![]() |
|
|
Vol. 9, Issue 10, 2949-2961, October 1998
Subunits with Point Mutations That Fail to
Activate Specific Signaling Pathways In Vivo: Dissecting Cellular
Responses Mediated by a Heterotrimeric G Protein in Dictyostelium
discoideum

and
Departments of
*Biological Chemistry and
Biophysics
and Biophysical Chemistry, Johns Hopkins University School of Medicine,
Baltimore, Maryland 21205; and
§LeukoSite, Inc.,
Cambridge, Massachusetts 02142
| |
ABSTRACT |
|---|
|
|
|---|
In Dictyostelium discoideum, a unique G
subunit
is required for a G protein-coupled receptor system that mediates a
variety of cellular responses. Binding of cAMP to cAR1, the receptor
linked to the G protein G2, triggers a cascade of responses, including activation of adenylyl cyclase, gene induction, actin polymerization, and chemotaxis. Null mutations of the cAR1, G
2, and G
genes completely impair all these responses. To dissect specificity in
G
signaling to downstream effectors in living cells, we screened a randomly mutagenized library of G
genes and isolated G
alleles that lacked the capacity to activate some effectors but retained the
ability to regulate others. These mutant G
subunits were able to
link cAR1 to G2, to support gene expression, and to mediate cAMP-induced actin polymerization, and some were able to mediate to
chemotaxis toward cAMP. None was able to activate adenylyl cyclase, and
some did not support chemotaxis. Thus, we separated in vivo functions
of G
by making point mutations on G
. Using the structure of
the heterotrimeric G protein displayed in the computer program CHAIN,
we examined the positions and the molecular interactions of the amino
acids substituted in each of the mutant G
s and analyzed the possible
effects of each replacement. We identified several residues that are
crucial for activation of the adenylyl cyclase. These residues formed
an area that overlaps but is not identical to regions where bovine
Gt
interacts with its regulators, G
and phosducin.
| |
INTRODUCTION |
|---|
|
|
|---|
In eukaryotes, heterotrimeric G proteins coupled to seven
transmembrane domain receptors mediate various cellular responses to
extracellular stimuli, such as light, odorants, chemoattractants, and
many hormones and neurotransmitters. Mammals contain multiple G
subunits, which form a large variety of heterotrimers with different
G
and G
subunits. Extensive biochemical studies in in vitro
systems and overexpression of various inhibitors of G
in
tissue-cultured cells have provided information on roles for G
signaling. G
subunits can activate various effectors, including phospholipases, adenylyl cyclase, and ion channels (Birnbaumer, 1992
;
Clapham and Neer, 1993
, 1997
; Sunahara et al., 1996
; Rhee and Bae, 1997
; Schneider et al., 1997
). Genetic evidence of
in vivo functions of G
signaling has been obtained from studies of G
null mutants. In Sacchromyces cerevisiae, null
mutations of either STE4 (G
) or STE18 (G
) leads to defects in
pheromone response and mating (Whiteway et al., 1989
). In
Caenorhabditis elegans, G
null embryos die at the
blastula stage with abnormally distributed tissues (Zwaal et
al., 1996
). In Drosophila melanogaster, there are two
cloned G
subunits. Mutants defective in an eye-specific G
subunit
(G
e) display severe defects in light response (Dolph et
al., 1994
). In Dictyostelium discoideum, there is a
single G
gene that is essential for the organism's developmental
program. The G
null cells are viable but are unable to develop or
differentiate because of an inability to regulate multiple signal
transduction pathways (Lilly et al., 1993
; Wu et
al., 1995
).
The same heterotrimeric G proteins coupled to one class of receptors
can regulate multiple signal transduction pathways within a single
cell. Signaling involves the sequential formation and dissociation of
complexes between G
and G
subunits and between G proteins and
receptors and effectors. This process is driven by the binding of
ligands (extracellular stimuli) to receptors and by the binding and
hydrolysis of GTP by the G
subunit. Receptors catalyze exchange of
GDP for GTP on G
subunits; activated GTP-bound G
then dissociates
from the receptor and G
, and both GTP-G
and G
regulate
downstream effectors. This active stage is transient and decays because
of the intrinsic GTPase activity of the G
. GDP-bound G
has a high
affinity for G
, and they reassociate to form a heterotrimer that
is available for fresh stimulation by receptors (reviewed by Gilman,
1987
; Birnbaumer, 1992
). An analysis of functions of G
and G
in transducing signals to their effectors in vivo is complex. First,
because G
and G
subunits must cooperate, deletion of either
the G
or G
gene eliminates signaling of a receptor-G protein
system and impairs responses mediated by both G
and G
subunits. Second, signaling through that very same system often
regulates expression of genes that encode effectors and components of
the receptor-G protein system. To circumvent these difficulties and to
dissect the functions of G
in vivo, we used a random mutagenesis
approach in D. discoideum to isolate G
alleles that are
able to form heterotrimers with the G
, to couple to receptors, and
to regulate gene expression but selectively fail to activate one or
more pathways.
D. discoideum is a useful system for studying signal
transduction pathways regulated by heterotrimeric G proteins. G
proteins coupled to seven transmembrane receptors play important
regulatory functions during development. The life cycle of haploid
cells consists of a vegetative growth stage and a developmental stage. Development is separated from growth and begins in the absence of a
food source. Independent amoebae aggregate to form a multicellular mound by chemotaxis to pulsatile cAMP signals and then proceed through
a series of morphological changes that lead to the formation of
fruiting bodies within 24 h (Devreotes, 1994
). There are four cAMP
chemoattractant receptors (cAR1-cAR4), eight G
subunits (G
1-G
8), and a single G
subunit (reviewed by Devreotes, 1994
; Firtel, 1995
). A G
gene has recently been cloned (Zhang and
Devreotes, unpublished result). The unique G
and G
genes are
expressed throughout growth and development, whereas the G
subunits
are transiently expressed at specific stages. Each of G
subunits is
thought to form a heterotrimeric G protein with the G
and G
and
to couple to a specific receptor to regulate various cellular responses
at different developmental stages.
