166 (see below), a similar fractionation analysis was
not performed.
Ste6-13p, Ste6-90p, and Ste6-166p Represent Two Mutant Classes, Based on Their Distinct and Aberrant Metabolic Stability
The relatively short metabolic half-life of wild-type Ste6p (~20
min) is due to its constitutive endocytosis from the plasma membrane,
followed by delivery to and degradation within the vacuole (Berkower
et al., 1994
; Kölling and Hollenberg, 1994
).
Therefore, the failure of Ste6p to reach the vacuole, as would be the
case for an ER-retained Ste6p mutant, should be reflected in a
difference in the kinetics of its degradation. To assess the rate of
degradation of our ER-localized Ste6p mutant proteins, we carried out
pulse-chase analysis (Figure 4). The
mutants clearly fall into two categories. The half-life of Ste6-166p
(lanes 5-8) is significantly shorter than that observed for wild-type
Ste6p (lanes 1-4), 6 min versus 18 min, respectively, which
corresponds to a threefold faster rate of degradation for Ste6-166p.
In contrast, the half-lives of Ste6-13p (lanes 9-12) and Ste6-90p
(lanes 13-16) are 54 min and 43 min, respectively, which are
considerably longer (2.5- to 3-fold) than the 18-min half-life of
wild-type Ste6p. Thus, although the three ER-retained ste6
mutants appear indistinguishable by immunofluorescence, their
half-lives define distinct classes.
|
We have designated the hyperunstable Ste6-166p allele as a "Class I" mutant and the hyperstable alleles, Ste6-13p and Ste6-90p, as "Class II" mutants, based on their distinctive and abnormal metabolic degradation patterns, as compared with wild-type Ste6p. It is notable that the half-lives of the Class II mutants, Ste6-13p and Ste6-90p, are quite similar to one another, yet their mating efficiencies differ by nearly 100-fold (42% and 0.4%, respectively). It is likely that the ste6-90 mutation severely impairs function, in addition to affecting localization of the mutant protein, so that any fraction of mutant protein that does manage to escape the ER would function very poorly as an a-factor transporter.
Sequence of the ste6-13, ste6-90, and ste6-166 Mutations
We mapped the mutations responsible for the Class I and Class II
mutant phenotypes to a 50-residue segment of Ste6p that contains the
Walker B site (Figure 5A) and is located
within or adjacent to the C-terminal NBD of Ste6p (see MATERIALS
AND METHODS for details). This region of Ste6p is predicted to be
cytosolically oriented (Kuchler et al., 1989
; Geller
et al., 1996
). DNA sequence analysis indicates that the
Class I mutant ste6-166 bears a premature termination
mutation (Q1249X). The Ste6-166p protein is therefore 42 amino acids
shorter than wild-type Ste6p, or about 4.6 kDa smaller, a size
difference that is detectable by SDS-PAGE (see Figure 4). The two Class
II mutants, ste6-13 and ste6-90, each contain
an adjacent pair of missense mutations (A1201T, R1202I; and T1245M,
H1246Y, respectively) (Figure 5B). As shown in the alignment in Figure
5B, the residues altered in both mutants lie in a conserved region in
or near the N- and C-terminal NBDs of other ABC proteins (MDR, CFTR,
and Ste6p). The fact that all three mutations fall strikingly close
together, particularly considering the large size of Ste6p (1290 amino
acids), suggests that this particular region of Ste6p may play a
critical role in exit from the ER.
|
The amino acid changes, A1201T and R1202I (the changes corresponding to ste6-13) and T1245M and H1246Y (the changes corresponding to ste6-90), were generated as single-point mutations in STE6. We found that the amino acid change R1202I had a phenotype similar to the ste6-13 mutation, although its defect was not as pronounced. The R1202I mutant protein supported mating to 60%, showed ER localization, and was also hyperstable, with a half-life of 37 min. For ste6-90, both amino acid changes were required for the phenotypes described.
