![]() |
|
|
Vol. 9, Issue 12, 3335-3349, December 1998
Department of Cell Biology, Emory University School of Medicine, Atlanta, Georgia 30322
Submitted July 17, 1998; Accepted September 21, 1998| |
ABSTRACT |
|---|
|
|
|---|
Previous structural and biochemical studies have revealed that the
inner arm dynein I1 is targeted and anchored to a unique site located
proximal to the first radial spoke in each 96-nm axoneme repeat on
flagellar doublet microtubules. To determine whether intermediate
chains mediate the positioning and docking of dynein complexes, we
cloned and characterized the 140-kDa intermediate chain (IC140) of the
I1 complex. Sequence and secondary structural analysis, with particular
emphasis on
-sheet organization, predicted that IC140 contains seven
WD repeats. Reexamination of other members of the dynein intermediate
chain family of WD proteins indicated that these polypeptides also bear
seven WD/
-sheet repeats arranged in the same pattern along each
intermediate chain protein. A polyclonal antibody was raised against a
53-kDa fusion protein derived from the C-terminal third of IC140. The
antibody is highly specific for IC140 and does not bind to other dynein
intermediate chains or proteins in Chlamydomonas
flagella. Immunofluorescent microscopy of Chlamydomonas
cells confirmed that IC140 is distributed along the length of both
flagellar axonemes. In vitro reconstitution experiments demonstrated
that the 53-kDa C-terminal fusion protein binds specifically to
axonemes lacking the I1 complex. Chemical cross-linking indicated that
IC140 is closely associated with a second intermediate chain in the I1
complex. These data suggest that IC140 contains domains responsible for
the assembly and docking of the I1 complex to the doublet microtubule cargo.
| |
INTRODUCTION |
|---|
|
|
|---|
Dyneins constitute a family of molecular motors responsible for
several different functions, including ciliary and flagellar motility,
minus end-directed transport of membrane-bound organelles, assembly of
the Golgi apparatus, and formation and function of the mitotic
apparatus. To perform these transport functions each dynein must be
correctly anchored to distinctive organelles, or "cargoes"
(Mitchell, 1994
; Witman et al., 1994
; Porter, 1996
). Although we know much about the composition and activity of dynein (reviewed in Holzbaur and Vallee, 1994
; Mitchell, 1994
; Porter, 1996
),
we know little about the protein-protein interactions involved in the
assembly and binding of dynein to its cargo. It has been proposed that
the dynein intermediate chain (IC) subunits play a central role in the
docking mechanism (King and Witman, 1990
; King et al., 1991
,
1995
).
The ICs were first identified as proteins that copurify with heavy
chains of the flagellar outer dynein arms (Mitchell, 1994
; Witman
et al., 1994
; Porter, 1996
). Subsequent biochemical analysis has revealed that IC subunits are also found in cytoplasmic (Holzbaur and Vallee, 1994
) and flagellar inner arm dyneins (Piperno et al., 1990
; Smith and Sale, 1991
, 1992
; Kagami and Kamiya, 1992
; Porter et al., 1992
). Based on the structure of isolated
flagellar outer arm dyneins and subfractionated dynein complexes, the
ICs were predicted to be located at the base of the dynein structure, at the site of attachment with the doublet microtubule cargo
(Goodenough and Heuser, 1983
; Sale et al, 1985
).
Immunoelectron microscopy of isolated dynein complexes supports this
predicted localization (King and Witman, 1990
: Steffen et
al., 1996
). Moreover, chemical cross-linking demonstrated that
IC78 from the outer dynein arm of Chlamydomonas flagella is
closely associated with
-tubulin of the doublet microtubule cargo
(King et al., 1991
). Analysis of mutant cells indicates that
the ICs are required for dynein assembly (Mitchell and Kang, 1991
;
Wilkerson et al., 1995
; Perrone et al., 1998
).
Sequence analysis revealed that many of the ICs form a family of
WD-repeat proteins, possibly indicating a common functional
substructure (Ogawa et al., 1995
; Wilkerson et
al., 1995
). Finally, indirect evidence also indicates that
cytoplasmic dynein is linked to organelles by ICs (Karki and Holzbaur,
1995
; Steffen et al., 1997
). Together, these data support
the hypothesis that IC subunits play a role in the positioning and
docking of different dyneins to specific cargoes. However, despite
these data, we know little about the precise functions and protein
interactions of the dynein ICs.