The heterotrimeric G protein G2, containing G
2 and G
, coupled
to the cAMP receptor cAR1, is essential in mediating various cellular
responses to the chemoattractant cAMP during aggregation (reviewed by
Devreotes 1994
; Firtel, 1995
; Parent and Devreotes, 1996
). Activation
of cAR1 results in several responses, including activation of the
adenylyl cyclase (ACA), which produces cAMP signals, induction of gene
expression, and regulation of actin polymerization and chemotaxis (Wu
et al., 1995
; Zigmond et al., 1997
) (reviewed by
Devreotes, 1994
; Firtel, 1995
). Cells lacking G
or G
2 are
defective in all these cAMP-mediated responses in vivo, because no
functional heterotrimeric G2 is formed (reviewed by Firtel, 1995
;
Parent and Devreotes, 1996
). Thus, the precise functions of G
and
G
2 signaling in mediating these responses have been difficult to
determine in vivo. In vitro experiments have shown that GTP
S
stimulates ACA activity in membranes of G
2 null cells but not G
null cells, suggesting that G
rather than G
2 mediates this
activation (Wu et al., 1995
). We reasoned that if ACA is
specifically activated by G
, then G
mutant alleles that are
defective in ACA activation but not other cellular responses during
aggregation should exist. Cells impaired in ACA activation because of
deletion of the genes encoding the enzyme ACA or cytosolic proteins
that are required for ACA activation, such as Aimless (a RasGEF), CRAC,
and Pianissimo, are defective in producing cAMP signals and do not
aggregate. However, unlike G
null cells, they can respond to cAMP
signals generated by wild-type cells in a mixture and can differentiate
into viable spores in chimeric fruiting bodies (Pitt et al.,
1993
; Insall et al., 1994
, 1996
; Chen et al.,
1997
). These mutants are designated as "synag."
In this study, we screened a collection of cells carrying a library of
random mutagenized G
genes to identify those that displayed a
synag phenotype. We isolated five cell lines expressing G
alleles, SN1-SN5. Characterization of SN1-SN5 cells revealed that SN
mutant G
s could form a heterotrimeric G protein with G
2, could
couple to cAR1, and could mediate certain cellular responses, including
gene expression during aggregation and cAMP-induced actin
polymerization. Some of the mutants supported chemotaxis toward cAMP,
in contrast to G
null cells, which are completely defective (Wu
et al., 1995
). In the membranes of SN1-SN5 cells, GTP
S
failed to stimulate ACA activity, indicating that these SN G
mutants are defective in signaling to downstream components that lead
to ACA activation. We determined the mutations on each of these G
alleles. Using the structure displayed in the computer program
CHAIN, we identified mutations that occurred at or affected residuals on the surface of G
. These mutations are likely to cause the observed defects in connecting G
to its downstream effectors. This study not only gives important insight into the specificity of complex G
signaling in a well-defined genetic system but also sheds light onto the general mechanism of control of
G
functions by its regulators.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Growth and Development
Cells of AX3 (wild type) and LW6 (g
) were grown
in HL5 axenic media, which, for transformed cell lines,
contained 20 µg/ml G418 (Sigma, St. Louis, MO). To screen for
developmental phenotypes, transformants were plated with
Klebsiella aerogenes (~40-50 D. discoideum cells per 10-cm bacterial plate) and incubated for 5-7
d until each cell formed a single plaque. For development on
nonnutrient agar, cells were washed in DB (2 mM
MgCl2 and 0.2 mM CaCl2 in 10 mM Na/K phosphate,
pH 6.5) and then incubated on 1.5% agar in DB. For development in
suspension, cells were harvested, washed twice in DB, resuspended in DB
at 2 × 107 cells/ml, shaken at 120 rpm, and pulsed
with 75 nM cAMP at 6-min intervals for 5 h.
Construction of the Library of Mutagenized G
Genes, Plasmid
Recovery, and Sequence Analysis
The G
cDNA was randomly mutagenized by a low-fidelity PCR
procedure. The 5' primer (AGATCTATAAAAAATGTCATCAGATATTTCAG) corresponds to the sequence of a ribosomal binding site and the beginning of the
coding region of the G
gene, flanked by a BglII site; the
3' primer (GCGGCCGCTTAAGCCCAAATCTTGAGGAG) corresponds to the region
around the stop codon of the G
gene, flanked by a NotI site. The G
cDNA was used as the template in the PCR reaction for
mutagenesis in buffer (1 mM dTTP, dGTP, and dCTP, 0.2 mM dATP, 7 mM
MgCl2, and 0.5 mM MnCl2). The PCR products were
digested by BglII and NotI and subcloned into the
BglII-NotI sites of the D. discoideum
extrachromosomal expression vector pMC34 in which the inserted gene was
driven by an actin 15 promoter and an actin 8 terminator. The ligation
mixture was transformed into the Escherichia coli Sure
strain (Stratagene, La Jolla, CA), and plasmids were isolated from
mixture of ~15,000 independent clones. To recover plasmid from
transformants of D. discoideum, total DNA was isolated from
108 cells as described previously (Parent and Devreotes,
1995
) and transformed into the XL1-blue E. coli strain
(Stratagene).