The Degradation of Ste6-166p Does Not Occur in the Vacuole, but Instead Takes Place Before Exit from the ER
The degradation of wild-type Ste6p involves vacuolar proteases
whose activities depend on the master vacuolar protease Pep4p. The
hyperunstable phenotype of Ste6-166p could be due to its faster rate
of arrival in the vacuole, or to the involvement of nonvacuolar proteolytic machinery. To determine whether Ste6-166p is degraded in
the vacuole or elsewhere, we examined its half-life in a
pep4
mutant. Unlike wild-type Ste6p, which is stabilized
in the pep4
mutant (Figure
6, top and middle left panels, lanes
1-4), Ste6-166p undergoes degradation with an identical rate in the
pep4
mutant and the isogenic wild-type
PEP4+ strain (Figure 6, top and middle right
panels, lanes 5-8); this Pep4p-independent degradation suggests that
Ste6-166p does not reach the vacuole.
|
To address whether the rapid degradation of Ste6-166p occurs before
its exit from the ER, we examined the fate of Ste6-166p in the
sec18-1 mutant, which exhibits an ER to Golgi vesicular trafficking defect at 37°C (Novick et al., 1981
).
Wild-type Ste6p is stabilized when the sec18-1 mutant is
shifted to restrictive temperature (Figure 6, bottom left panel), since
it is unable to reach the vacuole under these conditions (Berkower
et al., 1994
; Kölling and Hollenberg, 1994
). In
contrast, the hyperinstability of Ste6-166p is unaffected in the
sec18-1 mutant at restrictive temperature (Figure 6, bottom
right panel). We conclude that the degradation of Ste6-166p does not
require its exit from the ER. Instead, Ste6-166p appears to be
degraded before the ER-to-Golgi transition, possibly in situ in the ER
membrane.
The Degradation of Ste6-166p Requires the Ubiquitin-conjugating Enzymes, Ubc6p and Ubc7p, and the Activity of the Proteasome
Since the vacuolar proteolytic system is not involved in the
degradation of Ste6-166p, a likely alternative is the
ubiquitin-proteasome system. We therefore tested whether mutations in
genes encoding components of ubiquitin-proteasome pathway affected the
degradation rate of Ste6-166p. As shown in Figure
7, Ste6-166p is stabilized significantly
in the ubc6,7
double mutant, which is defective for a
specific pair of ubiquitin-conjugating enzymes that reside in the ER
membrane (Chen et al., 1993
; Sommer and Jentsch, 1993
). The
half-life of Ste6-166p in the ubc6,7
strain is
approximately 10-fold greater than in the wild-type strain (57 min vs.
6.5 min, respectively), (Figure 7, compare lanes 5-8 to 1-4). Thus, a
defect in ubiquitination correlates with a defect in the degradation of
Ste6-166p, implicating the ubiquitin-proteasome system in the rapid
turnover of the mutant protein.
|
To further analyze cellular components that could be required for the
degradation of Ste6-166p, we determined the half-life of Ste6-166p in
the doa4
mutant, in which a deubiquitination enzyme is
altered and the activity of the proteasome is compromised (Papa and
Hochstrasser, 1993
). Ste6-166p is stabilized in this mutant over a
time course of 60 min (Figure 7, lanes 9-12), as strongly as observed
for the ubc6,7
mutant. Our finding suggests that the
degradation of Ste6-166p is dependent upon the proteolytic activity of
the proteasome.
We also examined the degradation rate of Ste6-166p in the
pre1-1 pre2-1 double mutant, which is defective in the
chymotrypsin-like activity of the proteasome (Heinemeyer et
al., 1993
). We observed that Ste6-166p is partially stabilized in
the pre1-1 pre2-1 mutant (Figure
8A), but not to the same extent as in the
ubc6,7
or doa4
mutants. The half-life of
Ste6-166p in the pre1,pre2 mutant is ~15 min,
corresponding to a threefold stabilization of the mutant protein
relative to that seen in the wild-type strain. Significant amounts of
degradation still occur in the pre1-1 pre2-1 mutant, suggesting that some other proteolytic activity of the proteasome may
also participate in the degradation of Ste6-166p. Alternatively, leakiness of the pre1-1 pre2-1 defect could explain the
residual degradation of Ste6-166p.
|
A number of compounds that interfere with the activity of the
proteasome have been described recently (Bogyo et al.,
1997
). One of these, MG132, is a peptide aldehyde known to bind and
inhibit several of the subunits of the 26S proteasome and to reduce its activity in vivo (Lee and Goldberg, 1996
; Wiertz et al.,
1996
). We asked whether MG132 could stabilize Ste6-166p by interfering with proteasome function in vivo. This experiment was performed in an
erg6
mutant, previously shown to have increased
permeability to a variety of exogenous compounds (see Graham et
al., 1993
). As shown in Figure 8B, treatment with MG132 leads to
significant stabilization of Ste6-166p, about fourfold relative to the
mock treatment with DMSO only (although Ste6-166p has a somewhat
longer half-life in the erg6
strain background than in
the other strains used in this study), confirming the notion that the
proteasome is responsible for the degradation of Ste6-166p in the ER.