The inner row of dynein arms in the flagellar axoneme presents an ideal
system for studying the mechanism of cargo-dynein interaction.
Structural and biochemical analyses of wild-type and mutant axonemes
have established that the inner arm dyneins are heterogeneous in
composition and location along each doublet microtubule (reviewed in
Porter, 1996
). Current models suggest that the inner arms are organized
in precise groups, which repeat in a 96-nm pattern, in exact register
with the paired radial spokes (Goodenough and Heuser, 1984
; Piperno
et al., 1990
; Burgess et al., 1991
; Mastronarde
et al., 1992
; Porter et al., 1992
; Gardner et al., 1994
; Woolley, 1997
). Notably, in vitro
reconstitution of axonemes with isolated dyneins revealed that each
inner arm dynein is targeted and anchored to a unique position within
the 96-nm axoneme repeat (Smith and Sale, 1992
).
The I1 inner arm dynein complex offers several advantages for study of
dynein assembly. First, I1, like outer arm and cytoplasmic dynein, can
be isolated as a complex, composed of two heavy chains, three ICs
(IC140, IC138, and IC97) (IC97 is also referred as IC110 [Perrone
et al., 1998
, accompanying article]), and three light chains (Goodenough et al., 1987
; Piperno et al.,
1990
; Porter et al., 1992
; Harrison et al.,
1998
). Second, the I1 complex is defined by mutations in four loci
(Brokaw and Kamiya, 1987
; Piperno et al., 1990
; Kamiya
et al., 1991
; Porter et al., 1992
; Myster et al., 1997
; Perrone et al., 1998
).
Defects in any of these loci result in the failure to assemble the I1
complex in the axoneme. Structural analysis of I1 mutant axonemes
revealed that the complex is located in a proximal position in each
96-nm repeat unit (Goodenough and Heuser, 1984
; Piperno et
al., 1990
; Mastronarde et al., 1992
; Smith and Sale,
1992
; Porter et al., 1992
). Notably, the resulting gaps
located at 96-nm intervals indicate that each inner arm dynein can be
assembled and targeted independent of neighboring dyneins (Piperno
et al., 1990
). Finally, as described above, I1 can be reconstituted in vitro, precisely restoring I1 structure and function to the axoneme (Smith and Sale, 1992
).
Based on the hypothesis that the IC subunits play a role in targeted
assembly of dynein, we focused on studying IC140, one of the IC
subunits of the I1 complex. To determine whether IC140 plays a role in
I1 assembly and anchoring, we began by cloning IC140 with the dual
goals of characterizing its molecular structure and producing specific
reagents such as fusion proteins and antibodies. Sequence analysis,
with focus on
-sheet structure, revealed that IC140 contains seven
WD repeats arranged in an order similar to that of the seven
WD/
-sheet repeats predicted in other dynein ICs. We also report that
IC140 is located along the length of axonemes in both
Chlamydomonas flagella, consistent with conclusions based on
structural analysis of axonemes lacking the I1 structure (Piperno
et al., 1990
; Piperno and Ramanis, 1991
; Porter et
al., 1992
). Finally, based on in vitro reconstitution and chemical cross-linking, we suggest that IC140 plays a central role in the assembly and anchoring of the I1 complex. These predictions are supported by the observations of Perrone et al. (1998)
that
mutations in the IC140 gene block assembly of the I1 complex and that
transformation of these mutants with a wild-type copy of the IC140 gene
will rescue the assembly defect.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Strains
Cell strains were obtained from the Chlamydomonas
Genetics Center (Dr. E.H. Harris, Duke University, Durham, NC).
Wild-type CC-125 was used for preparation of DNA and RNA. Mutant
strains pf28 (Mitchell and Rosenbaum, 1985
) and
pf28pf30 (Piperno et al., 1990
) were used for
biochemical and cell biological experiments. The cell wall defective
mutant cw-15 was used for immunofluorescent staining. All
cells were grown in Tris-acetate-phosphate medium with aeration over a
14/10-h light/dark cycle (Witman, 1986
).
