![]() |
|
|
Vol. 9, Issue 11, 3085-3094, November 1998
Department of Anatomy and Cell Biology, State University of New York Health Science Center, Syracuse, New York 13210
Submitted April 24, 1998; Accepted September 3, 1998| |
ABSTRACT |
|---|
|
|
|---|
Chlamydomonas reinhardtii flagellar regeneration is accompanied by rapid induction of genes encoding a large set of flagellar structural components and provides a model system to study coordinate gene regulation and organelle assembly. After deflagellation, the abundance of a 70-kDa flagellar dynein intermediate chain (IC70, encoded by ODA6) mRNA increases approximately fourfold within 40 min and returns to predeflagellation levels by ~90 min. We show by nuclear run-on that this increase results, in part, from increased rates of transcription. To localize cis induction elements, we created an IC70 minigene and measured accumulation, in C. reinhardtii, of transcripts from the endogenous gene and from introduced promoter deletion constructs. Clones containing 416 base pairs (bp) of 5'- and 2 kilobases (kb) of 3'-flanking region retained all sequences necessary for a normal pattern of mRNA abundance change after deflagellation. Extensive 5'- and 3'- flanking region deletions, which removed multiple copies of a proposed deflagellation-response element (the tub box), did not eliminate induction, and the IC70 5'-flanking region alone did not confer deflagellation responsiveness to a promoterless arylsulfatase (ARS) gene. Instead, an intron in the IC70 gene 5'-untranslated region was found to contain the deflagellation response element. These results suggest that the tub box does not play an essential role in deflagellation-induced transcriptional regulation of this dynein gene.
| |
INTRODUCTION |
|---|
|
|
|---|
Flagellar and ciliary regeneration is a common phenomenon among
many organisms such as protozoan flagellates, ciliates, and ciliated
invertebrate larvae (Lefebvre and Rosenbaum, 1986
) and is accompanied
by the rapid induction of genes encoding a large set of flagellar or
ciliary structural components (Stephens, 1977
; Guttman and Gorovsky,
1979
; Lefebvre et al., 1980
). Since these organelles contain
hundreds of proteins that assemble in precise stoichiometric ratios,
their regeneration provides a unique opportunity to study mechanisms of
coordinate gene regulation during organelle assembly.
After deflagellation, the abundance of Chlamydomonas
reinhardtii flagellar protein mRNAs rises rapidly and peaks after
20-50 min with a 2- to 15-fold increase over constitutive
(nondeflagellated, ND) levels; transcript levels then gradually return
to normal within 2 h (Lefebvre et al., 1980
; Schloss
et al., 1984
; Williams et al., 1986
). Nuclear
run-on experiments have demonstrated that deflagellation-induced
accumulation of
- and
-tubulin mRNA can be largely accounted for
by increased transcription of new mRNAs (Keller et al.,
1984
), although changes in tubulin mRNA stability also contribute
(Baker et al., 1984
). The cis elements required for this
response are located in 5'-flanking sequences, within 100 bp of the
initiation site (Davies et al., 1992
; Davies and Grossman,
1994
). A 10-bp consensus motif (the tub box; Brunke et al.,
1984
) occurs in multiple copies upstream of all four C. reinhardtii tubulin genes and has been implicated in regulation of
the tubB2
-tubulin gene (Davies and Grossman, 1994
).
Similar sequences are found in other C. reinhardtii genes
regulated by deflagellation, such as the radial spoke genes encoding
RSP3, RSP4, and RSP6 (Williams et al., 1989
; Curry et
al., 1992
), but the role of tub box sequences in transcriptional
regulation of these genes has not been studied. Recent analysis of
induction elements in an
1-tubulin gene concluded that two regions
contributed to the deflagellation response and questioned the role of
tub box elements in that promoter (Periz and Keller, 1997
). The
CBLP gene, which also has a tub box in the promoter region,
is not up-regulated after deflagellation (Schloss, 1990
). Because
tubulins are far more abundant than other flagellar proteins and are
used for cytoplasmic as well as flagellar microtubules, their
regulation may not typify that of most flagellar protein genes. To
identify promoter elements involved in transcriptional regulation of a typical flagellar protein gene, we have analyzed transcripts generated from introduced copies of a C. reinhardtii gene encoding the
70-kDa intermediate chain subunit of flagellar outer row dynein
(ODA6 gene).
