![]() |
|
|
Vol. 9, Issue 11, 3041-3055, November 1998
Department of Biochemistry and Molecular Biology, Pennsylvania State University College of Medicine, Hershey, Pennsylvania 17033
Submitted June 24, 1998; Accepted September 1, 1998| |
ABSTRACT |
|---|
|
|
|---|
To understand the factors specifically affecting tRNA nuclear export, we adapted in situ hybridization procedures to locate endogenous levels of individual tRNA families in wild-type and mutant yeast cells. Our studies of tRNAs encoded by genes lacking introns show that nucleoporin Nup116p affects both poly(A) RNA and tRNA export, whereas Nup159p affects only poly(A) RNA export. Los1p is similar to exportin-t, which facilitates vertebrate tRNA export. A los1 deletion mutation affects tRNA but not poly(A) RNA export. The data support the notion that Los1p and exportin-t are functional homologues. Because LOS1 is nonessential, tRNA export in vertebrate and yeast cells likely involves factors in addition to exportin-t. Mutation of RNA1, which encodes RanGAP, causes nuclear accumulation of tRNAs and poly(A) RNA. Many yeast mutants, including those with the rna1-1 mutation, affect both pre-tRNA splicing and RNA export. Our studies of the location of intron-containing pre-tRNAs in the rna1-1 mutant rule out the possibility that this results from tRNA export occurring before splicing. Our results also argue against inappropriate subnuclear compartmentalization causing defects in pre-tRNA splicing. Rather, the data support "feedback" of nucleus/cytosol exchange to the pre-tRNA splicing machinery.
| |
INTRODUCTION |
|---|
|
|
|---|
Nucleus/cytosol exchange of macromolecules is a complicated
process requiring participation of "shared" gene products affecting exchange of many types of macromolecular cargo, as well as
participation of "specific" gene products affecting a subset of the
types of cargo. Generally, karyophilic proteins are imported into the
nuclear interior, and newly synthesized RNAs are exported out to the
cytosol, but some macromolecules pass in both directions. Entry and
exit proceed through the same nuclear pores (Dworetzky and Feldherr, 1988
). Nuclear pores are large supramolecular complexes comprising ~50-100 separate proteins, called nucleoporins, that span the nuclear inner and outer membranes, creating an aqueous channel (for
review see Fabre and Hurt, 1997
; Ohno et al., 1998
). Small molecules can diffuse through the pore, but most macromolecules are
transported by an energy-requiring, signal-mediated process.
Nucleus/cytosol exchange seems to require a specific category of
exchange components, called importin-
proteins, which are instrumental in docking of the cargo to the nuclear pore. The prototype
of this family, importin-
, was identified as a cytoplasmic receptor
for the nuclear localization signal containing karyophilic proteins
(for review see Izaurralde and Adam, 1998
; Ohno et al., 1998
). Subsequent members of this family of receptors have been demonstrated to have different substrate specificity (Rout et al., 1997
; Schlenstedt et al., 1997
). RNA export, like
protein import, requires the participation of receptors or exportins
that are members of the importin-
family. Export of particular types of RNAs, i.e., tRNA, small nuclear RNA (snRNA), rRNA, and mRNA, is competed by an excess of that RNA type. However, the excess does not
inhibit the export of other RNA types, indicating existence of limiting
quantities of species-specific transit factors (Jarmolowski et
al., 1994
). Recent data on the roles of particular RNA binding proteins such as cap binding proteins, necessary for snRNA export, and
hnRNP proteins, important for mRNA export, support the concept of RNA
species-specific export pathways (Izaurralde and Adam, 1998
). Some of
the RNA binding proteins participating in the export process possess
leucine-rich nuclear export sequences recognized by importin-
family
member Crm1p/Xpo1p. Crm1p/Xpo1p has been shown to function as an
exportin for the leucine-rich nuclear export sequence containing
nucleus-localized proteins and to affect mRNA export to the cytosol
(Fornerod et al., 1997
; Fukuda et al., 1997
; Kudo
et al., 1997
; Ossareh-Nazari et al., 1997
; Stade
et al., 1997
; Ohno et al., 1998
).
Recently, another importin-
-like protein, exportin-t, has been
proposed to serve as a tRNA-specific receptor for tRNA export in
Xenopus and human cells by binding tRNA directly (Arts
et al., 1998
; Kutay et al., 1998
).
Nucleus/cytosol exchange also requires participation of a small GTPase,
Ran, and at least four proteins that regulate its GTP- or
GDP-bound states. Although the role(s) of the Ran cycle in
nucleus/cytosol exchange is not completely understood, several lines of
evidence support the model that RanGDP/GTP exchange functions to
release imported cargo from import receptors, and conversely, RanGTP
hydrolysis functions to release exported cargo from export receptors
(Izaurralde and Adam, 1998
; Ohno et al., 1998
). Although a
functional Ran cycle is required for translocation of most RNAs (Izaurralde et al., 1997
), export of the yeast heat shock
mRNAs is apparently independent of the Ran cycle (Saavedra et
al., 1996
).
Our studies focus on tRNA biogenesis including those gene products
necessary for pre-tRNA processing and export of the mature tRNAs to the
cytosol. Yeast pre-tRNAs differ from their mature counterparts by
possession of extra sequences located at the 5' and 3' extremities and,
for ~25% of tRNA families, by the presence of intron sequences
located one nucleotide 3' to the anticodon. Pre-tRNAs also lack
numerous nucleoside modifications that are present on the mature tRNAs,
posttranscriptionally added CCA nucleotides located at the 3' end and
sometimes a G located at the 5' terminus (for review see Hopper and
Martin, 1992
). Although there appears to be a preferred order of
processing steps, genetic studies and molecular analyses show that most
of the steps are not in an obligatory order (Hopper et al.,
1982
; Martin and Hopper, 1982
; O'Connor and Peebles, 1991
; Hopper and
Martin, 1992
). Some order to the eukaryotic processing pathway may be
imposed by the subcellular distribution of the processing activities,
because particular processing activities such as
m22G tRNA methyltransferase and splicing tRNA
endonuclease appear to be located at the surface of the inner nuclear
membrane (Peebles et al., 1983
; Clark and Abelson, 1987
;
Rose et al., 1995
), whereas other activities appear to be
nucleolar (Bertrand et al., 1998
; Hunter et al.,
1998
). Given what appears to be a nonobligatory order of processing
steps, it is curious that those mutations that act indirectly in tRNA
processing all affect the same step: excision of introns from the
pre-tRNA.