Purification of IC140
All reagents, unless stated otherwise, were from Sigma Chemical
(St. Louis, MO). For cloning IC140, our strategy was first to obtain
partial amino acid sequence from the isolated protein and then to
design degenerate primers for reverse transcription (RT)-PCR. Axonemes
were isolated from pf28 cells, and dynein extraction and
sucrose gradient fractionation were carried out as described previously
(Smith and Sale, 1992
). For sucrose gradients, the dynein-containing
extracts were first dialyzed into buffer A (10 mM HEPES, 5 mM
MgSO4, 1 mM DTT, 0.5 mM EDTA, 30 mM NaCl, 0.1 mM PMSF, 0.6 trypsin inhibitor units aprotinin, pH 7.4), followed by
sedimentation through 5-20% sucrose gradients prepared in buffer A. The I1 dynein fractions sedimenting between 18 and 21S were identified
by SDS-PAGE and silver staining and concentrated by centrifugation in
an Ultrafree-CL Polysulfone filter unit (Millipore, Bedford, MA). The
concentrated sample was resolved by 7% SDS-PAGE and then transferred
onto a polyvinylidene difluoride membrane (Applied Biosystems,
Foster City, CA) in 10 mM 3-[cyclohexylamino]-1-propane sulfonic acid/10% methanol, pH 11. The IC140 band was detected on the
membrane by Amido Black staining (0.1% in 1% acetic acid/40% methanol), excised, and shipped to Dr. J. Leszyk (University of Massachusetts, Worcester, MA; formerly the Worcester Foundation for
Experimental Biology) for peptide microsequencing. Briefly, the
membrane bearing the IC140 protein was exposed to endoproteinase lys-C,
and the resulting peptides were eluted and fractionated by HPLC. Three
peak fractions were selected and sequenced with an Applied Biosystems
Procise Sequencer (see Table 1).
Molecular Biology
For cloning, total RNA was derived from cells before (control)
or 45 min after deflagellation, a process that up-regulates the
transcription of many flagellar genes (Lefebvre and Rosenbaum, 1986
).
Genomic DNA was prepared as described (Wilkerson et al., 1994
). Poly(A) RNA was further purified with oligo(dT) cellulose (Collaborative Biochemical Products, Bedford, MA) following the methods
of Schnell and Lefebvre (1993)
. Primers for RT-PCR used for various
cloning steps (Figure 1) include P1S
(CGCGGAATTCATGACIGACACICARTTY), P3A
(CGCGGGATCCAISWICCIGCRTARAACAT), RT1
(TTGCCCTTCTTCAGCAGCTTCTCA), Cr5
(GCGTGTCCGTCATGAATCGGTGCTT), FUS
(CGCTACCAGAGGACTACGTG), FUSrev (CGTAGTCCTCTGGTAGCG), and
T3 (CTCCTTGCTAGGGATCTG).
RT was primed either with oligo(dT)12-18 (Pharmacia
Biotech, Piscataway, NJ) or with the gene-specific primers (RT1) using
the reverse transcriptase Superscript II (Life Technologies, Gaithersburg, MD) according to the manufacturer's instructions. Each
50-µl PCR reaction contained 0.5 µl RT mixture, 0.2 mM dNTP, a 0.2 µM concentration of each primer (2 µM for degenerate primers), 2.5 U Taq or 1.25 U Pfu DNA polymerase (Strategene,
La Jolla, CA) and 1× manufacturer-provided buffer. The PCR mixture was
initially denatured at 95°C for 3 min, followed by 35 cycles of
95°C, 1.5 min, 48-50°C, 1.5 min, and 72°C, 3 min. The reaction
mixture was maintained at 72°C for an additional 10 min, followed by
separation of products in 0.8-1% agarose (Fisher Scientific,
Pittsburgh, PA). Notably, after extensive experimentation and numerous
primers, we found that RT-PCR, using the gene-specific primer RT1, was optimal when dGTP was replaced with 7-deaza-2'-dGTP/dGTP (3:1; see
Innis, 1990
) and that the sample was treated with RNAse H after reverse
transcription. These steps resulted in the 1.55-kb RT-PCR product known
as pC2. The bands of interest were excised and spun through siliconized
glass wool. The DNA in the flow through was extracted with
phenol-chloroform and precipitated with ethanol. Most purified PCR
products were then blunt end cloned into the SmaI site of
pBluescript II KS(
). The 350-bp product primed with P1S/P3A was
cloned into the EcoRI and BamHI sites.