Screening for SN Mutant Cells
The g
cell line LW6 (Wu et al.,
1995
) was transformed with the library of mutagenized G
genes and
selected for 7 d in HL5 containing G418. The mixture of
transformants was screened by two procedures to isolate SN mutants.
1) The mixture of transformants was plated out on SM/Ka plates
for individual plaques, and agg
clones were isolated as
SN mutant candidates and grown in HL5 containing G418. The cells of
these candidates were mixed with wild-type cells (AX3) at a 1:1 ratio
and allowed to develop. Spores were then collected from the fruiting
bodies, resuspended in buffer containing 10 mM NaCl, 10 mM KCl, and 2.5 mM CaCl2, and treated at 45°C for 30 min twice with a
5-min intervening on ice to kill the possible contaminating nonspore
cells. The treated spores were plated out on SM/Ka plates. The
efficiency of synergy with wild-type cells was measured as the
percentage of agg
plaques versus total plaques. SN4 and
SN5 mutants were isolated using this procedure.
2) The mixture of the transformants (~108 cells) was
plated and allowed to develop on nonnutrient DB agar plates. The spores were collected from the fruiting bodies, resuspended, and treated as
described above. The treated spores were then plated on SM/Ka plates,
and the agg
plaques were isolated. The cells from these
plaques were plated on a nonnutrient DB agar, and those that showed
complete agg
phenotypes were collected as SN mutant
candidates. The ability of these candidates to synergize with wild-type
cells was further confirmed. SN1, SN2, and SN3 mutants were isolated
using this procedure.
Immunoblot Analysis
Samples of 2 × 106 cells were solubilized in
sample buffer, analyzed by a 10% regular or low-bis SDS gel, and then
blotted onto membranes (Millipore, Bedford, MA). The membranes were
probed with antibodies to G
and cAR1 as described previously (Wu
et al., 1995
). Bands were visualized using an enhanced
chemiluminescence kit (Amersham, Arlington Heights, IL).
cAMP Binding to cAR1 Receptor and GTP Inhibition Effect of Its Binding
cAMP binding to the membranes in the absence or presence of 0.1 mM GTP was carried out as described (Van Haastert and Kien, 1983
;
Caterina et al., 1994
), except that the membranes were
resuspended at 108 cell equivalents/ml.
Adenylyl Cyclase Assay
Cells were developed in suspension with 50 nM cAMP additions at
6-min intervals for 5 h, lysed in 2× lysis buffer (2 mM
MgSO4 and 20 mM Tris, pH 8.0) in the presence and absence
of 40 µM GTP
S or in the presence of 5 mM MnSO4, and
then rapidly mixed with 10× reaction mix (100 mM Tris, pH 8.0, 1 mM
ATP, and 100 mM dithiothreitol and [
-32P]ATP).
Reactions were stopped at 2 min and assayed for [32P]cAMP
as described (Pupillo et al., 1992
).
Chemotaxis Assays
Chemotaxis to cAMP was examined by two methods. The small
population assay was performed as described previously (Konijn and Van
Haastert 1987
; Insall et al., 1996
). Additionally, a
quantitative assay was carried out by using Biocoat transwell tissue
culture inserts (Collaborative Biomedical Products, Bedford,
MA). The cells were washed with DB buffer and resuspended at
107/ml. The DB buffer containing various concentrations of
cAMP was carefully placed into the wells avoiding any air bubbles. One hundred microliters of cells were then added to the top of the chamber
and were incubated at 22°C. The cells were monitored closely under
the microscope for cell migration to the bottom chamber, and the assay
was stopped when the background well (no stimulus control) began to
have cells migrating nonspecifically. The number of cells migrated to
the lower chamber were counted by fluorescence-activating cell
sorting using forward and side scatters.
Actin Polymerization Assay
Cells were developed in suspension for 6 h and then washed
and resuspended at 2 × 107 cell/ml. After stimulation
by 10 nM cAMP, F-actin levels in the cells were measured at various
time points by methods previously described (Insall et al.,
1996
).
Molecular Interactions of the Amino Acids Substituted in the SN
G
Subunit and Effects of Each Substitution
Using the structure of the heterotrimeric G protein G
t
chimera G
1
1 displayed in the computer program CHAIN (Lambright
et al., 1996
), we examined the positions and the molecular
interactions of each of the amino acids substituted in SN G
subunits
and the possible effects of each substitution. Specific interactions
were considered those <3.6 Å apart and were visually inspected for reasonable stereochemistry.
| |
RESULTS |
|---|
|
|
|---|
Isolation of SN G
Mutations
We devised a screen to sort through the huge number of mutant
alleles of G
genes created by random mutagenesis and to isolate the
alleles with a specific phenotype (synag). When plated on nonnutrient
agar, wild-type cells aggregate and develop into fruiting bodies in
24 h, whereas G
null cells completely fail to aggregate and
remain as individual cells in monolayers. When a mixture of G
null
cells and wild-type cells is allowed to develop together, the spores
from the resulting fruiting bodies are all derived from wild-type cells
(Wu et al., 1995
). In contrast, synag mutant cells, such as
aca
and crac
cells,
cannot aggregate alone but are able to form chimeric structures when
mixed with wild-type cells (Pitt et al., 1993
; Insall
et al., 1994
). To isolate G
alleles that resemble the
phenotype seen in synag mutants, we transformed cells of a G
null
parent strain with a library of randomly mutagenized G
cDNA and
screened for transformants that failed to enter development in
isolation but formed chimeric fruiting bodies when mixed with wild-type cells. We used two procedures to screen for such mutants, designated as
SN. In the first procedure (Figure 1A),
the transformants were plated on bacterial lawns and the
aggregation-minus (agg
) plaques were collected. Each
clone was then tested for its ability to differentiate into viable
spore cells when mixed with wild-type cells, and the mutants that
synergized were isolated as candidates. In the second procedure (Figure
1B), the mixture of the transformants (~108 cells) was
plated on nonnutrient agar and allowed to from chimeric fruiting
bodies. The spores from these fruiting bodies were then plated on
bacterial lawns, and the agg
plaques were isolated as
candidates. Clones derived from both procedures were then retested on
nonnutrient agar, and those that failed to aggregate were collected.