Many of the genes that indirectly affect pre-tRNA splicing are known to
play a role in nucleus/cytosol exchange, such as Rna1p and
Prp20p (Amberg et al., 1992
; Forrester et al.,
1992
; Kadowaki et al., 1993
), and/or to be nucleoporins,
such as Nsp1p, Nup49p, Nup116p, Nup133p, and Nup145p (Sharma et
al, 1996
). Why the first step of pre-tRNA splicing is often
affected by gene products that act indirectly in pre-tRNA processing
and how intervening sequence removal is coupled to nucleus/cytosol
exchange are intriguing questions. In an effort to learn about gene
products important for tRNA export and the coupling of nuclear export
and pre-tRNA splicing, we successfully adapted in situ hybridization to
locate endogenous levels of particular tRNAs in wild-type and mutant yeast cells. Here we describe the roles of particular yeast proteins in
export of tRNAs to the cytosol.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Strains and Media
The following yeast strains were used. EE1b-35
(MATa RNA1 rnh1::URA3 ura3-52 ade1 tyr1
his7 his4 Gal
) and EE1b-6 (MATa
rna1-1 rnh1::URA3 ura3-52 ade1 tyr1 his7 his4
Gal
) were described in Traglia et al. (1989)
.
Strains W303
(MAT
ade2-1 ura3-1 his3-11, 15 trp1-1 leu2-3,
112 NUP116) and SWY27 (MAT
ade2-1 ura3-1 his3-11, 15 trp1-1 leu2-3, 112 nup116
::HIS) were obtained from S. Wente (Wente et al., 1993
), and strains FY86 (MAT
RAT7 his3
200 ura3-52 leu2
1) and LGY101 (MAT
rat7-1 his3
200 ura3-52 leu2
1) were obtained from C.N. Cole (Gorsch et al., 1995
). X2316-3C (MAT
LOS1 SUP4 ade2-1
can1-100 lys1-1 his5-2 trp5-48 ura3-1) and IIIdIc-
V
(los1-
V SUP4 ade2-1 can1-100 ura3-1) were described by
Hurt et al. (1987)
. YEPD medium was used to grow yeast cells.
Oligonucleotide Probes
Probe 02 contains 50 residues of deoxythymidine. The sequences for probes 03, 04, and 05 are 5'-CGTTGCTTTTAAAGGCCTGTTTGAAAGGTCTTTGGCACAGAAACTTCGGAAACCGAATGTTGCTAT-3', 5'GTGGGGATTGAACCCACGACGGTCGCGTTATAAGCACGAAGCTCTAACCACTGAGCTACA-3', and 5'-GCGGGATCGAACCGCTGATCCCCGCGTTATTAGCACGGTGCCTTAACCAACTGGGCCAAG-3', respectively. All oligonucleotides used as probes for Northern analysis and in the subsequent fluorescence in situ hybridization analyses were synthesized by the Pennsylvania State University College of Medicine Macromolecular Core Facility.
Preparation of RNA and Northern Analysis
RNA was isolated by phenol extraction from log phase yeast cells
as described by Hopper et al. (1980)
. Approximately 15 µg of each RNA sample were used for Northern analysis, which was done
according to Wang et al. (1988)
.
Fluorescence In Situ Hybridization
This procedure has been adapted from the previously published
procedure of Kadowaki et al. (1992)
. Strains were grown at
23°C to log phase in YEPD and were either maintained at 23°C or
shifted to 37°C for the indicated periods of time. Cells were
prefixed in the culture by the addition of 0.1 volume of 37%
formaldehyde. After 15 min, 5 ml cells were harvested by centrifugation
and resuspended in 6 ml 4% paraformaldehyde, 0.1 M KPO4
(pH 6.5), and 5 mM MgCl2. After 3 h, cells were washed
twice with solution B (1.2 M sorbitol and 0.1 M KPO4, pH
6.5) and resuspended in 2.8 ml solution B containing 0.05%
-mercaptoethanol and 50 µl 2 mg/ml freshly prepared 100T Zymolyase
(ICN Biochemicals, Cosa Mesa, CA). Spheroplasting was conducted at
37°C for 20 min. Spheroplasts were washed three times in solution B
and resuspended in 0.3 ml solution B. Cells were adhered to the wells
of Teflon-faced slides (Cel-Line/Erie Scientific, Portsmouth,
NH) that had been pretreated with a 0.1% (wt/vol)
poly-L-lysine-containing solution (Sigma Chemical, St.
Louis, MO). Nonadhered cells were removed by aspiration. Cells were
treated with 70, 90, and 100% ethanol successively for a duration of 5 min each. The slides were placed in a dessicator for 5 min. Cells were
then incubated in prehybridization buffer containing 10% dextran
sulfate, 0.2% BSA, 2× SSC (1× SSC is 0.15 M NaCl and 0.015 M
Na-citrate), 125 µg Escherichia coli tRNA/ml, and 500 µg
denatured sonicated salmon sperm DNA/ml for 2 h at 37°C in a
humid chamber. Hybridization buffer had the same composition with 450 pg/ml digoxigenin-labeled probes. All probes were labeled at their 3'
end using terminal transferase (Life Technologies, Gaithersburg, MD)
and digoxigenin-11-UTP (Boehringer Mannheim, Indianapolis, IN)
according to the previously described procedure of Amberg et
al. (1992)
. Both the prehybridization and hybridization buffers
contained RNasin (Promega, Madison, WI) at a concentration of 1 U/µl.
Hybridization was carried out at 37°C overnight. Cells were washed
three times with 2× SSC at 45°C for tRNA probes and at 37°C for
the oligo(dT)50 probe. Cells were then washed three times
for 10 min with 1× SSC at room temperature. Cells were briefly washed
with 4× SSC containing 1% Triton X-100 and then blocked for 2 h
using 1% BSA containing 4× SSC. Fluoresceinated anti-digoxigenin Fab
fragment (Boehringer Mannheim) was diluted according to the manufacturer's recommendation in solution containing 1% BSA and 4×
SSC, and the cells were incubated with the diluted antibody for 2 h. Cells were washed twice with 4× SSC followed by two more washes
with 4× SSC containing 1% Triton X-100, each wash lasting for 10 min.
After two more rapid washes with 4× SSC, cell nuclei were
counterstained with 0.1 µg/ml 4',6-diamidino-2-phenylindole dihydrochloride (DAPI). After two rapid washes with water, the slides
were mounted under 90% glycerol and 1× PBS containing 1 mg/ml
p-phenylenediamine and stored at
20°C.
Fluorescence In Situ Hybridization and Indirect Immunofluorescence
Fluorescence in situ hybridization was carried out as described
above, but after incubation with fluoresceinated anti-digoxigenin Fab
fragment all subsequent washes were of only 5 min duration each. Cells
were incubated with 1:20,000 dilution of mouse monoclonal antibody 32D6
(anti-Nsp1p) (Hunter et al., 1998
) for 2 h followed by
five rapid washes with 1× SSC and then incubated for 1 h with 1:400 dilution of CY3-conjugated goat-anti-mouse antibody (Jackson ImmunoResearch Laboratories, West Grove, PA). Cells were washed five
times with 1× SSC and stained with DAPI as described above.