Library Screening
To obtain cDNA clones containing IC140 sequence, we screened a
zapII cDNA library, made from RNA derived from cells regenerating flagella (kindly provided by K. Wilkerson and G. Witman, University of
Massachusetts; Wilkerson et al., 1995
). To obtain genomic
clones containing IC140 sequence, a
fixII genomic library,
constructed from strain A54-e18, was screened (kindly provided by E. Smith and P. Lefebvre, University of Minnesota, Minneapolis, MN; Smith and Lefebvre, 1997
). For screening, libraries were plated and transferred to Hybond N filters (Amersham International,
Buckinghamshire, UK), followed by UV cross-linking with
Strata-linker (Strategene). Positive clones were identified by
hybridizing the filters with the [P32]dCTP-labeled,
random-primed probes using the 350-bp PCR product as a template and
were incubated at 65°C overnight in buffer (1% BSA, 1 mM. EDTA, 0.5 M sodium phosphate buffer, pH 7.5, 7% SDS). The membranes were then
washed once at 65°C with 2× SSC/0.1% SDS and three times with 0.2×
SSC/0.1% SDS for 20 min each. The cDNA clones from purified plaques
were excised with helper phage (Wilkerson et al., 1995
). The
1.6-kb insert of cDNA clone pC1 (Figure 1) was released with
EcoRI and XhoI and further digested to a 1-kb 5'
fragment, containing the coding sequence, and a 0.6-kb 3' fragment. The
1-kb fragment was subcloned and used as a probe for Northern and
Southern blots. The inserts from genomic clones were released from
phage vector by XbaI digestion and ligated into pBluescript II KS(
). The XbaI genomic clone was further digested with
SalI and NotI and subcloned into pBluescript II
KS(
) to further facilitate sequencing.
Southern and Northern Blots
For Southern analysis, genomic DNA (5 µg) was digested with restriction endonucleases, fractionated in 0.8% agarose gels, and transferred to a Nytran membrane following the manufacturer's instructions (Schleicher & Schuell, Keene, NH). For Northern analysis, poly(A) RNA (3 µg) was fractionated in 1.2% formamide-containing gels and transferred to Hybond N+ filters (Amersham). Membranes were probed with the 1-kb EcoRI-NotI fragment of pC1 (Figure 1) using the procedures described for library membrane lifts.
Fusion Protein and Antibody Production
The 1.6-kb insert from the pC1 cDNA clone was released by
EcoRI and XhoI and ligated, in frame, into
pET28(a) expression vector (Novagen, Madison, WI). The expression
construct was transformed into Escherichia coli strain
BL21(DE3) (Novagen). Production of the N-terminal His-tagged fusion
protein was induced by 100 mM isopropyl-1-thio-
-D-galactopyranoside, and
proteins contained within the inclusion body were solublized in the 6 M
urea/imidazole buffer designed for Ni+ column affinity
purification and according to the manufacturer's instructions
(Novagen). The eluent was slowly dialyzed against PBS (without pressure
or stirring) for 20 h. Most of the purified fusion protein was
soluble and used as an antigen to produce polyclonal antibodies in
rabbits (Spring Valley Laboratories, Sykesville, MD). For Western
blots, samples were separated in SDS-PAGE followed by Coomassie
blue staining or transferred to a nitrocellulose membrane
(Bio-Rad, Hercules, CA) for immunoblot. The membrane was
blocked with 5% nonfat dry milk followed by incubation first with
anti-IC140 antibody (1:3000-1:6000 dilution) and then with HRP-conjugated goat anti-rabbit secondary antibody (1:5000, Bio-Rad). The antibody reactivity was detected with 4-chloro-1-naphthal and
hydrogen peroxide or with enhanced chemiluminescent reagents (Amersham). M. Porter and S. Myster (University of Minnesota) generously provided the antibody to the 1-
heavy chain of inner arm
dynein I1 (Myster et al., 1997
).