Finally, the ability of each candidate to form chimeric fruiting bodies
with wild-type cells was retested. The results are summarized in Table
1.
|
|
To prove that the SN phenotypes are plasmid dependent, we rescued the
plasmids and retransformed them into fresh g
cells.
The new transformants showed the same characteristics as did the
original mutants. To rule out the possibility that the phenotypes of
the SN mutants were caused by an inadequate expression of the mutant
G
subunits, we carried out immunoblot analysis using
specific G
antiserum (Lilly et al., 1993
). As shown in
Figure 2, the SN1-SN5 cells expressed
G
at the same level as wild-type cells, whereas SN6 cells expressed
G
at a lower level. Therefore, SN1-SN5 but not SN6 were used for
further study.
|
Developmental Phenotypes of SN Mutant Cells after Treatment with Extracellular cAMP
Cells specifically impaired in the ACA pathway, for example
aca
cells, cannot enter development and remain
as monolayers on nonnutrient agar, because they are unable to produce
cAMP waves. However, these cells can respond to cAMP signals: after
repeated treatment with extracellular cAMP, the cells will form
aggregates and multicellular structures (Pitt et al., 1993
).
To determine whether such treatment with extracellular stimuli can
rescue the SN mutants, the cells were starved in suspension, provided
with exogenous cAMP at 6-min intervals for 5 h, and then plated on
nonnutrient agar. As shown in Figure 3,
after treatment with cAMP, each of the SN cell lines formed
multicellular structures, whereas without treatment all remained as a
monolayer. The SN1, SN3, and SN5 cells aggregated, completed
development, and formed abnormal fruiting bodies. The SN2 and SN4 cells
aggregated, formed mounds, and then arrested. As controls,
g
cells remained as a monolayer, whereas wild-type
cells formed fruiting bodies with or without cAMP treatment. These
results suggested that cells carrying SN G
alleles cannot produce
cAMP oscillatory signals but can respond to external cAMP signals; therefore, each of the SN G
subunits can couple to cAR1 and can carry out some functions of the G
subunit.
|
Ability of SN G
Subunits to Mediate Induction of cAR1 and Form
Heterotrimers That Couple to cAR1
The expression levels of several components required for
aggregation increase significantly during early development. Initially, cells accumulate sufficient levels of cAR1, G
2, and ACA to support cAMP oscillations. The repeated cAMP stimuli resulting from the oscillations then further induce levels of several proteins, including cAR1 itself and csA/gp80, a cell adhesion glycoprotein (Firtel, 1995
).
The G
is required for induction of these components by cAMP (Milne
et al., 1995
; Jin et al., 1998
). To examine
whether SN G
subunits can mediate full induction of these genes, we
allowed cells to develop in suspension with repeated cAMP stimuli for 5 h and then carried out an immunoblot using cAR1
antiserum. As shown in Figure 4A, each of
the SN mutant cells expressed cAR1 at a level comparable to that of
wild-type cells, whereas g
cells expressed cAR1 at a
considerably lower level. These results indicate that the SN G
subunits can support cAR1-mediated induction of aggregation stage
genes. cAMP induces phosphorylation of cAR1 in wild-type and G
null
cells. cAMP elicited this response in all SN mutant cells (Figure 4).
|
Agonist binding studies have demonstrated that cAR1 is linked to
the heterotrimeric G protein containing G
2 and G
. Membranes of
wild-type cells exhibit both high- and low-affinity binding sites for
cAMP. As for other G protein-coupled receptors, the high-affinity
binding sites represent cAR1 coupled with a heterotrimeric G protein;
GTP or GDP releases the G protein from the receptor and eliminates
these sites. This process is conveniently assayed at 20 nM
[3H]cAMP, a concentration at which addition of GTP or GDP
causes a significant inhibition of binding (Kesbeke et al.,
1988
). Membranes of g
and g
2
cells
display only low-affinity sites, insensitive to GTP inhibition, indicating that both G
and G
2 are essential for maintaining the
appropriate coupling between cAR1 and the G protein (Wu et al., 1995
). Disruptions of other G
genes do not affect cAMP
binding in this assay (reviewed by Parent and Devreotes, 1996
). To
directly assess the ability of each SN G
subunit to form a
heterotrimeric G protein capable of linking to cAR1, we examined
effects of GTP on cAMP binding in isolated membranes. As shown in
Figure 4B, in membranes prepared from wild-type cells, GTP reduced
binding of [3H]cAMP to cAR1. In contrast, membranes
prepared from g
cells displayed low, GTP-insensitive
binding. Membranes from each of the SN mutant cells exhibited different
cAMP binding affinities in the absence or presence of GTP. The
percentage inhibition of cAMP binding by GTP varied among the SN G
mutants and was 20% in SN1, 53% in SN2, 33% in SN3, 62% in SN4, and
64% in SN5. These data indicate that each of SN G
subunits
participates in formation a heterotrimer that couples to cAR1. The
efficiency of forming a heterotrimer or coupling to cAR1 may be reduced
in SN1 and SN3.