Microscopic Imaging
Fluorescence images were obtained by using a Nikon Microphot-FX microscope (Nikon Instrument Group, Melville, NY) equipped with a SenSys charged-coupled device camera (Photometrics, Tucson, AZ). Image processing was done with QED software (Pittsburgh, PA), NIH Image (http://rsb.info.nih.gov/nih-image), and Adobe Photoshop (Adobe Systems, Mountain View, CA).
| |
RESULTS |
|---|
|
|
|---|
In Situ Hybridization Analysis of the Subcellular Distributions of Endogenous Levels of tRNAs in Wild-Type Cells
In situ hybridization is a powerful method to study gene products
important for the export of RNAs from their nuclear site of synthesis
to their final cytoplasmic destination. Using oligo(dT) to detect total
poly(A)-containing mRNA populations, numerous yeast mutants altered in
mRNA transport have been identified (Amberg et al,
1992
; Kadowaki et al., 1992
). It has also been possible to
study the location of particular mRNAs via in situ hybridization. Usually single mRNA species are detected by overexpression of the gene
in question and by using multiple probes complementary to the mRNA
species (Saavedra et al., 1996
; Long et al.,
1997
); however, there is one report of successful use of in situ
hybridization to locate endogenous levels of a mRNA (Takizawa et
al., 1997
). Because tRNAs have no sequences such as poly(A) in
common with each other, it is not possible to study the cellular
distribution of the total tRNA population. However, tRNAs are rather
abundant molecules. Only ~2.5 × 104 of the 1.2 × 107 nucleotide yeast genome is devoted to tRNA genes
(for review see Hani and Feldmann, 1998
), yet tRNAs constitute ~20%
of the total RNA population. One reason for tRNA abundance is long
half-life. Given 42 tRNA species (Hani and Feldmann, 1998
), an
individual species should constitute ~0.5% of the total cellular
RNA, within an order of magnitude of the sum of the total mRNA
population (~1-5% of total RNA). Therefore, we anticipated that in
situ hybridization would be sufficiently sensitive to locate a single
species of mature tRNA within yeast cells. In contrast, tRNA precursors
(pre-tRNAs) have shorter half-lives than their mature counterparts, and
the ability to detect individual pre-tRNAs by in situ techniques could be problematic.
To determine whether it is possible to use in situ hybridization to
locate individual tRNAs within yeast, we chose to study tRNAIle and designed oligonucleotide probes to detect
particular tRNAIle species (Figure
1). Probe 05 contains 60 nucleotides and
is complementary to tRNAIleAAU, which is
encoded by 13 identical genes that do not contain introns (Hani and
Feldmann, 1998
). The specificity of the probe was determined by RNA
blot analysis. Using this assay, a single RNA species that migrates at
the expected molecular weight for mature
tRNAIleAAU was detected (Figure
2). tRNAIleUAU is
encoded by two identical genes that contain 60-nucleotide-long introns,
the longest of the yeast tRNA introns (Hopper and Martin, 1992
). To
detect intron-containing pre-tRNAIleUAU, we
used a 66-nucleotide probe complementary to the entire intron plus 3 nucleotides 5' and 3' to the intron (Figure 1, Probe 03). To detect the
entire tRNAIleUAU population, we used an
oligonucleotide containing 60 nucleotides complementary to a region of
the mature tRNA sequence that spans the anticodon loop (Figure 1, Probe
04). By Northern analysis probe 04 detected three RNAs migrating at the
expected molecular weights for mature
tRNAIleUAU, end-matured intron-containing
pre-tRNA, and 5' and 3' end-extended intron-containing pre-tRNA
species. Probe 03, as expected, detected only the two intron-containing
pre-tRNAs. Therefore, the probes detect only the anticipated tRNA
species.
|
|
In situ hybridization studies using probes 03, 04, and 05 were conducted to locate the tRNAs within wild-type yeast strain EE1b-35 (Figure 3; see MATERIALS AND METHODS). The positions of nuclei were assessed by costaining cells with the DNA-specific dye DAPI (Figure 3) or by combining in situ hybridization with immunofluorescence techniques and using an antibody specific for nuclear pores (see below). Control cells treated identically to experimental cells except for the absence of probe had little or no fluorescent signal (Figure 3, A and B). Using probe 05, which is specific for mature tRNAIleAAU, wild-type cells grown at 23°C had signal throughout the cells, with some accumulation in nuclei (Figure 3, C and D). When the same cells were incubated for 1 or 3 h at 37°C, the signal was primarily cytoplasmic, and the nucleus appeared to be rather depleted for tRNAIleAAU (see below). Controls in which 1000-fold excess of unlabeled probe 05 was included during hybridization resulted in loss of the fluorescent signal (Figure 3, E and F), whereas including 1000-fold excess of probes 03 or 04 during hybridization did not affect the intensity or location of the probe 05 signal (our unpublished results). The results show that the hybridization signal detected is specific for tRNAIleAAU and indicate, as expected, that mature tRNAs are located primarily in the cytosol. Detection of a nuclear pool at 23°C but not at 37°C probably reflects a lower rate of nuclear export of tRNAIleAAU at the lower temperature growth conditions.
|
In situ hybridization using probe 04 complementary to the two forms of precursor and the mature tRNAIleUAU gave a cytosolic signal along with evidence of nuclear staining when the cells were grown at 23°C (Figure 3, G and H) or when incubated at 37°C for 1 or 3 h (our unpublished results). This signal was completely competed by the addition of 1000-fold excess of unlabeled probe 04 in the hybridization mix but not by heterologous probe 05 (our unpublished results), again documenting specificity. Because probe 04 detects pre-tRNAIleUAU as well as mature tRNAIleUAU, whereas probe 05 detects only mature tRNAAAU, the nuclear signal detected for wild-type cells incubated at 37°C using probe 04 but not 05 could be indicative of a nuclear pool of pre-tRNAIleUAU at both low and high temperatures. To test this, we used probe 03, which detects only pre-tRNAIleUAU as documented by Northern analysis for in situ hybridization. These studies revealed only a somewhat uniformly distributed nuclear signal whether the cells were grown at 23°C (Figure 3, I and J) or incubated at 37°C for 1 or 3 h (see below).
Absence of signal in the absence of probe, competition of signal for each probe when an excess of unlabeled probe was included during hybridization, and lack of competition when the same molar excess of either heterologous unlabeled probe was used, provide strong evidence that in situ hybridization can be used to detect endogenous levels of specific tRNAs in yeast. Moreover, the nuclear location of pre-tRNA and primarily cytosolic location of mature tRNAs substantiate the efficacy of the in situ hybridization procedure and further indicate the usefulness of this method for studies of subcellular distributions of tRNA species and/or pre-tRNA processing.
The Effects of Nucleoporins, Los1p, and RanGAP on Nuclear Export of tRNAs Encoded by Genes Lacking Introns
Nucleoporins.