DNA Sequencing and Sequence Analysis
Sequencing of both strands was carried out manually using
dideoxy methods with a Sequenase II kit (United States Biochemicals, Cleveland, OH) or in most cases by automated cycle sequencer (ABI 377, Applied Biosystems). Sequence was analyzed using programs from
Wisconsin Sequence Analysis Package Incremental Release 8.1 (Genetics
Computer Group, Madison, WI). Programs used include CodonPreference to
reveal regions of codon bias in genomic sequences, Findpattern to
identify the consensus sequence for exon-intron junctions
(/GAXXGX . . . . . . . CAG/, kindly provided by C. Silflow, University of Minnesota), COMPARE for comparing pairs of dynein IC
sequences (window, 30; stringency, 18), PileUp for plotting dendrograms, BLAST to search for homologous molecules (Altschul et al., 1990
), Motifs to identify WD repeats, and
PeptideStructure for predicting the secondary structure. Coiled-coil
structures were predicted using the Coils program (Lupas et
al., 1991
) (with the MTIDK matrix and a window of 21) from Pedros
Biomolecular Research Tools
(www.public.iastate.edu/~pedro/research_ tools.html). For
analysis, default parameters were used unless stated otherwise.
Immunolocalization
Immunofluorescent staining was carried out as described (Johnson
and Rosenbaum, 1992
) with modification. The cell wall-deficient cells
were allowed to attach to the Nalge-Nunc Permanox chamber slide (Fisher
Scientific). Immobilized cells were fixed by immersion in
20°C
methanol for 10 min, followed by immersion in a blocking buffer
composed of 3% BSA in PBS at room temperature. Slides were incubated
with either preimmune serum or the anti-IC140 polyclonal antibody,
diluted 1:1000 in 1% BSA/PBS, overnight at 4°C, and FITC-conjugated
goat anti-rabbit antibody 1:500 (Cappel/INC Pharmaceuticals, Costa
Mesa, CA) in 1% BSA/PBS for 2 h. The images were captured by a
Zeiss (Thornwood, NY) epifluorescent microscope equipped with an
air-cooled charge-coupled device camera (CCD300T; Dage-MTI, Michigan
City, IN).
Fusion Protein-Doublet Microtubule Binding Assay
Axonemes from pf28 and pf28pf30 were
prepared as described (Smith and Sale, 1992
). Axonemal and fusion
protein concentration was determined with the Bradford assay (Bio-Rad).
The mixture of 2 mg/ml axonemes in buffer A and 15-150 ng fusion
protein in a total volume of 100 µl was incubated on ice or at 22°C
for 30 min. After dilution with 1.5 ml buffer A, axonemes were
sedimented, and the pellet was resuspended with 100 µl buffer A for
SDS-PAGE and Western blots.
For cross-linking, axonemes (2-5 mg/ml) and dynein extract were
prepared in buffer A but in the absence of DTT and protease inhibitors.
Cross-linking was carried out as described (King et al.,
1991
) by incubating axonemes or dynein extract with 1-10 mM
1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC;
Pierce, Rockford, IL) for 1 h at room temperature and was terminated with at least a 10-fold molar excess of
-mercaptoethanol. For sucrose gradient sedimentation, the cross-linked axonemes were
further extracted with 0.6 M NaCl/buffer A, and the extract was
sedimented through a 5-20% sucrose gradient made with buffer A. Fractions were analyzed by SDS-PAGE and Western blots.
| |
RESULTS |
|---|
|
|
|---|
Cloning of IC140
To clone and analyze the IC140 gene, our strategy was to obtain partial protein sequences from purified IC140 (Table 1), design oligonucleotide primers for RT-PCR (Figure 1), and use the product for screening libraries and for Southern and Northern analysis (Figure 2). IC140 was purified by a combination of velocity sedimentation fractionation of the dynein extract on sucrose gradients followed by SDS-PAGE and transfer to polyvinylidene difluoride membranes. We found that the N terminus of the band-purified IC140 was naturally or experimentally blocked to the Edman degradation reaction. Therefore, internal amino acid sequence was obtained by digestion of IC140 with endoproteinase lys-C, followed by fractionation of peptides by HPLC. The sequences of three peptides are listed in Table 1.