Ste6-166p Remains in the ER, Even When It Is Not Efficiently Degraded
It is possible that reduced degradation of Ste6-166p would allow
it to exit the ER. To examine this possibility, we determined the
localization of Ste6-166p under conditions in which it is not
efficiently degraded, i.e., in the ubc6,7
and in the
doa4
mutants (Figure 7). The perinuclear
immunofluorescence localization pattern of Ste6-166p in the
ubc6,7
and doa4
mutants is
indistinguishable from that of Kar2p, indicating that Ste6-166p is
still localized to the ER (Figure 9),
even when it is not efficiently degraded. Thus, inhibition of the
degradation of Ste6-166p in the ER does not alleviate its trafficking
defect. Therefore, in the ubc6,7
and doa4
mutants, the Class I mutant protein Ste6-166p acts as a phenocopy of
the Class II mutant proteins, Ste6-13p and Ste6-90p, in that it is
ER-retained and hyperstable.
|
Ste6-166p Is Ubiquitinated
Since the ubiquitin-proteasome degradation pathway appears to be
responsible for the rapid degradation of the Class I mutant, Ste6-166p, we asked whether we could detect ubiquitinated forms of it.
We also examined the Class II mutant, Ste6-13p. We used a strain
harboring a myc-tagged ubiquitin gene expressed from a high-copy
plasmid. Ste6-HAp was immunoprecipitated from total extracts and
subjected to SDS-PAGE. Proteins were transferred to a nitrocellulose
membrane, which was probed by immunoblotting with the
anti-myc (9E10) antibody to detect ubiquitinated species of Ste6-166p.
This assay is described by Hochstrasser et al. (1991)
. We
and others have used this assay to detect ubiquitinated forms of
wild-type Ste6p (Figure 10, lane 1),
for which ubiquitination presumed to occur at the cell surface appears
to be a prerequisite for endocytosis (Kölling and Hollenberg,
1994
; Kölling and Losko, 1997
; Loayza and Michaelis, 1998
).
|
As shown in Figure 10, the Class I and Class II mutants, Ste6-166p and Ste6-13p, respectively, exhibit strikingly different levels of ubiquitination from one another. Ubiquitinated forms of Ste6-166p are present at a higher level than that seen for Ste6-13p (Figure 10A, compare lanes 3 and 2), despite the much lower steady-state protein level of Ste6-166p as compared with wild-type Ste6p or Ste6-13p (Figure 10B, compare lane 3 to lanes 1 and 2). The low steady-state amount of Ste6-166p reflects its hyperinstability. We conclude that the defect displayed by Ste6-166p in the ER results in the ubiquitination of the mutant protein, which in turn leads to rapid degradation by the ubiquitin-proteasome degradation system. This outcome does not result simply from a defect in exiting the ER, since it is not observed with Ste6-13p. It should be noted that ubiquitination of wild-type Ste6p (Figure 10, lane 1) presumably occurs at the cell surface before endocytosis, and thus may occur via a completely different mechanism from that responsible for the ERAD of ER-retained mutant form of Ste6p. Thus, ubiquitination of Ste6p may have different consequences depending on where (ER vs. plasma membrane) and how it occurs.
The Hyperinstability of Ste6-166p Predominates over the Hyperstability of Ste6-90p
Since we identified two classes of ste6 mutants defective for efficient exit from the ER, we wanted to know which class would predominate over the other phenotypically. To address this question, we generated a mutant form of STE6 that contained the changes that correspond to ste6-90 in combination with the ste6-166 mutation (Figure 5B). This double-mutant allele of STE6 is designated ste6-90,166. As shown in Figure 11, Ste6-90,166p shows the same hyperunstable phenotype as Ste6-166p (lanes 9-12 and 13-16). Thus, the hyperunstable phenotype associated with ste6-166 predominates over the hyperstable phenotype seen with ste6-90.
|
HRD2 Is an Allele-specific High-Copy Suppressor of the Mating Defect Associated with ste6-90 and ste6-166
To identify cellular components that may allow ER-retained mutant
forms of Ste6p to exit the ER, we initiated a multicopy suppressor
screen of the mating defect associated with ste6-90. A
2 µ genomic library was transformed into a strain
containing the ste6-90 allele integrated into the genome.