Chemoattractant-stimulated Actin Polymerization and Chemotaxis to cAMP in the SN Mutant Cells
Stimulation of D. discoideum cells with
chemoattractants causes a rapid and transient polymerization of actin
(Devreotes and Zigmond, 1988
; Hall et al., 1988
; Zigmond
et al., 1997
). G
2 or G
4 null cells are specifically
defective in this response to cAMP or folic acid, respectively, whereas
G
null cells are completely unable to trigger actin polymerization
in response to any chemoattractants, suggesting that two different
heterotrimeric G proteins are linked to two classes of receptors and
that G
is essential for each G protein to mediate an actin response
(Zigmond et al., 1997
). To test whether the SN G
subunits
can mediate this response to a chemoattractant, we measured
cAMP-stimulated actin polymerization in SN cells. As shown in Figure
5A, all the SN mutant cells (SN1-SN5) showed a clear transient actin polymerization response, with the peak
in F-actin levels occurring ~8 s after stimulation. The
g
cells did not show any response, and the F-actin
level remained at the resting level after the stimulation. This result
indicates that these SN G
subunits retain the function of regulating
actin polymerization.
|
Wild-type cells exhibit chemotaxis to a variety of attractants, whereas
G
null cells fail completely to move toward any stimulus (Devreotes
and Zigmond, 1988
; Wu et al., 1995
). To investigate the
ability of cells expressing the SN G
alleles to carry out chemotaxis, we allowed the cells to develop to the aggregation stage
and then measured chemotaxis to cAMP by both a small population assay
and a transwell assay (details in MATERIALS AND METHODS). In the small
population assay, SN4 and SN5 moved toward cAMP as well as did the
wild-type cells. SN1-SN3 showed very weak chemotactic responses,
whereas the control g
showed no response. In the more
quantitative transwell chemotaxis assay, wild-type and SN5 cells
displayed a similar sensitivity toward cAMP, and SN4 showed reduced
sensitivity, whereas SN1 and SN2 displayed very weak and not detectable
responses, respectively (Figure 5B).
Activation of the Adenylyl Cyclase in SN G
Cells
The phenotype of the SN cells suggested that they are primarily
defective in establishing cAMP oscillations. One possible reason could
be inefficient activation of G2 by cAR1 in vivo, because some of the SN
G
alleles have reduced affinity in coupling to the receptor. To
assess whether free G
containing an SN G
subunit is able to
activate the adenylyl cyclase, we measured ACA activity in vitro after
stimulation of GTP
S, which directly activates G proteins, bypassing
the need for cAR1 (Soede et al., 1994
). We stimulated cells
with exogenous cAMP for 5 h to allow them to express aggregative
genes and then examined ACA activity in lysates. As shown in Figure
6, GTP
S significantly stimulated ACA
activity in the lysates of wild-type cells but did not stimulate activity in lysates of g
cells. The ratios of
stimulated to basal were about 10 and 1 in wild-type and
g
cells, respectively. In all SN mutant cells, GTP
S
showed no or little stimulation of ACA activity. The ratios of
stimulated to basal activity in the lysates of the SN cells were 0.9 in
SN1, 0.8 in SN2, 1.1 in SN3, 1.1 in SN4, and 2.0 in SN5. In the
presence of Mn2+ ions, which directly stimulate activity,
lysates of wild-type, g
, and SN mutant cells showed
comparable levels of activity, and immunoblot analyses
showed that the SN mutant cells expressed ACA protein at the same level
as wild-type cells (our unpublished results), demonstrating that the
defect in GTP
S-stimulated activity in SN mutant cells is not due to
a low level of ACA. These results indicated that G
dimers
containing each of the SN G
subunits are unable to transduce signals
to downstream effectors that lead to activation of ACA.
|
Determination of Mutations in the SN G
Alleles
Each of the SN G
subunits retains some of functions of
wild-type G
, strongly suggesting that mutations do not disrupt the global structure of the G
dimer. It is likely the mutations cause
local changes, which manifest most significantly in defects in
activation of ACA. We sequenced the SN G
alleles and found that SN1,
SN2, SN3, and SN5 have three mutations and SN4 has four (Figure
7). The G
subunit of D. discoideum is highly homologous to its counterparts in mammals,
D. melanogaster, and C. elegans. The crystal
structures of G proteins demonstrated that different G
dimers
display almost identical structures and that GDP-G
and phosducin,
negative regulators of G
, inhibit signaling of G
by binding
to the "hub" in the propeller structure of G
. The structures
of G

, free G
, and the complex of G
with phosducin
have also revealed that G
does not undergo significant conformational changes whether free or in a complex with other protein
G
(Wall et al., 1995
; Lambright et al.,
1996
; Sondek et al., 1996
; Gaudet et al.,
1996
). Thus, if a mutation causes a defect in interaction with
an effector, it is likely either to be on the surface or to affect
residues on the surface of the G
dimer. To understand how the SN
mutations affect G
functions, we examined the positions and the
molecular interactions of the amino acids that were substituted, using
the three-dimensional structure of the heterotrimeric G protein
(Lambright et al., 1996
) displayed in the computer program
CHAIN.
|
In SN1, the substitutions are V88A, F229S, and D235V (Figure 7, A and
B, 1). The F229S substitution creates a hole in a pocket of the G
dimer, and will probably affect residues on the surface of the G
.