We previously found that IC70 mRNA abundance increases after
deflagellation in a pattern similar to that of radial spoke gene transcripts (Williams et al., 1986
). Since several copies of
the tub box consensus were found within 1 kb upstream of the presumed IC70 transcription start site, this region was targeted for promoter deletions and for fusions to a reporter gene encoding C. reinhardtii arylsulfatase (ARS). Here we use nuclease protection
to identify the IC70 transcription start site, show that the
deflagellation-induced increase in IC70 mRNA abundance is regulated
transcriptionally, and find that a cis promoter element located within
an intron in the 5'-untranslated region (UTR) is both necessary and
sufficient for this deflagellation response.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Chlamydomonas Strains and Manipulations
Chlamydomonas stocks were obtained from the following
sources: strain oda6-95 from R. Kamiya (University of
Tokyo); wild-type strain 137c from J. Rosenbaum (Yale
University); a cw15,nit1-305 strain and
Nit+ strain A2 from P. A. LeFebvre (University of
Minnesota). An oda6-95,nit1-305,cw15 strain was created by first crossing the oda6-95 mutation
out of the 137c background into a Nit+
background and then in a second cross introducing the
nit1-305 and cw15 mutations. All stocks were
maintained by standard methods (Harris, 1989
) on minimal medium I (M-I)
or M-I supplemented with acetate (M-II) (Sager and Granick, 1953
).
RNA Isolation and Northern Blot Analysis
Cells were grown in liquid M-I medium with a 12-h light/12-h
dark cycle until cell density reached ~1 × 107
cells per ml. Either before deflagellation, or at indicated times after
pH shock deflagellation (Witman et al., 1972
), cells were harvested and RNA was isolated by a guanidinium extraction procedure (Chomczynski and Sacchi, 1987
) modified as previously described (Mitchell and Kang, 1991
). For Northern blot analysis (Sambrook et al., 1989
), 10-30 µg of total RNA were electrophoresed
on a 1% agarose gel containing formaldehyde, transferred to nylon
membranes (Micron Separations, Westboro, MA) by capillary
blotting, baked at 80°C for 2 h, and hybridized with
32P-labeled RNA probes overnight at 58°C in an solution
containing 50% formamide, 5× Denhardt's solution, 6× SSC, and 100 µg/ml yeast tRNA. Membranes were then washed twice with 2× SSC,
0.1% SDS at 58°C and twice with 0.1× SSC, 0.1% SDS at 65°C.
[32P]UTP-labeled RNA probes were synthesized using an in
vitro transcription kit (Stratagene, La Jolla, CA). Autoradiographs
were quantitated with a Shimadzu CS-9000 density scanner (Shimadzu
Scientific Instruments, Columbia, MD). For comparing
autoradiographic band intensities of different lanes, all densities
were normalized with the RNA band density of a C. reinhardtii G protein
subunit-like polypeptide (CBLP), which
is constitutively expressed after deflagellation (Schloss, 1990
).
In Vitro Nuclear Run-on Transcription
A crude nuclear fraction was prepared from cw15,nit1
cells either before or 2 min after deflagellation by the method of
Keller et al. (1984)
, mixed with 2× reaction buffer,
quick-frozen in liquid nitrogen, and stored at
70°C. Buffers and
procedures for freezing nuclei and for in vitro transcription reactions
were taken from Nevins (1987)
. For labeling, 50 µl of nuclei
from 6 × 107 cells were added to 50 µl of labeling
mix containing 250 µCi
-32P UTP (3000 Ci/mmol). After
60 min at 26°C, 5 vol of DNase digestion mix were added (150 U DNase
I, 10 mM Tris, 500 mM NaCl, 50 mM MgCl2, 2 mM
CaCl2, pH 7.4), and incubation was continued tor 10 min at
30°C. Total nucleic acids were extracted, precipitated, and
hybridized to duplicate dots of 2 µg denatured plasmid DNA. Blots
were exposed for 38 h and were quantitated on a PhosphorImager (Molecular Dynamics, Sunnyvale, CA). Signal intensity readings were corrected for background, then deflagellated (DF) vs. ND signals
were normalized for any difference in intensity of the CBLP signal
(Schloss, 1990
).