Of 8500 transformants screened, 2 showed a 10-fold increase in mating
that was plasmid-linked. Restriction mapping indicated that these were
independent isolates containing nonidentical, but overlapping, genomic
inserts. Mapping of the region that conferred suppression (described in
MATERIALS AND METHODS) indicated that the ORF YHR027C
encodes the activity that suppresses the mating defect associated with
the ste6-90 mutation (Figure
12A). We also examined a panel of
ste6 loss-of-function mutants for suppression (Figure 12B).
Interestingly, this analysis revealed that in addition to
ste6-90, high-copy number YHR027C could suppress
the mating defect of ste6-166, but not that of the other
trafficking allele, ste6-13, nor of nontrafficking
loss-of-function alleles, including ste6-K398R,
ste6-K1093R, ste6-G509D, or
ste6-G1193D, which alter the NBDs of Ste6p (Berkower and
Michaelis, 1991
) (Figure 12, A and B). Thus, suppression of a
ste6 mating defect by 2 µ YHR027C is not a
general phenomenon, but is seen only for certain ste6
trafficking alleles and, in particular, only for two alleles that map
very close to one another.
|
The ORF YHR027C corresponds to the previously identified
gene HRD2. The predicted sequence for Hrd2p shows high
homology with p97, a mammalian subunit of the 19S cap of the
proteasome, the regulatory complex of the 26S proteasome (Hampton
et al., 1996
; Tsurumi et al., 1996
).
HRD2 was identified based on its being required for the
regulated degradation of the enzyme HMG-CoA reductase in the ER
(Hampton et al., 1996
). The suppression by 2µ
HRD2 of the mating defects of Ste6-90p and Ste6-166p is likely
to occur by an increase in the ER exit of these Ste6p mutant proteins. We did not observe an increased half-life or increased cell surface staining in an end4 mutant for either mutant (our
unpublished results). However, because of the high degree of
sensitivity of the mating test versus the low degree of sensitivity of
immunofluorescence, moderately improved mating may be easier to detect
than moderately improved exit of Ste6p from the ER. While the mechanism
of suppression of the mating defect associated with Ste6-166p and
Ste6-90p remains to be elucidated, the identification of
HRD2 as a suppressor suggests that there may be a connection
between the regulated degradation of a wild-type ER protein (HMG-CoA
reductase) and the folding or degradation of an ER-retained mutant
membrane protein (Ste6p).
| |
DISCUSSION |
|---|
|
|
|---|
Two Classes of Ste6p Mutant Proteins with a Defect in Exit from the ER
The overall goal of this study was to identify mutant forms of Ste6p, the a-factor transporter in S. cerevisiae, that would be substrates for the ER quality control system. We presently know little about the ER quality control system in yeast. In particular, few studies have dealt with how aberrant multispanning membrane proteins are recognized and handled by this system. By screening a collection of loss-of-function ste6 mutants, we isolated three mutants, Ste6-13p, Ste6-90p, and Ste6-166p, that are defective in efficient exit from the ER. Whereas in all three cases the mutant proteins fail to exit the ER, we show that they define two distinct phenotypic classes on the basis of their metabolic half-lives. The Class I mutant, Ste6-166p, is highly unstable and behaves as a prototypical substrate for ERAD. In contrast, the Class II mutants, Ste6-13p and Ste6-90p, do not appear to be substrates for ERAD; they are hyperstable, undergoing little degradation over time. To our knowledge, this represents the first report of a single protein in yeast for which distinct mutant forms can be channeled to different outcomes by the ER quality control system; our study suggests a model for a linear pathway of ER quality control comprised of at least two distinct checkpoints, as discussed below.
Because the degradation of a misfolded multispanning membrane protein
is only poorly characterized in yeast, we analyzed several features of
the metabolic instability of the Class I mutant Ste6-166p. We found
that its degradation displayed many features in common with other ERAD
substrates. In contrast to wild-type Ste6p, the half-life of Ste6-166p
is unaffected in a pep4 or sec18 mutant, indicating that the degradation of Ste6-166p does not occur in the
vacuole, nor does it require vesicular trafficking out of the ER.