The D235V substitution is at the surface; its corresponding residue
(D228) in bovine Gt
makes direct contacts with both G
and
phosducin (Gaudet et al., 1996
; Lambright et al.,
1996
). The substitution of the negatively charged D235 with a nonpolar
V is very likely to affect positive-negative charge interactions of
G
with other proteins. In contrast, V88 is not on the surface, and A is a conservative substitution. This substitution is not expected
to cause significant structural changes and thus it is not likely to
cause a defect in SN1. We therefore propose that the mutations F229S
and D235V cause the defects in SN1.
In SN2, the substitutions are N147D, H149R, and N237S (Figure 7, A and
B, 2). The side chain of N147 is at the surface of G
, and the
substitution of N147 with a negatively charged D is likely to affect
interactions with other proteins. The N237 residue is also at the
surface, an its corresponding residue (N230) in the bovine Gt
subunit interacts with both G
and phosducin (Gaudet et
al., 1996
; Lambright et al., 1996
). In contrast, the side chain of H149, pointing toward the inside of G
, is not accessible to interact with other proteins. The H149R substitution is
unlikely to cause a defect in SN2. We therefore propose that the
mutations N147D and N237S cause the defects in SN2.
In SN3, the substitutions are A99T, Y271H, and C335 M (Figure 7, A and
B, 3). The substitution of Y271H is likely to affect interactions of
other amino acids and to reduce the stability of a region of the
G
dimer. The side chains of A99 and C335 are in internal pockets.
These two substitutions are not expected to cause significant
structural changes. We therefore propose that the mutation Y271H causes
the defects in SN3.
In SN4, the substitutions are M30V, K85R, S104P, and Q163H (Figure 7, A
and B, 4). S104 is at a surface loop of G
. The S104P mutation
will drastically change the positions of S105 and W106, because values
of
and
for S104 are
116 and
80, respectively, which are
incompatible with a P substitution. The corresponding residues of S105
and W106 in bovine Gt
, S98, and W99 are involved in direct
interactions with both G
and phosducin. Therefore, the S104P
mutation is very likely to affect interactions between G
and
other proteins. Although the residue M30 is close to G
, the M30V
mutation is not expected to cause structural changes and is probably
neutral. K85 is located at the surface of G
, and its
corresponding residue in bovine Gt
(K78) interacts with G
through
a hydrogen bond. However, the substitution of K85 with R, another
positively charged residue, is not likely to affect interaction with
G
. Residue Q163 is conserved among some G
s (Figure 7A) but is
replaced by an H at the corresponding position of G
2 of D. melanogaster and the G
of S. cerevisiae (Sondek et al., 1996
). Thus, the substitution Q163H is likely
neutral. We propose that the mutation S104P causes the defects in SN4.
In SN5, the substitutions are S196G, V199D, and C211R (Figure 7, A and
B, 5). C211 is on the surface of G
, and its corresponding residue
(C204) in bovine Gt
is involved in interactions with phosducin. The
C211R mutation will probably cause a simple rearrangement of side
chains in this region and interfere with interactions with other
proteins. In contrast, S196 is located in the central channel of
G
and is not accessible to interact with associated proteins. The
S196G substitution will not have structural effects. Residue V199 is
also not on the surface of G
and will probably not affect local
structure. Therefore S196G and V199D are unlikely to cause the defect
in SN5. We propose the mutation C211R causes the defects in SN5.
The mutations on the surface of the G
are predicated to probably
cause the defects in SN G
alleles. The positions of these mutations
(black dots) and residues of bovine Gt
that interact with G
(red
dots) or phosducin (blue dots) are superimposed in a ribbon
representation of a G
(Figure 7B, 6). It is apparent that the
relevant SN mutations are on the same face of the G
dimer that
interacts with both G
and phosducin. These mutations occurred at the
residues that are involved in interaction with both G
and phosducin
(D235, N237, S105, and W106, which were affected by the S104P
substitution), only with phosducin (C211), or with neither of them
(F229, Y271, and N147).
| |
DISCUSSION |
|---|
|
|
|---|
The G
subunit is essential for many steps in the mechanism of
signaling by a G protein-coupled receptor system, including formation
of functional heterotrimeric G proteins linked to receptors and
transduction of signals to downstream effectors. In D. discoideum, the same G
subunits can form various G proteins
with different G
subunits in a single cell. Deletion of the G
gene results in the absence of functional G proteins linked to
receptors. Therefore, the phenotypes displayed by the null mutant may
be caused by impairment of cellular responses normally regulated by
either G
or G
subunits. Furthermore, expression of genes
encoding effectors and other components required for signaling are also
affected in this mutant. To dissect the complex functions of G
and
to study the specificity of G
signaling in vivo, we randomly
mutagenized the G
gene and isolated mutations on the G
subunit
that impaired specific responses. We designed a screening procedure to
identify a class of G
alleles whose phenotypes are similar to those
displayed by synag mutant cells, which are specifically impaired in G
protein-mediated activation of ACA, the pathway required for
cell-cell cAMP signaling. Clonal populations of cells carrying these
G
alleles (SN1-SN5) cannot enter development in isolation. However,
unlike G
null cells, these mutants can complete development by
forming chimeric fruiting bodies when mixed with wild-type cells or can
form multicellular structures after treatment with exogenous cAMP that
mimics oscillatory cAMP signals. The developmental phenotypes indicate
that these G
alleles can form functional G proteins coupled to cAR1,
respond to extracellular cAMP, and mediate some cellular responses. We used biochemical approaches to further assess the functions of SN G
alleles in signaling mediated by cAR1. The results are summarized in
Table 2. Figure
8 shows a model of the cAR1-G2 signaling
events that mediate cellular responses.