S1 Nuclease Mapping
S1 mapping followed standard procedures (Sambrook et
al., 1989
). A NheI-SalI restriction
fragment from a 5'-deletion construct (see below), which covers from
114 bp downstream to 134 bp upstream of the 5'-end of IC70 cDNA c70-16
(Mitchell and Kang, 1991
), was purified, dephosphorylated with calf
intestinal alkaline phosphatase (New England Biolabs, Boston, MA), and
labeled at the 5'-end with
-32P ATP (Amersham, Arlington
Heights, IL) and T4 polynucleotide kinase (New England Biolabs). The
labeled double-stranded fragment was denatured in formamide at 90°C
for 10 min and run on a 5% neutral polyacrylamide gel for 18 h,
and separated strands were located by autoradiography and isolated by a
crush and soak method. Each labeled single-stranded DNA
(105 cpm) was denatured for 10 min at 90°C and hybridized
with 1-3 µg mRNA overnight at 30°C in 80% formamide, 40 mM
piperazine-N,N'-bis(2-ethanesulfonic acid) (pH 6.4), 400 mM
NaCl, 1 mM EDTA. The annealed products were digested with S1 nuclease
at 13°C for 1 h, the reaction was stopped by adding 0.25 vol of
S1 stop buffer, and the products were precipitated with ethanol and
separated on an 8% acrylamide gel. A phage M13 dideoxy sequence ladder
was used as a size marker.
Cotransformation
Double-mutant strain oda6,nit1,cw15 was used for
cotransformation with 2 µg of plasmid pMN24 containing the
NIT1 gene and 10 µg of plasmid containing the IC70
promoter construct, as described by Kindle (1990)
. All plasmids were
linearized within vector sequences before transformation. Cells grown
in M-II to 1 × 107 cells/ml were harvested by
centrifugation, and cell walls were removed by 30 min treatment with
gametic cell wall lysin (Harris, 1989
). Approximately 1 × 109 cells in 1 ml M-II lacking ammonia
(NH4NO2 replaced with NaNO2) were
used in each transformation, and cells were spread directly onto M-II
plates lacking ammonia and grown under constant light for several days.
Transformants were randomly selected and tested for cotransformation
with promoter constructs by PCR amplification of plasmid sequences from
genomic DNA as described below.
Genomic DNA was prepared from 107 cells by
phenol/chloroform extraction and ethanol precipitation. DNA from 5 × 105 cells was amplified with 20 pmol of each primer in a
total volume of 20 µl in a minicycler (MJ Research, Watertown, MA).
IC70 minigene deletions were amplified with the pBluescript KS primer
(CGAGGTCGACGGTATCG) as 5'-primer and a 3'-primer that covers the
truncated IC70 gene from nucleotide +41 to +60
(GCACCGAATAGCTTGACCTG). If the size of an amplification product matched
the expected length of the introduced promoter construct, we assumed
that an intact promoter was present. For similar tests of 70F/ARS,
70FU/ARS, and 70FU I/ARS transformants, the 5'-primer covered the IC70
promoter from upstream
309 to
326 (TCGCATCCATCCTGTCTC); for
70+5'I/ARS and 70
5'I/ARS transformants the 5'-primers were the
primers used to amplify the IC70 first intron (see below). A common
3'-primer (CGGGTTGAAGCACCACTA) was used that begins within the ARS gene 77 bp downstream of the translation start site.