Instead, the rapid degradation of Ste6-166p is promoted by the
ubiquitin-proteasome system, since strains defective in an
ER-associated pair of ubiquitin-conjugating enzymes (ubc6, 7), or in the activity of the 26S proteasome (pre1, 2 or doa4), cannot efficiently degrade it. Furthermore,
Ste6-166p is significantly spared from degradation in vivo after
treatment of cells with the proteasome inhibitor MG132. Thus, similar
to previously reported ERAD substrates in yeast, including mutant forms
of soluble proteins (CPY* and pro-
-factor) (Hiller et
al., 1996
; McCracken and Brodsky, 1996
) and a membrane protein
(Sec61-2p) (Biederer et al., 1996
), the degradation of
Ste6-166p is proteasome-dependent. Likewise, in mammalian cells, the
proteasome mediates the ER degradation of wild-type and mutant forms of
the multispanning membrane protein CFTR.
It has been suggested that aberrant proteins are reverse translocated
from the ER lumen or ER membrane into the cytosol before their
degradation, as has been shown for the mammalian single-pass membrane
protein MHC class I heavy chain (Wiertz et al., 1996
; Hughes
et al., 1997
) and for the soluble yeast pro-
-factor
(McCracken and Brodsky, 1996
). However, we have found that Ste6-166p
sediments with the membrane fraction, even under conditions where the
proteasome activity is inhibited (our unpublished results),
suggesting that it is degraded in situ at the cytoplasmic surface of
the ER membrane. It is perhaps not surprising that the cytosolic
proteasome can degrade a mutant form of Ste6p without its removal from
the membrane since most portions of Ste6p, with the exception of short
lumenal loops and the membrane spans per se, are predicted to reside on the cytosolic face of the ER membrane and thus could be directly accessible to the proteasome. We note, however, that we cannot dismiss
the possibility that Ste6-166p does enter the cytosol but forms
cytosolic aggregates, so that its apparent cosedimentation with
membranes upon treatment with proteasome inhibitors is fortuitous.
In contrast to the instability of the Class I mutant, the Class II
mutants, Ste6-13p and Ste6-90p, are hyperstable, exhibiting little
degradation over time. The inefficient exit of Ste6-13p and Ste6-90p
from the ER could involve a mechanism destined to allow more time for
defective proteins to fold correctly or to bind appropriate folding or
chaperone factors, ultimately permitting at least a fraction of the
protein to resume normal trafficking. Such a trafficking defect
resembles that documented in mammalian cells for the
temperature-sensitive mutant VSV G tsO45 protein, when cells are
incubated at the nonpermissive temperature (Doms et al.,
1987
).
It is notable that the Class I allele Ste6-166p is a premature termination codon resulting in the production of a truncated form of Ste6p, whereas the Class II alleles are missense mutants. Nevertheless, the type of mutation does not dictate the class, since other truncated ste6 mutants isolated in this laboratory (Nijbroek and Michaelis, unpublished results) produce metabolically stable products and thus are in Class II. Instead, the fate of mutant forms of Ste6p is presumably determined by subtle differences in folding that direct it to distinct machinery.
A Linear Pathway for ER Quality Control in Yeast
Our finding that Ste6p can be channeled to different outcomes suggests a model for a linear pathway of ER quality control (Figure 13A). We postulate two distinct checkpoints at which folding could be monitored, based on the distinct phenotypes of Class I and Class II mutants. At the first checkpoint, a severely misfolded membrane protein such as Ste6-166p could be assessed as unfoldable and channeled for ubiquitination and rapid degradation. Less severely misfolded proteins (represented by Class II alleles) may pass surveillance at the first checkpoint and be remonitored at a second checkpoint, where there is the option to allow for possible refolding over a longer period of time. Our proposal for the particular order of the two steps in this linear pathway of ER quality control is supported by two observations. First, in situations where Ste6-166p is not efficiently degraded, as is the case in mutants defective in the ubiquitin-proteasome degradation pathway, the usually rapidly degraded protein is stabilized and behaves as a phenocopy of Ste6-13p or Ste6-90p. This suggests that Ste6-166p can eventually be channeled into what seems to be the outcome reserved for Ste6-13p and Ste6-90p, and that ER accumulation occurs downstream of the events leading to proteasomal degradation. Second, the fact that the double mutant, Ste6-90,166p, is phenotypically indistinguishable from Ste6-166p in terms of its rapid degradation suggests that the checkpoint for Ste6-166p precedes the checkpoint that acts on Ste6-13p and Ste6-90p. The different ubiquitination pattern seen for Ste6-166p and Ste6-13p indicates that an early response in the first step of the pathway leads to ubiquitination of the protein, an event that does not appear to occur on mutant proteins that clear the first checkpoint. Thus, we speculate that exit from the first checkpoint, and therefore escape from ubiquitination, could still result in retention of the protein at the second checkpoint, possibly to allow the mutant protein to attempt to bind factors that promote a proper folded conformation or otherwise assist in exit from the ER.