|
|
Our results indicate that SN G
subunits can form heterotrimeric G
proteins with G
2 and couple to cAR1. Stable expression of a G
subunit has been shown to require G
to form a G
dimer (Schmidt
and Neer, 1991
). Previous studies have demonstrated that the protein
level of the D. discoideum G
does not change even when
its mRNA is overexpressed >10 fold, presumably because excess G
proteins that do not form dimers with G
subunits are unstable (Lilly
et al., 1993
). We demonstrated that each G
subunit
(SN1-SN5 alleles) was expressed at same level as a wild-type G
,
suggesting that each SN G
subunit can associate with a G
to form
a stable G
dimer. This result is consistent with results from
sequencing of the SN G
alleles, which revealed that no mutations
occurred at the residues that have been implicated in interaction with a G
(Sondek et al., 1996
). Our results from GTP
inhibition of cAMP binding to membranes suggested that G
dimers
containing SN2, SN4, and SN5 have comparable affinities in forming G
protein with G
2 and coupling to cAR1, whereas those containing SN1
and SN3 have somewhat reduced affinities.
Two cellular responses that require the functional G protein G2,
cAMP-induced gene expression and actin polymerization, are normal in SN
cells. We demonstrated that SN cells can reach the aggregation stage of
development, can form multicellular structures, and can regulate gene
expression after repeated cAMP treatment, in contrast to G
null
cells, which cannot respond to cAMP. Furthermore, we observed a clear
actin polymerization response in all SN cells, indicating that the SN
G
subunits are fully functional to regulate this pathway in response
to cAMP. The precise target protein that links the heterotrimeric G
protein to the actin polymerization response has not yet been
identified in D. discoideum or other eukaryotic cells. In
vitro studies suggest that activation of a small G protein is involved
in the pathway that leads to actin polymerization (Zigmond et
al., 1997
). A recent study in S. cerevisiae indicated
that the association of the G
and Cdc24, a GDP-GTP exchange
factor (GEF) for a small G protein Cdc42, is an essential step in
mediating actin response (Nern and Arkowitz; 1998
). It is possible that
free G
subunits generated from activation of G2 by cAR1 interact
with a GEF for a small G protein that triggers this actin response.
SN cells displayed differential chemotactic abilities; SN1 and SN2
could hardly carry out chemotaxis, whereas SN4 and SN5 displayed
chemotaxis. Because mutations on the G
subunit that do not impair
interaction with G
2 cause impairment of this response, G
may
directly signal to downstream effectors that lead to chemotaxis. Different chemotactic behaviors have been reported in mutants lacking
downstream components that are required for ACA activation. The null
mutations in CRAC, Pianissimo, and Aimless (a RasGEF) display weak
chemotaxis to cAMP (Insall et al., 1994
, 1996
; Chen et
al., 1997
). Nonchemotactic mutants KI8 and KI10 isolated from chemical mutagenesis are defective in cAMP-stimulated activation of
guanylyl cyclase but not the activation of adenylyl cyclase (Kuwayama
et al., 1993
); G
null cells are nonchemotactic and defective in the activation of both enzymes (Wu et al.,
1995
). These observations suggest that G
regulates multiple
pathways leading to chemotaxis.
SN cells are all defective in ACA activation. Both the developmental
phenotypes and the failure of GTP
S to activate ACA activity in
lysates demonstrated this defect. Because the SN G
subunits could
form G proteins that were linked to cAR1 and could participate in
signaling events that regulate other responses, the most likely explanation is an impairment in the linkage of free SN G
dimer to
the downstream effectors that lead to ACA activation. The pathway linking receptor-G protein to the activation of ACA involves several components, including four cytosolic proteins, CRAC, Pianissimo, Aimless (RasGEF), and ERK2 (MAP kinase) (Insall et al.,
1994
, 1996
; Segall et al., 1995
; Chen et al.,
1997
). It is not yet clear how these components act in a process that
leads to ACA activation. Our study indicated that G
directly
sends signals to mediate this process. The differences in chemotaxis in
the SN cells and cells lacking each of the cytosolic proteins suggest a
possible model in which G
links to at least two pathways. Each
pathway is essential but not sufficient for activation of ACA. Further studies to identify proteins that interact with G
should help us
understand this process.
We have identified G
alleles that are defective in mediating
specific cellular responses in vivo. It is conceivable that SN G
s
are just weak alleles, and these mutations generally reduce all
functions of G
rather than directly affect the linkage between G
and specific effectors, and that certain responses merely display differential sensitivities to nonspecific defects of G
subunits. We consider this possibility unlikely for the following reasons. First, our assay of ACA activation directly examined the
linkage between G
and downstream effectors by activating G
proteins with GTP
S. This activity did not require the coupling of G2
to receptors. Second, there was no change in the threshold for
triggering actin polymerization: 2 nM cAMP, the minimal concentration required for maximal actin responses in wild-type cells, could also
trigger this response in each of the SN cells. Third, the study of
inhibition of cAMP binding by GTP showed that each of the SN G
subunits did form functional heterotrimers linked to cAR1, and SN2,
SN4, and SN5 G
subunits displayed the efficiency of wild-type G
.
Fourth, cAR1-regulated gene expression was normal in the SN cells.