Construction of Reporter Genes and Promoter Deletions
All IC70 constructs were derived from a 6-kb genomic
SacI fragment (Mitchell and Kang, 1991
) cloned into
pBluescript (pB70S6). To create an IC70 minigene, two BglII
fragments spanning 1411 bp, which includes the 400 bp second intron of
the IC70 gene (Mitchell and Kang, 1993
), were removed from pB70S6. The
resulting truncated IC70 gene encodes a 1621-base mRNA instead of a
full-length 2634 base transcript. An Erase-a-Base kit (Promega Biotec,
Madison, WI) was used to create nested sets of 5'- and 3'- deletions
that were sequenced to determine exact deletion endpoints. Small
deletions within the 5'-flanking region were formed by joining pairs of 5'- and 3'-deletions that had been obtained as above. 5'- Deletions down to
32 and
13 were paired with 3'-deletions ending at
52 and
37 by ligating at pBluescript ClaI sites, so that deletion endpoints were joined by polylinker sequences (one ClaI and
two half HindIII sites; AGCTTATCGATAAGCT).
Plasmid pJD55 contains a promoterless ARS gene that lacks
5'-flanking sequences and retains only 67 bp of its 5'-UTR (Davies et al., 1992
). To create promoter fusions, IC70 gene
fragments extending from a KpnI site at
430 in the IC70
5'-flanking region to specific 3'-deletion sites were inserted into
pJD55 polylinker sites KpnI and SalI. An IC70
fragment that had been deleted with ExoIII from the 3'-end
to +1 (transcription initiation site) was cut at an adjacent
pBluescript SalI site and ligated with pJD55 to create
chimeric gene 70F/ARS. By inserting an IC70
KpnI-BstEII fragment spanning
430 to +430 into
the promoterless ARS gene, 70FU/ARS was obtained. The IC70
first intron in 70FU/ARS was removed by two steps: first, a 288 bp
NheI-BstEII fragment covering the first intron
was removed from the IC70 minigene and replaced by a corresponding cDNA
fragment, and then a 622-bp KpnI-BstEII fragment from this new construct was inserted into ARS plasmid pJD55. The resulting 70FU
I/ARS chimeric gene has no IC70 first intron but retains the rest of the IC70 5'-sequence from
430 to +430.
Primers covering the 5' (CTGGGTACCGCTGAACACAGTC) and 3'
(GACGTCCAGTGGGTACCGGT) end of the IC70 first intron were used to
amplify the intron. The amplification product was cloned into plasmid pCRII by TA cloning (Invitrogen, San Diego, CA), and a KpnI
fragment containing the intron was then inserted into the
5'-KpnI site of the 70FU
I/ARS chimeric gene plasmid. The
orientation of this fragment was determined by restriction mapping, and
constructs with the intron in its original orientation (70+5'I/ARS), or
the opposite orientation (70
5'I/ARS) were used for cotransformation and expression studies.
| |
RESULTS |
|---|
|
|
|---|
Since changes in tubulin mRNA levels in response to deflagellation
are controlled by both changes in message stability and changes in
transcription rate, we first tested whether changes in dynein IC70
abundance are controlled at the transcriptional level using nuclear
run-on assays. Labeled RNA synthesized from an equal number of ND and
DF cell nuclei were hybridized with dots of dynein cDNA clone pBc70-16
(Mitchell and Kang, 1991
),
2 tubulin cDNA (Youngbloom et
al., 1984
), and of a cDNA-encoding CBLP, a constitutively
expressed C. reinhardtii G protein
subunit-like protein
(Schloss, 1990
). As shown in Figure 1,
IC70 expression increased dramatically in response to deflagellation.
After subtraction of background and normalization to CBLP,
transcription signals (measured by PhosphorImager) increased 2.2-fold
for dynein and 6.3-fold for tubulin. Similar results were obtained
using RNA synthesized from two independently prepared nuclear samples.
|
To map potential IC70 gene promoter elements, the probable transcription start site was first located through S1 nuclease mapping with a 248-base probe, which extends 134 bases beyond the 5'-end of cDNA clone pBc70-16 (Figure 2). The major protected length of the probe was 146 nucleotides (Figure 2A), which places the initiation site 32 bp beyond the 5'-end of cDNA clone c70-16 (Figure 2B). Primer extension analysis also demonstrated that a major stop site is present 32 bp beyond the c70-16 cDNA 5'-end.