Our goal is to identify genes important
for the export of tRNAs to the cytosol. As described above, tRNA
export is coupled to pre-tRNA splicing. To study export of tRNAs
independent of pre-tRNA splicing, we chose to assess the location of
tRNAIleAAU, which is encoded by genes lacking
introns. In wild-type yeast cells tRNAIleAAU is
located primarily in the cytosol (Figure 3, C and D). Because tRNAs are
very stable molecules, cells will have high levels of cytosolic
tRNAIleAAU whether or not they are blocked in
tRNA nuclear export when incubated at nonpermissive conditions.
Therefore, it was not clear whether it would be possible to detect by
in situ hybridization increased nuclear pools over high cytosolic
signals in cells with tRNA export defects. To determine this, we chose
to compare the location of tRNAIleAAU in the
nup116
mutant to its location in the parent strain. NUP116 encodes a nucleoporin, and a deletion of this gene
causes a temperature-sensitive growth defect resulting from aberrant, sealed nucleopores and subsequent defects in nucleus/cytosol exchange (Wente and Blobel, 1993
). Because of the aberrant nucleopores, we
anticipated that export of tRNA would also be defective and that this
strain would be useful to test whether in situ hybridization could be
used to study tRNA nuclear retention.
strain were grown at a
permissive temperature and incubated at 37°C for 1 h, and the
locations of RNAs were determined by in situ hybridization (Figure
4). To be certain that the cells showed
the appropriate defect in nucleus/cytosol exchange under these
conditions and in the in situ procedures we use, we assessed the
location of poly(A)-containing RNA in these cells using a 50-nucleotide
oligo(d)T probe. Appropriate controls to confirm the specificity of the
oligo(dT)50 probe were conducted (our unpublished results).
For the parent grown at 23°C (our unpublished results) or incubated
for 1 h at 37°C (Figure 4, A and B), poly(A)-containing RNA was
distributed throughout the cells. For nup116
cells grown
at the permissive temperature, the signal was indistinguishable from
the parent strain (our unpublished results). In contrast, for
nup116
cells incubated for 1 h at 37°C (Figure 4,
C and D), poly(A)-containing RNA was predominately nuclear. Thus,
nup116
cells display the previously reported defect in
mRNA nuclear export (Wente and Blobel, 1993
mutants grown at 23°C was indistinguishable from its parent (our unpublished results). However, upon incubation of the nup116
cells for 1 h (Figure
4, G and H) at 37°C, prominent nuclear accumulation of
tRNAIleAAU resulted. Even though there is
considerable tRNAIleAAU in the cytosol of
nup116
cells incubated at 37°C, within 1 h there
is clear nuclear accumulation of tRNAIleAAU
above this background. We conclude that it is possible to detect RNA
export defects by in situ hybridization even for a stable molecule such
as tRNA and that Nup116p is important for the movement of tRNA from the
nucleus to the cytosol.
|
, tRNAIleAAU was
distributed throughout the FY86 cells when they were grown at
23°C, and there was a less prominent nuclear signal when these cells
were incubated for 1 h at 37°C (Figure 5, E and F). However, in
contrast to the results obtained for nup116
,
tRNAIleAAU distribution in rat7-1
cells was indistinguishable from the isogenic FY86 parent cells. No
tRNAIleAAU nuclear accumulation was evident
when the rat7-1 cells were incubated for 1 h at 37°C
(Figure 5, G and H). We conclude that not all nucleoporins that are
important for the distribution of mRNA to the cytosol are important for
the distribution of tRNA to the cytosol.
|
Los1p.
Yeast Los1p bears similarity to the importin-
family
of proteins (Görlich et al., 1997
), specifically to
vertebrate exportin-t, which has been shown to facilitate nuclear tRNA
export (Arts et al., 1998
; Kutay et al., 1998
).
LOS1 is an unessential yeast gene. Mutations of the
LOS1 gene cause accumulation of intron-containing pre-tRNAs
(Hopper et al., 1980
, Simos et al., 1996
) but do
not appear to affect production of rRNA or most mRNAs (Hopper et
al., 1980
; Shen et al., 1996
). If yeast Los1p is the
functional homologue of exportin-t, then one might expect that in
addition to the defects in pre-tRNA splicing, los1 mutants
might show defects in the distribution of tRNA to the cytosol. To study
the effects of Los1p on nuclear export independent of the affects on
pre-tRNA splicing, we used in situ hybridization to locate
tRNAIleAAU that is encoded by intronless genes.
V, which possesses a
deletion allele, los1
V (Hurt et al., 1987
V mutant cells showed significant tRNAIleAAU nuclear accumulation when the cells
were incubated for 1 h (Figure 6, A, panels G and H, and B) or
3 h at 37°C (our unpublished results). The accumulation of
nucleus-located RNA appeared to be tRNA specific, because the same
cells showed no accumulation of nucleus-located poly(A) RNA (Figure 6A,
panels C and D). Thus, los1 mutations affect export of tRNA
but not mRNA at the nonpermissive temperature. Although it is difficult
to obtain quantitative information regarding the amounts of nuclear
signal to cytosolic signal by these methods, the nup116
strain appears to accumulate tRNAIleAAU in the
nucleus more rapidly and to a higher level than do los1
V
cells.
|
(Figure 4) or los1
V (Figure 6A)
strains appeared more diffuse and to extend beyond the DAPI signal. To
confirm that accumulated tRNAIleAAU was within
the confines of the nuclear border, we probed for tRNAIleAAU and simultaneously stained the
nuclear membrane using monoclonal antibody 32D6, which is specific for
nucleoporin Nsp1p (Hunter et al., 1998
(our unpublished results)
and los1
V mutant cells (Figure 6B, panels A-D).
RanGAP.
Alteration of components of the RanGTPase cycle
causes nuclear accumulation of mRNA (Amberg et al., 1992
;
Forrester et al., 1992
; Kadowaki et al., 1993
;
Schlenstedt et al., 1995
) and defects in nuclear protein
import (Corbett et al., 1995
). The yeast RNA1 gene encodes the RanGTPase-activating protein RanGAP, which is necessary for GTP hydrolysis of RanGTP to RanGDP (Becker et
al., 1995
; Bischoff and Ponstingl, 1995
; Corbett
et al., 1995
). If alteration of Ran components also affects
tRNA export, then one might expect mutations in RNA1 to
cause nuclear accumulation of mature tRNAs. We determined
the location of mature tRNAIleAAU encoded by
intronless genes in rna1-1 cells. As for the studies of
nup116
and rat7-1 mutants, we compared the
cellular distributions of poly(A)-containing RNA and
tRNAIleAAU in EE1b-6 rna1-1 mutant
cells with the distributions in EE1b-35, the isogenic wild-type strain.