|
|
|
Sense and antisense degenerate oligonucleotides P1S and P3A, listed in
MATERIALS AND METHODS, were designed based on the amino acids
underlined in Table 1. RT-PCR with this primer pair resulted in a
single 350-bp band (Figures 1 and 3,
nucleotides 4048-4962). The 350-bp PCR product was cloned and
sequenced. The predicted amino acid sequence, flanking the primers, was
identical to the amino acid sequence obtained from microsequencing,
with the sole exception that VVTT in peptide 1 (Table 1) was later
confirmed to be VVTD (Figure 3, amino acids 638-641) based on the cDNA
and genomic sequence. The predicted peptide sequence (Figure 3, amino acids 628-741) is novel but homologous to the "C"-WD repeat
described in other dynein ICs (Ogawa, et al., 1995
),
suggesting that the 350-bp clone derived from IC140 represented a new
member of the dynein IC family.
|
The 350-bp PCR product was used to screen a
zapII cDNA library
constructed from RNA obtained from Chlamydomonas cells after deflagellation (Wilkerson et al., 1995
). Three identical
1.6-kb cDNA clones were recovered and are represented as pC1 in Figure 1 and nucleotides 4027-6814 in Figure 3. The pC1 sequence extended 9 bp beyond the PCR product in the 5' direction, contained a poly(A) tail, and, based on the predicted amino acid sequence, contained peptide 2 near the 3' end of the cDNA clone (Figure 3, amino acids 965-982). Based on these results, the 1.6-kb cDNA pC1 represents part
of the IC140 message.
Southern blots of genomic DNA, digested with four different restriction
enzymes (indicated in Figure 2A) and probed with the 1-kb fragment of
pC1, revealed only a single band of similar intensity for each enzyme.
Given that there were no restriction sites for these enzymes within the
1-kb probe, these data suggest that there is a single gene coding for
IC140. Northern blot analysis of poly(A) RNA from
Chlamydomonas revealed a single 3.7-kb transcript coding for
IC140 (Figure 2B), which was up-regulated 30-45 min after deflagellation (Figure 2B, lane a), as expected for a message that
encodes a protein with a flagellar-specific function (Silflow and
Rosenbaum, 1981
; Le-febvre and Rosenbaum, 1986
).
Rescreening the cDNA library and 5' rapid amplification of cDNA ends
both failed to yield additional clones at the 5' end of IC140.
Therefore, we chose to obtain the genomic clone of IC140 to complete
the sequence. Screening a
fixII genomic library (Smith and Lefebvre,
1997
) with the 1-kb fragment of pC1 as a probe resulted in the recovery
of 10 overlapping clones (17-22 kb each) covering a total of 30 kb of
genomic sequence. Seven of the clones were distinct, and, after
restriction mapping and analysis, a detailed map of the genomic clones
was constructed. Southern blot analysis of the genomic clones using the
1-kb 5' and 0.6-kb 3' fragments of pC1 (Figure 1) as probes identified
the 5' end of the IC140 gene and resulted in recovery of an 11.5-kb
XbaI clone (Figure 1). The 11.5-kb XbaI clone
contains pC1, and, as described in the accompanying article, the clone
rescues a Chlamydomonas mutant strain, which fails to
assemble inner arm I1 because of a deletion mutation in the IC140 gene
(Perrone et al., 1998
). Both strands of the XbaI
subclone were therefore sequenced. As predicted, the entire pC1
sequence was located close to the 3' terminus of the XbaI
genomic subclone (Figure 3).
To identify the coding sequence, we took advantage of two properties of
Chlamydomonas nuclear genes. First, most protein-coding sequences in nuclear genes are strongly biased toward G/C, particularly at the third position of each codon (LeDizet and Piperno,
1995). Therefore, the three reading frames of genomic and
pC1 sequences were analyzed with CodonPreference using a codon
frequency table based on the Chlamydomonas outer arm
-heavy chain coding sequence as a standard (Mitchell and Brown,
1994
; Wilkerson et al., 1994
). In theory, the exons of the
gene showing strong codon bias would be located at the codon bias peak.