|
Promoter Deletion Analysis of the Truncated IC70 Gene
Because no enzymatic reporter gene assay system has been adapted successfully for analysis of rapid changes in transcript abundance in Chlamydomonas, transcripts of introduced genes were measured directly by Northern blot hybridization. A truncated IC70 clone was created in which an internal 1411-bp BglII fragment was deleted so that an mRNA smaller than the endogenous IC70 mRNA would be encoded (Figure 3). When this truncated gene was cotransformed into oda6,nit1,cw15 cells, the truncated message was expressed, and transformants showed increased levels of this mRNA after deflagellation, suggesting that the deflagellation response element(s) was contained in the 813 bp of upstream sequences present in this construct. Examination of this 813-bp upstream region revealed the presence of eight sequences (underlined in Figure 2B) with at least 70% identity to the 10-bp tub box consensus GCTC(G/C)AAGGC (a ninth copy spans the initiation site, and a tenth resides within an intron in the 5'-UTR). To determine whether these or other regulatory elements control deflagellation responsiveness, a series of 5'-flanking region deletions were made from the truncated gene by exonuclease digestion, and the constructs diagrammed in Figure 3A were selected for further use. Deletion constructs T-416, T-96, and T-45, which result in deletion of five, seven, or all eight upstream tub boxes (see arrowheads in Figure 2B), were introduced, and RNA samples were isolated before and at various times after deflagellation. The constitutively expressed CBLP mRNA was used as a normalizing control for the amount of RNA loaded in each lane. When RNA that had been isolated from a T-416 transformant was probed with an IC70 cDNA antisense transcript, bands of 1.6 kb (truncated gene) and 2.6 kb (endogenous gene) were detected (Figure 3B). Both bands show a similar time course of abundance changes, indicating that T-416 contains most of the element(s) required for normal regulation in response to a deflagellation signal. Peak abundance of the endogenous transcript was 7.9-fold above control (ND) levels in this experiment, while peak abundance of the truncated transcript was 5.7-fold above control. Absolute levels of truncated gene mRNA were 2.1 ± 0.4 (n = 8) fold higher than those of the endogenous IC70 message (averaged over multiple time points from two separate deflagellations). Southern blots used to analyze T-416 copy number indicated that one partial and two complete copies of the minigene had been integrated in this transformant. Two T-96 and one T-45 transformant were similarly tested and in each case expressed the truncated gene at levels that were detectable in ND cells. Both constructs supported induction 30' after deflagellation similar to that of the endogenous IC70 gene (Figure 3D). To determine whether a regulatory element is located 3' to the IC70 gene, a deletion was created in which all sequences beyond 10 bp 3' from the polyadenylation site were removed (Figure 3A, 3'T10). When this deleted gene was introduced into oda6,nit1,cw15 cells, it still responded to deflagellation. The ratio of the fold-induction of truncated:endogenous transcripts was close to 1 in all cases (0.81 ± 0.18 (n = 3) for T-96, 1.24 ± 0.63 (n = 3) for T-45, and 0.96 ± 0.22 (n = 5) for 3'T10).
|
To further test the function of flanking sequences between
45 and the
transcriptional start site, we tested a 5'-deletion to
13 (T
13) and
two internal deletions in which bp
52 to
32 (I
52
32) and
37 to
13 (I
37
13) were replaced by 16 bp of plasmid sequence. None of 17 colonies transformed with T-13 expressed the truncated gene at a
detectable level, either before or after deflagellation, suggesting
that some elements between
45 and
13 might be necessary for basal
gene expression. However, both I-52-32 and I-37-13 transformed cells
expressed the truncated gene, and in both cases transcript levels had
increased several fold by 30 min after deflagellation (Figure 3D).