Poly(A)-containing RNA distributions were, as anticipated, largely
cytoplasmic in the wild-type strain and nuclear in the
rna1-1 mutant strain when the cells were incubated at 37°C
for 1 h (our unpublished results) or 3 h (Figure
7, A-D). Also as anticipated,
tRNAIleAAU was predominantly cytosolic when
EE1b-35 cells were incubated at 37°C for 1 h (our unpublished
results) or 3 h (Figure 7, E-F). Interestingly, rna1-1
mutant cells showed nuclear accumulation of
tRNAIleAAU when exposed for 1 h (our
unpublished results) or 3 h (Figure 7, G-H) at the nonpermissive
temperature. As for the studies of los1
V, it appears that
the nup116
cells accumulate
tRNAIleAAU in the nucleus more rapidly and to a
higher level than rna1-1 cells. Our results are in
agreement with the studies of Izaurralde et al. (1997)
, who
demonstrated a role for a functional RanGTPase cycle for the export of
all tested RNAs.
|
Defects in RanGAP Cause Nuclear Accumulation of Intron-Containing Pre-tRNA
As pre-tRNA splicing precedes export of mature tRNA from the
nucleus, it is remarkable that mutations of genes involved in nucleus/cytosol exchange
nuclear pore structural components and the
RanGTPase pathway
affect pre-tRNA intron removal (Hopper
et al., 1978
; Kadowaki et al., 1993
; Sharma
et al., 1996
). At least four different scenarios, or
combinations thereof, could account for this conundrum. First, there
could be "feedback" of information from the exchange process to the
splicing endonuclease machinery thereby indirectly causing
intron-containing species to accumulate within the nucleus. Second,
pre-tRNAs could fail to be delivered from their site of synthesis to
the nuclear membrane where the tRNA splicing machinery is located
(Peebles et al., 1983
; Clark and Abelson, 1987
). Third,
alteration of the nuclear pores and/or the Ran pathway could lead to
structural changes in the nuclear membrane which, in turn, could alter
the topology of the nuclear membrane-located tRNA splicing endonuclease
or cause leakage of nuclear components. Previous studies have
implicated a role for the RanGTPase cycle in nuclear membrane integrity
in mammalian and Schizosaccharomyces pombe cells (for review
see Sazer, 1996
). Fourth, alteration of nuclear transport components
could affect the regulation of the ordered path of pre-tRNA splicing
preceding nuclear export causing export of intervening sequence
(IVS)-containing RNAs. There is precedence for alterations in the
nucleus/cytosol exchange machinery affecting the ordered steps of RNA
processing and export. For example, when the HIV Rev gene is expressed
in yeast, unspliced RRE-containing mRNAs are detected in the cytosol and the levels of these cytoplasmic pre-mRNAs are modulated by overexpression or disruption of RIP1/NUP42, a
gene encoding a yeast nucleoporin (Stutz et al., 1995
).
Consequences of either the third or fourth scenarios could generate
cytoplasmic pools of intron-containing pre-tRNAs that could not be
spliced because they would be physically separated from the tRNA
splicing endonuclease located at the inner surface of the nuclear membrane.
Temperature-sensitive rna1-1 mutants are defective in
nucleus/cytosol exchange at the nonpermissive temperature (Amberg
et al., 1992
; Corbett et al., 1995
), and they
accumulate intron-containing pre-tRNAs (Hopper et al., 1978
;
Knapp et al., 1978
). As assessed by Northern analysis, using
probe 03 complementary to the entire pre-tRNAIleUAU intron, there was no difference
in the amount of intron containing pretRNAIleUAU when the wild-type, EE1b-35
or rna1-1 mutant, EE1b-6, cells were grown at the
permissive temperature (our unpublished results). However, after an
exposure to the elevated temperature of 37°C for 1 h,
rna1-1 cells had an increased level
pre-tRNAIleUAU compared with the isogenic
wild-type cells (Figure 2, compare lane 4 with lanes 1-3). To test
whether the increased levels of pre-tRNAIleUAU
in the rna1-1 cells were due to precocious movement of
pre-tRNAs to the cytosol in cells with an altered RanGTPase pathway, we used in situ hybridization to locate intron-containing pre-tRNAs in
wild-type cells and rna1-1 cells incubated at the
nonpermissive temperature. In agreement with the Northern analysis, the
in situ hybridization signal using probe 03 was substantially more
intense in rna1-1 cells when they were incubated at the
nonpermissive temperature in comparison with the control cells (Figure
8, compare A with C). This
intron-specific signal is restricted to the nucleus in both parental
and rna1-1 mutant cells, and the signal is somewhat uniformly distributed throughout the nucleus in both. Thus, the data
indicate that pre-tRNA accumulation in rna1-1 cells does not
result from precocious pre-tRNA nuclear export or accumulation in an
inappropriate nuclear subcompartment. The nuclear location of
intron-containing pre-tRNAs supports the notion that the tRNA splicing
pathway is tightly coupled to nucleus/cytosol exchange (Hopper et
al., 1978
; Kadowaki et al., 1993
; Sharma et
al., 1996
).
|
| |
DISCUSSION |
|---|
|
|
|---|
Three lines of evidence document successful adaptation of in situ hybridization to assess intracellular locations of endogenous levels of individual tRNA species: 1) competition studies showing specificity of the signals for particular tRNA probes used, 2) location of mature tRNAs in the cytosol and IVS-containing pre-tRNAs in the nucleus, and (3) nuclear accumulation of mature tRNA in yeast cells with sealed nuclear pores. Detection of endogenous levels of individual species of IVS-containing tRNA processing intermediates is due, in part, to pre-tRNA splicing being a slow step in the biogenesis pathway. Our ability to detect nuclear accumulation of mature tRNAs above the cytosolic pool has allowed analyses of particular yeast mutants for defects in tRNA export. We intend to extend this approach to characterize roles of other known nucleoporins in tRNA export. In principle, we should be able to adapt this type of analysis to screen among collections of yeast temperature-sensitive mutants to uncover novel essential genes important to the tRNA export pathway.
Studies of yeast mutants with lesions in genes encoding nucleoporins
have demonstrated that many of the nucleoporins are important for both
nuclear import and export. However, other nucleoporins have been found
to affect transit in a single direction (Fabre and Hurt, 1997
). Yeast
RAT7 encoding nucleoporin Nup159p has been reported to
affect only outward-bound nuclear traffic (Gorsch et al.,
1995
). Here we show that even though rat7-1 cells are defective in poly(A) RNA export, they appear not to be defective in
nuclear export of mature tRNAIleAAU. Thus,
Rat7p/Nup159p appears to have a species-specific role in RNA export.
Yeast NUP42/RIP1 encoding nucleoporin Nup42p provides another example of an RNA species-specific nucleoporin.
NUP42/RIP1 is an unessential gene and rip1
mutants show no defect in RNA nuclear export when the location of
poly(A) mRNA is analyzed using oligo(d)T probes for in situ
hybridization. However, the mutant cells are unable to export heat
shock mRNAs (Saavedra et al., 1997
). These two examples, the
role of Nup159p in poly(A) export but not in tRNA export, and the role
of Nup42p in heat shock mRNA export but not in general poly(A) export,
indicate that the roles of other nucleoporins in the exchange processes
need to be evaluated for multiple types of RNA cargo.