|
An alternative model to explain the phenotypic difference between Class I and Class II mutants is shown in Figure 13B. According to this view, the mutant Ste6p proteins are channeled into separate and parallel fates, reflecting divergent responses by the ER quality control system. Quality control could therefore involve two different sets of machinery, one for rapid degradation and one for stable retention, that would independently recognize different kinds of folding defects. This latter view suggests a branched and not a linear pathway. Ultimately, it will be the identification and characterization of ER quality control components that allow us to distinguish unambiguously between these possibilities.
HRD2, an Allele-specific High-Copy Suppressor of Two ste6 Trafficking Mutants
The phenomenon of ER quality control was discovered a number of
years ago, but the identification of components involved in the
recognition and possible refolding of abnormal proteins has proceeded
slowly. Using the integrated ste6-90 mutation as a starting point, we identified the gene HRD2 as a multicopy suppressor
of the mating defect associated with this mutation (Figure 12). The HRD2 gene was previously identified as required for the
physiological degradation of the enzyme HMG-CoA reductase in the ER,
since in a hrd2 mutant, HMG-CoA reductase fails to undergo
regulated degradation (Hampton et al., 1996
).
HRD2 shows significant homology to human p97, a component of
the 19S proteasome cap (Tsurumi et al., 1996
), thereby
implicating the proteasome in this degradative process.
Interestingly, the multicopy suppression of ste6 mutants by HRD2 is allele specific, in that 2µ HRD2 suppresses the mating defect of ste6-90 and ste6-166, but fails to suppress that of the other trafficking mutant, ste6-13, or of ste6 mutants that are defective in function but not trafficking. The allele-specific suppression exhibited by 2µ HRD2 for ste6-90 and ste6-166, both of which are mutations that cause ER retention and that lie very close on the Ste6p molecule, is suggestive of a direct interaction between Hrd2p and these mutant Ste6p proteins.
The explanation for the mating suppression of ste6-90 and ste6-166 by overexpression of the proteasome subunit Hrd2p is not clear at present. The simplest possibility is that 2µ HRD2 may improve the exit of the mutant Ste6p proteins from the ER. Although we did not detect an alteration in their half-life or localization, this could be due to the fact that a modest alteration in these parameters is challenging to detect, in contrast to improved mating, for which we have a very sensitive test. Alternatively, it is simply improved folding of these proteins that enhances their activity, suggesting a role for Hrd2p as a chaperone. The possibility that the proteasome could be involved in promoting the folding of certain molecules targeted for ERAD suggests a novel role for this cellular structure. Furthermore, the finding that there is an intersection between the process of ER quality control of aberrant proteins and the regulated ER degradation of wild-type HMG-CoA reductase provides a provocative hypothesis for further investigation.
| |
ACKNOWLEDGMENTS |
|---|
We thank C. Machamer for helpful comments on the manuscript; M. Hochstrasser and D. Wolf for strains and plasmids; M. Rose and E. Jones for antibodies and strains; D. Murphy and W. Guggino for generous help with microscopes and computers; and M. Bogyo and H. Ploegh for proteasome inhibitors. We thank members of the Michaelis laboratory for valuable ideas and G. Phan for technical assistance. This work was supported by National Institutes of Health grants GM-51508 and DK-48977 to S.M. and a fellowship (GM-18641) from the National Institutes of Health to W.K.S.
| |
FOOTNOTES |
|---|
* Present address: Department of Cell Biology and Genetics, Rockefeller University, New York, NY 10021.
| |
REFERENCES |
|---|
|
|
|---|
2 repressor.
Cell
74, 357-369[Medline].
2 transcriptional regulator is ubiquitinated in vivo.
Proc. Natl. Acad. Sci. USA
88, 4606-4610
F508.
Mol. Microbiol.