Use of the Promoterless ARS Gene as a Reporter Gene at the Transcriptional Level
Because extensive 5' and 3'-deletions did not eliminate the
response of this truncated gene to deflagellation, we reasoned that
either plasmid sequences were functioning as deflagellation response
elements, or an essential element was located inside the gene. To test
these possibilities, a promoterless ARS gene was used as a
reporter gene. Endogenous ARS expression is completely repressed by the
presence of low concentrations of SO42
in the
medium (Davies et al., 1992
), which allows the activity of
introduced ARS gene constructs to be monitored. Although ARS enzyme activity was detectable in cells transformed with an
ARS gene under the control of the
-2 tubulin promoter,
this activity did not parallel the rapid increase in ARS mRNA observed
when cells were deflagellated (Davies et al., 1992
), perhaps
reflecting slow processing of the translation product to its mature,
catalytically active form. We therefore used transcript abundance
rather than ARS activity to measure transcription of ARS under the
control of a modified IC70 promoter. Transformants of chimeric IC70/ARS genes used for tests of transcriptional regulation were all selected based upon a PCR assay that ensured that ARS had not fortuitously recombined with genomic DNA so as to lose IC70 sequences and fall under
the influence of another promoter.
Several IC70/ARS transcriptional fusions were generated to locate the
deflagellation response element (Figure
4A). In construct 70F/ARS, the IC70
5'-flanking region was ligated to a promoterless ARS gene
that extends 67 bp 5' of its translation start site. Additional
constructs contain both the 5'-flanking region and portions of the
5'-UTR of IC70. We first confirmed that endogenous ARS expression is
repressed in untransformed cells grown in the presence of
SO42
(cont. lanes in Figure 4B). 70F/ARS
transformants expressed the chimeric gene but no mRNA abundance
increase was seen after deflagellation, suggesting that neither the
IC70 5'-flanking region nor adjacent plasmid sequences can support
deflagellation induction (Figure 4B, 70F/ARS). To exclude the
possibility that the promoter fusion failed to respond because the pH
shock induction signal was weak, this blot was stripped and reprobed
with IC70 cRNA (Figure 4C), and a 4.8-fold increase in the endogenous
IC70 mRNA abundance was revealed (both probes could not be used at the
same time because the ARS and IC70 transcripts are of similar size).
|
To determine whether sequences needed for induction were present in the
IC70 5'-UTR, a restriction fragment spanning the IC70 5'-flanking
region plus most of the 5'-UTR (from
430 to +430) was ligated to the
promoterless ARS gene to create construct 70FU/ARS (Figure
4A). When this construct was introduced into oda6/nit1 cells, two of
nine randomly selected Nit+ colonies expressed the chimeric
gene, and in both cases the gene was inducible. The Northern blot
results of one such transformant are shown in Figure 4B. The strong
induction seen (3.3-fold) suggests that a deflagellation-responsive
element is located within the first 430 bp of the IC70 5'-UTR, which is
interrupted by a 239-bp intron. To remove the intron from 70FU/ARS, an
IC70 restriction fragment containing the intron was removed and a
corresponding IC70 cDNA fragment substituted to create 70FU
I/ARS
(Figure 4A). After transformation of pMN24 and 70FU
I/ARS into
oda6/nit1 cells, two of nine Nit+ colonies expressed the
chimeric gene, but neither of them responded to deflagellation (Figure
4D). As in Figure 4C, the blot was stripped and reprobed with IC70
(Figure 4E), and densitometry showed that the endogenous IC70 mRNA
abundance increased by 3.6-fold and 3.3-fold after deflagellation.
Most mammalian enhancer and yeast upstream elements have the ability to
function in both orientations, and at long and variable distances with
respect to the transcription initiation site. The IC70 first intron was
therefore tested for position and orientation dependence. The intron
was amplified and inserted in both orientations into an upstream
(
430) KpnI site of 70FU
I/ARS (Figure 4A). When introduced into oda6/nit1 cells, reporter plasmids containing the
intron in either orientation (70+5'I/ARS and 70
5'I/ARS) supported ARS
expression and responded to deflagellation (3.2-fold and 3.7-fold, respectively), indicating that the enhancer activity of the intron is
position and orientation independent (Figure 4F).
| |
DISCUSSION |
|---|
|
|
|---|
Our analysis of the deflagellation-induced increase in IC70 mRNA
abundance indicates that a primary mode of regulation for this gene is
transcriptional, as first shown by nuclear run-on assays and
subsequently confirmed by localizing a necessary regulatory region in
an intron. Because basal promoter elements have not been extensively
characterized in Chlamydomonas, and the IC70 gene lacks an
obvious TATA homology domain, its promoter could not be identified by
sequence inspection. S1 nuclease protection assays were used to reveal
one major transcription initiation site that defines the approximate
3'-end of the promoter. Multiple transcription initiation sites have
been observed for other Chlamydomonas genes that lack an
obvious TATA homology, such as those for radial spoke proteins 3 and 4 (Curry et al., 1992
) and CBLP (Schloss, 1990
), but promoter
deletion studies that might define important basal promoter elements in
these genes have not been reported.