Pre-tRNA splicing is highly coupled to nuclear export. Perhaps the most
compelling evidence for this is accumulation of IVS-containing pre-tRNAs in yeast strains with mutations in any of several genes encoding nucleoporins (Nsp1p, Nup49p, Nup116p, Nup133p, and Nup145p; Sharma et al., 1996
). We originally identified the
RNA1 and LOS1 genes in searches for yeast mutants
defective in pre-tRNA processing, and we and others showed that
rna1-1 and los1 mutants accumulate intron-containing end-matured pre-tRNAs (Hopper et al.,
1978
, 1980
; Knapp et al., 1978
; Simos et al.,
1996
). In this study we demonstrate that the rna1-1 and
los1
V mutations cause nuclear accumulation of tRNAs
encoded by genes lacking introns. Thus, RNA1 and
LOS1 functions are also important for tRNA export
independent of the effects on pre-tRNA splicing.
Los1p is located primarily in nuclei and it is a member of the
importin-
family of proteins (Shen et al., 1993
;
Görlich et al., 1997
). Recently, a human Ran binding
protein, exportin-t, was shown to interact with tRNA and, when
overexpressed, to facilitate export of tRNA from the nucleus to the
cytosol in Xenopus oocytes and HeLa cells (Arts et
al., 1998
; Kutay et al., 1998
). Human exportin-t is
19% identical to yeast Los1p (Kutay et al., 1998
). Here we
demonstrate that a disruption of the LOS1 gene causes nuclear accumulation of mature tRNA. Thus, an excess of human exportin-t facilitates tRNA nuclear export and yeast los1
deletion inhibits tRNA nuclear export. Hence our data is consistent
with the model that Los1p and human exportin-t are functionally
homologous because both affect tRNA export. Because the yeast genome
contains a single LOS1 gene and it is unessential (Hurt
et al., 1987
; Goffeau et al., 1997
), Los1p cannot
be absolutely required for tRNA export. Moreover, our results indicate
that los1 mutant cells accumulate nuclear tRNA more slowly
and to a lesser extent than do nup116 mutant cells, which
have nucleopore structural defects. If Los1p is indeed the yeast
exportin-t homologue, then there must be other factors, at least in
yeast, that also play a role in tRNA export.
In our efforts to identify other proteins that may function like Los1p,
we found the SOL family of genes as multicopy suppressors of
los1 mutations (Shen et al., 1996
). However, the
SOL genes do not appear to be involved in tRNA nuclear
export (Sarkar, Stanford, and Hopper, unpublished results) or pre-tRNA
splicing, because we do not see any accumulation of pre-tRNAs in the
sol mutants by in situ hybridization (Sarkar, Stanford, and
Hopper, unpublished results), and accumulation of intron-containing
pre-tRNAs, observed in los1 mutants, is not reversed by
overexpressing the SOL genes (Shen et al., 1996
).
Using the strategy of synthetic lethality, Simos et al.
(1996)
uncovered three-way genetic interactions between LOS1
and PUS1, which encodes tRNA pseudouridine
synthase, and NSP1. NSP1 encodes an essential member of the
FXFG family of nucleoporins and nsp1 mutants show defects in
nuclear protein import but not nuclear export of poly(A) RNAs. A
testable possibility is that NSP1 affects tRNA nuclear
export without affecting poly(A) export. It would also be valuable to
determine the phenotypes of yeast strains that have lesions in
LOS1 in addition to lesions in genes encoding other members
of the importin-
family.
Although the RanGTPase path has been shown to be required for nuclear
exit of most RNAs, yeast heat shock mRNAs exit the nucleus by a
Ran-independent path (Saavedra et al., 1996
). The role of the RanGTPase pathway in tRNA nuclear export has been somewhat controversial. Studying cells with a mutant RanGDP/ GTP exchange factor, Cheng et al. (1995)
found that tRNA export was
independent of the RanGTPase pathway. In contrast, injection of excess
RanGAP into nuclei to deplete nuclei of RanGTP, led Izaurralde et
al. (1997)
to conclude that the RanGTPase pathway is necessary for tRNA nuclear export. However, even for the studies using excess nuclear
RanGAP, tRNA export was affected to a lesser extent than were other
RNAs such as snRNAs. Although not conclusive from our work here, it
appears that rna1-1 cells, like los1
V cells,
accumulate nuclear tRNA slower and to lesser extent than do
nup116 mutant cells. Thus, in yeast as in higher eukaryotic
cells, it may be that nuclear export of tRNAs is less dependent on the
RanGTPase cycle than are other RNAs. Why the RanGTPase pathway has
different effects on particular RNA substrates is an intriguing
unresolved question.
How are pre-tRNA splicing and nuclear export coupled in
rna1-1 and los1 mutants? Unless Los1p and Rna1p
function at more than one step in the tRNA biogenesis pathway, the
simplest explanation for their functions is that they play direct roles
in tRNA nucleus/cytosol exchange and affect pre-tRNA splicing
indirectly. Nuclear accumulation of intron-containing pre-tRNAs in
rna1-1 (Figure 8) and los1
V (our unpublished
results) cells rule out one model wherein the IVS-containing pre-tRNAs
accumulate because they are physically separated from the splicing
machinery due to precocious movement to the cytosol. Our studies
showing similar intranuclear distribution of IVS-containing pre-tRNAs
in wild-type and mutant strains argue against yet another model wherein
pre-tRNA accumulation in the mutant strains is caused by inappropriate
subnuclear compartmentalization. A model (Sharma et al.,
1996
) that could account for the phenotypes of nup mutants
posits that the tRNA splicing machinery is located within nucleopore
channels and is aberrant in cells with lesions of genes encoding
nucleoporins. However, by this model it is more difficult to account
for the coupling of nuclear export and pre-tRNA splicing evidenced by
los1 and rna1 strains. It is possible that each
alters nuclear pore structure, but there is no evidence to support
this. Alternatively, it is possible that faulty export blocks upstream
pre-tRNA splicing. It is not likely that splicing defects are caused by
inappropriately high concentrations of mature tRNAs in nuclear
export-deficient mutants because it has been demonstrated that high
concentrations of mature tRNA failed to act as a competitor for
endonuclease activity (Peebles et al., 1979
). An attractive
and testable model for feedback inhibition is the possible shuttling of
splicing endonuclease subunits between the nucleus and the cytosol
(Trotta and Abelson, personal communication). This would result in
pre-tRNA splicing dependence on continuous appropriate nucleus/cytosol exchange.
| |
ACKNOWLEDGMENTS |
|---|
We thank Dr. A.M. Tartakoff for technical advice, Dr. D. Engelke for information before publication, and Dr. E. Phizicky for stimulating conversations. We thank Dr. J.E. Hopper, Dr. T. Zoladek, and the members of Dr. Hopper's laboratory for comments on the manuscript. This work was supported by a Public Health Services grant from the National Institutes of Health to A.K.H.