Two molecular genetic approaches can be used to identify the residues
on G
that are crucial for interaction between G
and effectors:
site-directed mutagenesis to target certain residues and random
mutagenesis and phenotypic screening to localize these residues. In
this study, we screened a library of >15,000 randomly mutagenized G
genes using a developmental phenotype as a readout. The mutations in
five SN G
alleles provide a rough map on G
. Our analysis of these
SN G
alleles, using the crystal structure of bovine G proteins,
allowed us to propose the residues that are important for signaling to
downstream effectors. Interestingly, these mutations all mapped on the
G
binding face, or the hub of the propeller, and included residues
that are involved in interactions with G
and phosducin as well as
residues that are not likely to contact these regulators. No mutations
were found on the other surfaces of G
, such as the blades and the
back of the propeller. This study indicates that the G
binding face
of the G
dimer directly participates in the interaction between
the G
and effectors leading to ACA activation. Two studies using
site-directed mutagenesis to examine the mammalian G
residues that
contact GDP-G
have recently been reported (Ford et al.,
1998
; Li et al., 1998
). They found that a single mutation on
these residues differentially affects G
signaling to its
effectors. Although mutation of N237 (in G
of D. discoideum) has not been carried out in mammalian G
subunits,
the other two identified mutations, D235V and S104P (which affects S105
and W106) in D. discoideum G
, have been created in
corresponding residues, D228A and W99A (Ford et al., 1998
) and D228R (Li et al., 1998
), of mammalian G
. These
mutations impaired the ability of mammalian G
subunits to
activate adenylyl cyclase II, which is a mammalian homologue of ACA.
These results are consistent with our conclusion. The random
mutagenesis approach allowed us to identify several residues in the
region that are likely needed for effector interaction but not G
binding sites, which have yet to be examined in other systems. Our
study along with these two studies suggests that binding of G
to
G
covers a part of the region that is required for interaction
between G
and its effectors
likely a general mechanism of
regulation of G
signaling by its regulators in all eukaryotic
systems.
| |
ACKNOWLEDGMENTS |
|---|
We thank Dr. R. Gaudet of the P. Sigler laboratory for sending
the ribbon diagram of the G
subunit and Dr. J. Sondek of the
Sigler laboratory for providing coordinates of the heterotrimeric G
proteins; J. Borleis for assistance in the assay of actin
polymerization response; and Dr. C. Parent, Dr. Z. Xiao, W.M.
Froehlich, and other members in the Devreotes laboratory for valuable
advice and discussions. This work was supported by National Institutes of Health grant GM34933 (to P.N.D.). J.T. is supported by a National Institutes of Health fellowship.
| |
FOOTNOTES |
|---|
Corresponding author. E-mail address:
pnd{at}welchlink.welch.jhu.edu.
| |
REFERENCES |
|---|
|
|
|---|

dimers as well as
subunits.
Cell
71, 1069-1072[Medline].
-dimers in transmembrane signaling.
Nature
365, 403-406[Medline].
subunits.
Annu. Rev. Pharmacol. Toxicol.
37, 167-203[Medline].
subunit essential for termination of the phototransduction cascade.
Nature
370, 59-61[Medline].
subunits with effectors.
Science
280, 1271-1274
and its regulator, phosducin.
Cell
87, 577-588[Medline].
mutants discriminate
between G-protein depend and G-protein independent signaling mediated
by serpentine receptors. EMBO J. (in press).
binding on the G protein
subunit overlap with sites for regulation of phospholipase C
and adenylyl cyclase.
J. Biol. Chem.
273, 16265-16272
-subunit is essential for Dictyostelium development.
Genes Dev.
7, 986-995
dimers.
J. Biol. Chem.
266, 4538-4544
dimer at 2.1A resolution.
Nature
379, 369-374[Medline].
1
1
2.
Cell
83, 1047-1058[Medline].
and
subunits of the mating factor receptor-coupled G protein.
Cell
56, 467-477[Medline].
subunit is essential for multiple responses to chemoattractants in Dictyostelium.
J. Cell Biol.
129, 1667-1675
S and Cdc42.
J. Cell Biol.
138, 363-374This article has been cited by other articles:
![]() |
H. Levine, D. A. Kessler, and W.-J. Rappel Directional sensing in eukaryotic chemotaxis: A balanced inactivation model PNAS, June 27, 2006; 103(26): 9761 - 9766. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Xu, M. Meier-Schellersheim, X. Jiao, L. E. Nelson, and T. Jin Quantitative Imaging of Single Live Cells Reveals Spatiotemporal Dynamics of Multistep Signaling Events of Chemoattractant Gradient Sensing in Dictyostelium Mol. Biol. Cell, February 1, 2005; 16(2): 676 - 688. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Brzostowski, C. A. Parent, and A. R. Kimmel A G{alpha}-dependent pathway that antagonizes multiple chemoattractant responses that regulate directional cell movement Genes & Dev., April 1, 2004; 18(7): 805 - 815. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Latijnhouwers and F. Govers A Phytophthora infestans G-Protein {beta} Subunit Is Involved in Sporangium Formation Eukaryot. Cell, October 1, 2003; 2(5): 971 - 977. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Zhang, Y. Long, and P. N. Devreotes Ggamma in Dictyostelium: Its Role in Localization of Gbeta gamma to the Membrane Is Required for Chemotaxis in Shallow Gradients Mol. Biol. Cell, October 1, 2001; 12(10): 3204 - 3213. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Jin, N. Zhang, Y. Long, C. A. Parent, and P. N. Devreotes Localization of the G Protein Complex in Living Cells During Chemotaxis Science, February 11, 2000; 287(5455): 1034 - 1036. [Abstract] [Full Text] |
||||
![]() |
C. A. Parent and P. N. Devreotes A Cell's Sense of Direction Science, April 30, 1999; 284(5415): 765 - 770. [Abstract] [Full Text] |
||||
![]() |
F Soderbom, C Anjard, N Iranfar, D Fuller, and W. Loomis An adenylyl cyclase that functions during late development of Dictyostelium Development, January 12, 1999; 126(23): 5463 - 5471. [Abstract] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||