In several transformants the IC70 minigenes were expressed at levels
equal to or higher than the endogenous IC70 gene, as seen also for
1-tubulin gene constructs (Periz and Keller, 1997
). In contrast,
transformants containing chimeric CABII-1/NIT1 genes (Blankenship and Kindle, 1992
) and tubulin/ARS genes (Davies
et al., 1992
) express these genes at levels much lower than
those of endogenous CABII-1 or tubulin genes. Whether the
high levels of expression we observed result from high levels of mRNA
stability or from high levels of transcription, which in turn might be
due to fortuitous integration into favorable genomic sites, to
integration of multiple gene copies, or to an intrinsic property of the
IC70 promoter sequences used, was not determined. Although several of
these transformants contain more than one introduced gene copy, we did
not determine how many of these copies were transcribed actively.
Approximately 25% of the cotransformants (identified by PCR) failed to
express the truncated gene at a detectable level. Although promoter
regions of these genes were intact (PCR primers were chosen to only
amplify complete recombinant promoters), absence of a detectable
expression product could have resulted from rearrangement of coding
sequences during the integration event or, alternatively, to
integration into an unfavorable genomic region.
Less than 100 bp of Chlamydomonas
2 tubulin gene
5'-flanking region is sufficient for deflagellation induction (Davies
and Grossman, 1994
); deletions of this tubulin promoter to
95
retained inducibility while deletions to
65 or
36 removed
deflagellation control without affecting basal transcription. A
Chlamydomonas
-tubulin gene promoter has been similarly
tested and loses full inducibility between
176 and
122, but retains
weak inducibility down to
85 and basal transcription down to
16
(Periz and Keller, 1997
). Here we have demonstrated continued
transcription of the IC70 gene after deletion of 5'-flanking regions
down to
45 from the major initiation site, and after replacing
sequences from
52 to
32 and
37 to
13 with approximately equal
lengths of plasmid sequence, suggesting that, as with tubulin, all
essential promoter elements are found in a small region close to the
initiation site. Unlike tubulin genes, the regulatory element
responsible for deflagellation induction of the IC70 gene is not found
in the 5'-flanking region but instead is an enhancer located in a 239-bp intron. Intronic enhancers have been identified in many other
genes (Chung and Perry, 1989
; Franklin et al., 1991
; Bai et al., 1993
), including
-tubulin genes of
Drosophila (Buttgereit and Renkawitz-Pohl, 1993
), and the
RBCS2 gene in Chlamydomonas (Lumbreras et
al., 1998
). Sequence comparisons between this intron and either
the 5'-proximal promoter region or the introns of several other
C. reinhardtii flagellar genes including
1,
2,
1,
and
2 tubulin genes (Brunke et al., 1984
; Schloss
et al., 1984
; Silflow et al., 1985
) and radial
spoke protein 3, 4, and 6 genes (Williams et al., 1989
;
Curry et al., 1992
) did not reveal any flagellar gene-exclusive consensus sequence. Although one region with an 80%
match to the tub box consensus is seen in the IC70 intron, deletion of
nine other tub box consensus sequences between
813 and +1 (and four
additional tub box consensus sequences in reverse orientation on the
opposite strand) did not affect induction. The presence of multiple
matches to the tub box consensus may be a consequence of the high G + C
content of the C. reinhardtii genome with no direct
relevance to transcriptional regulation. Lack of a highly conserved
sequence motif among all genes induced by deflagellation suggests that
different genes may use different regulatory element(s) for
deflagellation-induced transcriptional regulation, or that the
element(s) is degenerate enough to be missed by sequence alignments.