| |
FOOTNOTES |
|---|
* Corresponding author. E-mail address: ahopper{at}psu.edu.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Y. Haitani and H. Takagi Rsp5 is required for the nuclear export of mRNA of HSF1 and MSN2/4 under stress conditions in Saccharomyces cerevisiae. Genes Cells, February 1, 2008; 13(2): 105 - 116. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. R. Strub, M. B.K. Eswara, J. B. Pierce, and D. Mangroo Utp8p Is a Nucleolar tRNA-binding Protein That Forms a Complex with Components of the Nuclear tRNA Export Machinery in Saccharomyces cerevisiae Mol. Biol. Cell, October 1, 2007; 18(10): 3845 - 3859. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Whitney, R. L. Hurto, H. H. Shaheen, and A. K. Hopper Rapid and Reversible Nuclear Accumulation of Cytoplasmic tRNA in Response to Nutrient Availability Mol. Biol. Cell, July 1, 2007; 18(7): 2678 - 2686. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Hurto, A. H. Y. Tong, C. Boone, and A. K. Hopper Inorganic Phosphate Deprivation Causes tRNA Nuclear Accumulation via Retrograde Transport in Saccharomyces cerevisiae Genetics, June 1, 2007; 176(2): 841 - 852. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Shaheen, R. L. Horetsky, S. R. Kimball, A. Murthi, L. S. Jefferson, and A. K. Hopper Retrograde nuclear accumulation of cytoplasmic tRNA in rat hepatoma cells in response to amino acid deprivation PNAS, May 22, 2007; 104(21): 8845 - 8850. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yoshihisa, C. Ohshima, K. Yunoki-Esaki, and T. Endo Cytoplasmic splicing of tRNA in Saccharomyces cerevisiae Genes Cells, March 1, 2007; 12(3): 285 - 297. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Culjkovic, I. Topisirovic, L. Skrabanek, M. Ruiz-Gutierrez, and K. L.B. Borden eIF4E is a central node of an RNA regulon that governs cellular proliferation J. Cell Biol., November 6, 2006; 175(3): 415 - 426. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Shibata, M. Sasaki, T. Miki, A. Shimamoto, Y. Furuichi, J. Katahira, and Y. Yoneda Exportin-5 orthologues are functionally divergent among species Nucleic Acids Res., October 18, 2006; 34(17): 4711 - 4721. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Haeusler and D. R. Engelke Spatial organization of transcription by RNA polymerase III Nucleic Acids Res., October 18, 2006; 34(17): 4826 - 4836. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. KWAPISZ, P. CHOLBINSKI, A. K. HOPPER, J.-P. ROUSSET, and T. ZOLADEK Rsp5 ubiquitin ligase modulates translation accuracy in yeast Saccharomyces cerevisiae RNA, November 1, 2005; 11(11): 1710 - 1718. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Gu, R. L. Hurto, A. K. Hopper, E. J. Grayhack, and E. M. Phizicky Depletion of Saccharomyces cerevisiae tRNAHis Guanylyltransferase Thg1p Leads to Uncharged tRNAHis with Additional m5C Mol. Cell. Biol., September 15, 2005; 25(18): 8191 - 8201. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. G. Campbell, N. P. Hoyle, and M. P. Ashe Dynamic cycling of eIF2 through a large eIF2B-containing cytoplasmic body: implications for translation control J. Cell Biol., September 12, 2005; 170(6): 925 - 934. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Shaheen and A. K. Hopper From the Cover: Retrograde movement of tRNAs from the cytoplasm to the nucleus in Saccharomyces cerevisiae PNAS, August 9, 2005; 102(32): 11290 - 11295. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Takano, T. Endo, and T. Yoshihisa tRNA Actively Shuttles Between the Nucleus and Cytosol in Yeast Science, July 1, 2005; 309(5731): 140 - 142. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Hiley, T. Babak, and T. R. Hughes Global analysis of yeast RNA processing identifies new targets of RNase III and uncovers a link between tRNA 5' end processing and tRNA splicing Nucleic Acids Res., May 26, 2005; 33(9): 3048 - 3056. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Kim, U. Hoja, J. Stolz, G. Sauer, and E. Schweizer Identification of the tRNA-binding Protein Arc1p as a Novel Target of in Vivo Biotinylation in Saccharomyces cerevisiae J. Biol. Chem., October 8, 2004; 279(41): 42445 - 42452. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Stanford, M. L. Whitney, R. L. Hurto, D. M. Eisaman, W.-C. Shen, and A. K. Hopper Division of Labor Among the Yeast Sol Proteins Implicated in tRNA Nuclear Export and Carbohydrate Metabolism Genetics, September 1, 2004; 168(1): 117 - 127. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Steiner-Mosonyi, D. M. Leslie, H. Dehghani, J. D. Aitchison, and D. Mangroo Utp8p Is an Essential Intranuclear Component of the Nuclear tRNA Export Machinery of Saccharomyces cerevisiae J. Biol. Chem., August 22, 2003; 278(34): 32236 - 32245. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Li and X. Chen PAUSED, a Putative Exportin-t, Acts Pleiotropically in Arabidopsis Development But Is Dispensable for Viability Plant Physiology, August 1, 2003; 132(4): 1913 - 1924. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Hunter, M. J. Aukerman, H. Sun, M. Fokina, and R. S. Poethig PAUSED Encodes the Arabidopsis Exportin-t Ortholog Plant Physiology, August 1, 2003; 132(4): 2135 - 2143. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yoshihisa, K. Yunoki-Esaki, C. Ohshima, N. Tanaka, and T. Endo Possibility of Cytoplasmic pre-tRNA Splicing: the Yeast tRNA Splicing Endonuclease Mainly Localizes on the Mitochondria Mol. Biol. Cell, August 1, 2003; 14(8): 3266 - 3279. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Hopper and E. M. Phizicky tRNA transfers to the limelight Genes & Dev., January 15, 2003; 17(2): 162 - 180. [Full Text] [PDF] |
||||
![]() |