19, 1007-1017[Medline].This article has been cited by other articles:
![]() |
M. B. Metzger and S. Michaelis Analysis of Quality Control Substrates in Distinct Cellular Compartments Reveals a Unique Role for Rpn4p in Tolerating Misfolded Membrane Proteins Mol. Biol. Cell, February 1, 2009; 20(3): 1006 - 1019. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Metzger, M. J. Maurer, B. M. Dancy, and S. Michaelis Degradation of a Cytosolic Protein Requires Endoplasmic Reticulum-associated Degradation Machinery J. Biol. Chem., November 21, 2008; 283(47): 32302 - 32316. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Hrizo, V. Gusarova, D. M. Habiel, J. L. Goeckeler, E. A. Fisher, and J. L. Brodsky The Hsp110 Molecular Chaperone Stabilizes Apolipoprotein B from Endoplasmic Reticulum-associated Degradation (ERAD) J. Biol. Chem., November 9, 2007; 282(45): 32665 - 32675. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ahner, K. Nakatsukasa, H. Zhang, R. A. Frizzell, and J. L. Brodsky Small Heat-Shock Proteins Select {Delta}F508-CFTR for Endoplasmic Reticulum-associated Degradation Mol. Biol. Cell, March 1, 2007; 18(3): 806 - 814. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Mason, K. E. Allen, and C. W. Slayman Effects of C-terminal Truncations on Trafficking of the Yeast Plasma Membrane H+-ATPase J. Biol. Chem., August 18, 2006; 281(33): 23887 - 23898. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Oh, X. Bai, and J. M. Rommens Human Homologs of Ubc6p Ubiquitin-conjugating Enzyme and Phosphorylation of HsUbc6e in Response to Endoplasmic Reticulum Stress J. Biol. Chem., July 28, 2006; 281(30): 21480 - 21490. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Staub and D. Rotin Role of Ubiquitylation in Cellular Membrane Transport Physiol Rev, April 1, 2006; 86(2): 669 - 707. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Subramanian, C. A. Woolford, E. Drill, M. Lu, and E. W. Jones Pbn1p: An essential endoplasmic reticulum membrane protein required for protein processing in the endoplasmic reticulum of budding yeast PNAS, January 24, 2006; 103(4): 939 - 944. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. D. Spear and D. T.W. Ng Single, context-specific glycans can target misfolded glycoproteins for ER-associated degradation J. Cell Biol., April 11, 2005; 169(1): 73 - 82. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Huyer, W. F. Piluek, Z. Fansler, S. G. Kreft, M. Hochstrasser, J. L. Brodsky, and S. Michaelis Distinct Machinery Is Required in Saccharomyces cerevisiae for the Endoplasmic Reticulum-associated Degradation of a Multispanning Membrane Protein and a Soluble Luminal Protein J. Biol. Chem., September 10, 2004; 279(37): 38369 - 38378. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Dasgupta, K. L. Ramsey, J. S. Smith, and D. T. Auble Sir Antagonist 1 (San1) Is a Ubiquitin Ligase J. Biol. Chem., June 25, 2004; 279(26): 26830 - 26838. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Vashist and D. T.W. Ng Misfolded proteins are sorted by a sequential checkpoint mechanism of ER quality control J. Cell Biol., April 12, 2004; 165(1): 41 - 52. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sato, K. Sato, and A. Nakano Endoplasmic Reticulum Quality Control of Unassembled Iron Transporter Depends on Rer1p-mediated Retrieval from the Golgi Mol. Biol. Cell, March 1, 2004; 15(3): 1417 - 1424. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Huyer, G. L. Longsworth, D. L. Mason, M. P. Mallampalli, J. M. McCaffery, R. L. Wright, and S. Michaelis A Striking Quality Control Subcompartment in Saccharomyces cerevisiae: The Endoplasmic Reticulum-associated Compartment Mol. Biol. Cell, February 1, 2004; 15(2): 908 - 921. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Luk, M. Carroll, M. Baker, and V. C. Culotta From The Cover: Manganese activation of superoxide dismutase 2 in Saccharomyces cerevisiae requires MTM1, a member of the mitochondrial carrier family PNAS, September 2, 2003; 100(18): 10353 - 10357. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Fu and E. Sztul Traffic-independent function of the Sar1p/COPII machinery in proteasomal sorting of the cystic fibrosis transmembrane conductance regulator J. Cell Biol., January 21, 2003; 160(2): 157 - 163. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Mason and S. Michaelis Requirement of the N-Terminal Extension for Vacuolar Trafficking and Transport Activity of Yeast Ycf1p, an ATP-binding Cassette Transporter Mol. Biol. Cell, December 1, 2002; 13(12): 4443 - 4455. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Vashist, C. G. Frank, C. A. Jakob, and D. T.W. Ng Two Distinctly Localized P-Type ATPases Collaborate to Maintain Organelle Homeostasis Required for Glycoprotein Processing and Quality Control Mol. Biol. Cell, November 1, 2002; 13(11): 3955 - 3966. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. McBratney and M. Winey Mutant Membrane Protein of the Budding Yeast Spindle Pole Body Is Targeted to the Endoplasmic Reticulum Degradation Pathway Genetics, October 1, 2002; 162(2): 567 - 578. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E-C. Luk and V. C. Culotta Manganese Superoxide Dismutase in Saccharomyces cerevisiae Acquires Its Metal Co-factor through a Pathway Involving the Nramp Metal Transporter, Smf2p J. Biol. Chem., December 7, 2001; 276(50): 47556 - 47562. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Vashist, W. Kim, W. J. Belden, E. D. Spear, C. Barlowe, and D. T.W. Ng Distinct retrieval and retention mechanisms are required for the quality control of endoplasmic reticulum protein folding J. Cell Biol., October 29, 2001; 155(3): 355 - 368. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-y. Zhang, A. Chang, T. B. Kjeldsen, and P. Arvan Intracellular Retention of Newly Synthesized Insulin in Yeast Is Caused by Endoproteolytic Processing in the Golgi Complex J. Cell Biol., June 11, 2001; 153(6): 1187 - 1198. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-i. Nishikawa, S. W. Fewell, Y. Kato, J. L. Brodsky, and T. Endo Molecular Chaperones in the Yeast Endoplasmic Reticulum Maintain the Solubility of Proteins for Retrotranslocation and Degradation J. Cell Biol., May 28, 2001; 153(5): 1061 - 1070. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhang, G. Nijbroek, M. L. Sullivan, A. A. McCracken, S. C. Watkins, S. Michaelis, and J. L. Brodsky Hsp70 Molecular Chaperone Facilitates Endoplasmic Reticulum-associated Protein Degradation of Cystic Fibrosis Transmembrane Conductance Regulator in Yeast Mol. Biol. Cell, May 1, 2001; 12(5): 1303 - 1314. [Abstract] [Full Text] |
||||
![]() |
A. Srivastava, C. A. Woolford, and E. W. Jones Pep3p/Pep5p Complex: A Putative Docking Factor at Multiple Steps of Vesicular Transport to the Vacuole of Saccharomyces cerevisiae Genetics, September 1, 2000; 156(1): 105 - 122. [Abstract] [Full Text] |
||||
![]() |
T. Suzuki, H. Park, N. M. Hollingsworth, R. Sternglanz, and W. J. Lennarz PNG1, a Yeast Gene Encoding a Highly Conserved Peptide:N-Glycanase J. Cell Biol., May 29, 2000; 149(5): 1039 - 1052. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. W. LOO and D. M. CLARKE The human multidrug resistance P-glycoprotein is inactive when its maturation is inhibited: potential for a role in cancer chemotherapy FASEB J, October 1, 1999; 13(13): 1724 - 1732. [Abstract] [Full Text] |
||||
![]() |
D. J. Katzmann, E. A. Epping, and W. S. Moye-Rowley Mutational Disruption of Plasma Membrane Trafficking of Saccharomyces cerevisiae Yor1p, a Homologue of Mammalian Multidrug Resistance Protein Mol. Cell. Biol., April 1, 1999; 19(4): 2998 - 3009. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. E. Petaja-Repo, M. Hogue, A. Laperriere, S. Bhalla, P. Walker, and M. Bouvier Newly Synthesized Human delta Opioid Receptors Retained in the Endoplasmic Reticulum Are Retrotranslocated to the Cytosol, Deglycosylated, Ubiquitinated, and Degraded by the Proteasome J. Biol. Chem., February 2, 2001; 276(6): 4416 - 4423. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Ketchum, W. K. Schmidt, G. V. Rajendrakumar, S. Michaelis, and P. C. Maloney The Yeast a-factor Transporter Ste6p, a Member of the ABC Superfamily, Couples ATP Hydrolysis to Pheromone Export J. Biol. Chem., July 27, 2001; 276(31): 29007 - 29011. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Umebayashi, R. Fukuda, A. Hirata, H. Horiuchi, A. Nakano, A. Ohta, and M. Takagi Activation of the Ras-cAMP Signal Transduction Pathway Inhibits the Proteasome-independent Degradation of Misfolded Protein Aggregates in the Endoplasmic Reticulum Lumen J. Biol. Chem., October 26, 2001; 276(44): 41444 - 41454. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||