Although
- and
-tubulin mRNA accumulation can be largely
accounted for by new transcription (Keller et al., 1984
),
comparison of the synthesis rates with accumulation fold change
indicated that an elongated mRNA half-life contributes as well (Baker
et al., 1984
). Whether dynein mRNA stability likewise
increases after deflagellation has not been directly determined, but a
similar fold change in mRNA abundance was observed for the IC70
minigene, which has intact 5'- and 3'-UTRs, and the IC70/ARS chimeric
gene constructs, in which the IC70 3'-UTR was replaced by the ARS
3'-UTR. Gene-specific 3'-UTR sequences do not appear to contribute to deflagellation-induced mRNA abundance increases. Further, when the
intronic transcriptional control region is absent, no change in
IC70/ARS mRNA abundance is seen after deflagellation (Figure 4B,
70F/ARS; Figure 4D). The contribution of 5'-UTR-dependent mRNA
stability changes to increases in mRNA abundance must therefore be
below the level of detection in these Northern blot experiments.
The signal transduction pathway that mediates deflagellation-induced
transcriptional activation is not yet well characterized. Although mRNA
abundance changes are usually coupled with flagellar outgrowth and
synthesis of new flagellar proteins, several lines of evidence indicate
that protein synthesis is not required for deflagellation-induced
increases in mRNA synthesis (Baker et al., 1986
) and that
induction is actually independent of flagellar excision and
regeneration (Cheshire and Keller, 1991
; Quarmby et al.,
1992
). The calmodulin antagonist W-7, the protein kinase inhibitor
staurosporine, and conditions that reduce calcium concentrations each
partially inhibit flagellar gene induction, implicating several second
messengers in the deflagellation induction cascade (Cheshire and
Keller, 1991
). This pathway must ultimately lead to cis elements important to the deflagellation response such as the enhancer identified here. A fuller understanding of the coordinate regulation of
flagellar assembly will require a more detailed analysis of transcriptional regulation with multiple genes, preferably genes encoding flagellar components that ultimately assemble in similar stoichiometric ratios.
| |
ACKNOWLEDGMENTS |
|---|
We thank Pete Lefebvre for providing the NIT1 gene, John Davies for ARS constructs, Jeff Schloss for the CBLP gene, Mike Lane for generous use of his scanner, and Bob West for reading the manuscript critically. Kim Brown provided valuable technical assistance. This work was supported by grant GM-44228 from the General Medical Sciences division of the National Institutes of Health (to D.R.M.).
| |
FOOTNOTES |
|---|
* Present Address: Department of Orthopedics, Johns Hopkins School of Medicine, 720 Rutland Avenue, Baltimore, MD 21205.
| |
REFERENCES |
|---|
|
|
|---|
nit2
strain.
Mol. Cell. Biol.
12, 5268-5279
2-tubulin gene after deflagellation and during the cell cycle.
Mol. Cell. Biol.
14, 5165-5174
2-tubulin promoter in Chlamydomonas reinhardtii.
Nucleic Acids Res.
20, 2959-2965
1-tubulin gene inductionn during regeneration of eukaryotic flagella.
Mol. Cell. Biol.
17, 3858-3866[Abstract].
-tubulin genes of Chlamydomonas reinhardtii code for identical proteins.
Mol. Cell Biol.
4, 2686-2696This article has been cited by other articles:
![]() |
G. Periz, D. Dharia, S. H. Miller, and L. R. Keller Flagellar Elongation and Gene Expression in Chlamydomonas reinhardtii Eukaryot. Cell, August 1, 2007; 6(8): 1411 - 1420. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Stark, D. L. Kirk, and R. Schmitt Two enhancers and one silencer located in the introns of regA control somatic cell differentiation in Volvox carteri Genes & Dev., June 1, 2001; 15(11): 1449 - 1460. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Lupold, A. G. F. S. Caoile, and D. B. Stern Genomic context influences the activity of maize mitochondrial cox2 promoters PNAS, September 28, 1999; 96(20): 11670 - 11675. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||