X.-L. Yang, R. J. Skene, D. E. McRee, and P. Schimmel Crystal structure of a human aminoacyl-tRNA synthetase cytokine PNAS, November 26, 2002; 99(24): 15369 - 15374. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Feng and A. K. Hopper A Los1p-independent pathway for nuclear export of intronless tRNAs in Saccharomycescerevisiae PNAS, April 16, 2002; 99(8): 5412 - 5417. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-E. Gleizes, J. Noaillac-Depeyre, I. Leger-Silvestre, F. Teulieres, J.-Y. Dauxois, D. Pommet, M.-C. Azum-Gelade, and N. Gas Ultrastructural localization of rRNA shows defective nuclear export of preribosomes in mutants of the Nup82p complex J. Cell Biol., December 10, 2001; 155(6): 923 - 936. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. G. Macara Transport into and out of the Nucleus Microbiol. Mol. Biol. Rev., December 1, 2001; 65(4): 570 - 594. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Gro{beta}hans, F. Lecointe, H. Grosjean, E. Hurt, and G. Simos Pus1p-dependent tRNA Pseudouridinylation Becomes Essential When tRNA Biogenesis Is Compromised in Yeast J. Biol. Chem., November 30, 2001; 276(49): 46333 - 46339. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Lin, M. H. Nymark-McMahon, L. Yieh, and S. B. Sandmeyer Integrase Mediates Nuclear Localization of Ty3 Mol. Cell. Biol., November 15, 2001; 21(22): 7826 - 7838. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kuwabara, M. Warashina, S. Koseki, M. Sano, J. Ohkawa, K. Nakayama, and K. Taira Significantly higher activity of a cytoplasmic hammerhead ribozyme than a corresponding nuclear counterpart: engineered tRNAs with an extended 3' end can be exported efficiently and specifically to the cytoplasm in mammalian cells Nucleic Acids Res., July 1, 2001; 29(13): 2780 - 2788. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Maraia La Protein and the Trafficking of Nascent RNA Polymerase III Transcripts J. Cell Biol., May 14, 2001; 153(4): F13 - F18. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Azad, D. R. Stanford, S. Sarkar, and A. K. Hopper Role of Nuclear Pools of Aminoacyl-tRNA Synthetases in tRNA Nuclear Export Mol. Biol. Cell, May 1, 2001; 12(5): 1381 - 1392. [Abstract] [Full Text] |
||||
![]() |
A.W. JOHNSON, J.H.-N. HO, G. KALLSTROM, C. TROTTA, E. LUND, L. KAHAN, J. DAHLBERG, and J. HEDGES Nuclear Export of the Large Ribosomal Subunit Cold Spring Harb Symp Quant Biol, January 1, 2001; 66(0): 599 - 606. [Abstract] [PDF] |
||||
![]() |
K. Hellmuth, H. Grosjean, Y. Motorin, K. Deinert, E. Hurt, and G. Simos Cloning and characterization of the Schizosaccharomyces pombe tRNA:pseudouridine synthase Pus1p Nucleic Acids Res., December 1, 2000; 28(23): 4604 - 4610. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H.-N. Ho, G. Kallstrom, and A. W. Johnson Nmd3p Is a Crm1p-dependent Adapter Protein for Nuclear Export of the Large Ribosomal Subunit J. Cell Biol., November 20, 2000; 151(5): 1057 - 1066. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kendall, M. W. Hull, E. Bertrand, P. D. Good, R. H. Singer, and D. R. Engelke A CBF5 mutation that disrupts nucleolar localization of early tRNA biosynthesis in yeast also suppresses tRNA gene-mediated transcriptional silencing PNAS, November 2, 2000; (2000) 240454997. [Abstract] [Full Text] |
||||
![]() |
H. Qiu, C. Hu, J. Anderson, G. R. Björk, S. Sarkar, A. K. Hopper, and A. G. Hinnebusch Defects in tRNA Processing and Nuclear Export Induce GCN4 Translation Independently of Phosphorylation of the alpha Subunit of Eukaryotic Translation Initiation Factor 2 Mol. Cell. Biol., April 1, 2000; 20(7): 2505 - 2516. [Abstract] [Full Text] |
||||
![]() |
H. Grosshans, E. Hurt, and G. Simos An aminoacylation-dependent nuclear tRNA export pathway in yeast Genes & Dev., April 1, 2000; 14(7): 830 - 840. [Abstract] [Full Text] |
||||
![]() |
A. L. Benko, G. Vaduva, N. C. Martin, and A. K. Hopper Competition between a sterol biosynthetic enzyme and tRNA modification in addition to changes in the protein synthesis machinery causes altered nonsense suppression PNAS, January 4, 2000; 97(1): 61 - 66. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sarkar, A. K. Azad, and A. K. Hopper Nuclear tRNA aminoacylation and its role in nuclear export of endogenous tRNAs in Saccharomyces cerevisiae PNAS, December 7, 1999; 96(25): 14366 - 14371. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. I. Moy and P. A. Silver Nuclear export of the small ribosomal subunit requires the Ran-GTPase cycle and certain nucleoporins Genes & Dev., August 15, 1999; 13(16): 2118 - 2133. [Abstract] [Full Text] |
||||
![]() |
Y. Liu, W. Guo, P. Y. Tartakoff, and A. M. Tartakoff A Crm1p-independent nuclear export path for the mRNA-associated protein, Npl3p/Mtr13p PNAS, June 8, 1999; 96(12): 6739 - 6744. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Floer and G. Blobel Putative Reaction Intermediates in Crm1-mediated Nuclear Protein Export J. Biol. Chem., June 4, 1999; 274(23): 16279 - 16286. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Paraskeva, E. Izaurralde, F. R. Bischoff, J. Huber, U. Kutay, E. Hartmann, R. Luhrmann, and D. Gorlich CRM1-mediated Recycling of Snurportin 1 to the Cytoplasm J. Cell Biol., April 19, 1999; 145(2): 255 - 264. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Wolin and A. G. Matera The trials and travels of tRNA Genes & Dev., January 1, 1999; 13(1): 1 - 10. [Full Text] |
||||
![]() |
E. Lund and J. E. Dahlberg Proofreading and Aminoacylation of tRNAs Before Export from the Nucleus Science, December 11, 1998; 282(5396): 2082 - 2085. [Abstract] [Full Text] |
||||
![]() |
S. M. Bailer, C. Balduf, J. Katahira, A. Podtelejnikov, C. Rollenhagen, M. Mann, N. Pante, and E. Hurt Nup116p Associates with the Nup82p-Nsp1p-Nup159p Nucleoporin Complex J. Biol. Chem., July 28, 2000; 275(31): 23540 - 23548. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Deinert, F. Fasiolo, E. C. Hurt, and G. Simos Arc1p Organizes the Yeast Aminoacyl-tRNA Synthetase Complex and Stabilizes Its Interaction with the Cognate tRNAs J. Biol. Chem., February 16, 2001; 276(8): 6000 - 6008. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gwizdek, E. Bertrand, C. Dargemont, J.-C. Lefebvre, J.-M. Blanchard, R. H. Singer, and A. Doglio Terminal Minihelix, a Novel RNA Motif That Directs Polymerase III Transcripts to the Cell Cytoplasm. TERMINAL MINIHELIX AND RNA EXPORT J. Biol. Chem., July 6, 2001; 276(28): 25910 - 25918. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kendall, M. W. Hull, E. Bertrand, P. D. Good, R. H. Singer, and D. R. Engelke A CBF5 mutation that disrupts nucleolar localization of early tRNA biosynthesis in yeast also suppresses tRNA gene-mediated transcriptional silencing PNAS, November 21, 2000; 97(24): 13108 - 13113. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||