As predicted, the coding sequence of pC1 showed strong codon bias and
corresponded to the codon-biased peaks of the genomic sequence.
In contrast, the 3' untranslated region and introns are not biased.
Second, a consensus sequence (5'-/GTXXGX ... CAG/-3') for
Chlamydomonas exon-intron-exon junctions has been compiled
(Silflow, University of Minnesota, unpublished data). As predicted,
each codon-biased peak within the region coding for the pC1 sequence
was flanked by the exon-intron consensus sequence. Therefore the
codon-biased peaks flanked by the consensus sequence using Findpattern
were identified as potential exons throughout the gene.
Several sense primers located within the hypothetical exons were designed, and after two additional RT-PCR steps (illustrated in Figure 1), the 1.55-kb clone pC2 and the 550-bp clone pC3 were obtained. The pC2 clone contained the second to the seventh exons, and the pC3 clone contained the first two exons, resulting in recovery of the 5' untranslated region and the first ATG, which was preceded by a stop codon TGA 18 bp upstream (Figure 3, 962) in the first exon. The genomic sequence along with the predicted exons and amino acid sequence for IC140 are shown in Figure 3.
Sequence Analysis
The IC140 gene consists of 14 exons interrupted by 13 introns
illustrated in Figures 1 and 3. The sequences at the exon-intron junction (Figure 3) completely conform to those from most known Chlamydomonas nuclear genes. In addition to several
stretches of AT-rich segments, a number of "tub box" sequences were
found upstream of the transcription initiation site (Figure 3). It was proposed that the tub box (GCTC[G/C]AAGGC) is involved in the regulation of tubulin transcript during flagellar regeneration and
during the cell cycle (Davis and Grossman, 1994
). The presence of tub
boxes is consistent with the up-regulation of the IC140 transcript
after deflagellation as shown by Northern blot (Perrone et
al., 1998
).
The 3072-bp open reading frame predicts a protein of 1024 amino acids
with a mass 110 kDa and a pI of 4.68 (Figure 3). Similar differences
between predicted and measured size were also reported for other
axonemal proteins (LeDizet and Piperno, 1995
; Ogawa et al.,
1995
; Koutoulis et al., 1997
). However, this difference is
probably not due to phosphorylation (Habermacher and Sale, 1997
). The N-terminal 125 amino acids of IC140 are particularly rich in G and A (44%), D and E (28%), and P (16%). No basic residues are found in this region. As expected, the top of the list of the
homologous proteins revealed by BLAST search includes dynein IC family
members (smallest sum probability ranging from 4.4 × 10
31 to 1.2 × 10
10). The homologous
regions between the ICs, summarized as a dot plot in Figure
4A, are primarily located around and
within a set of WD-repeat motifs common to the ICs studied to date
(Ogawa et al., 1995
; Wilkerson et al., 1995
).
Analysis from BLAST search, Compare (Figure 4A, dot plot), and PileUp
(Figure 4B, dendrogram) suggests that IC140 is most closely related to
sea urchin IC3 and Chlamydomonas IC69 of the outer dynein
arm (Mitchell and Kang, 1991
; Ogawa et al., 1995
). Motif
search and initial visual evaluation revealed five WD repeats in the
middle of IC140 (Figure 3, amino acids 461-842). However, closer
examination revealed two additional WD repeats, C' and E' (Figure
5, A and B). This assignment of WD
repeats is based on the predicted
-sheet position, on the consensus
sequence for the WD repeat, and on homologous sequences within the IC
family. Based on this new analysis it is possible to assign seven
WD/
-sheet repeats in each dynein IC family member, as summarized in
Figure 5 (see DISCUSSION). (IC140, IC69, IC78, and IC2 were selected
because these four ICs represent distinct classes of IC.) Notably, the
WD repeats of the ICs shown in Figure 5B are located in relatively
similar positions. One exception is an unusually long variable region
of 100 amino acid (aa) residues between the B and C repeats of IC140
(Figure 5B). The variable regions of WD-repeat proteins identified so
far consist of 6-94 residues (Neer et al., 1994
). Several
observations indicate that the long stretch of aa is not a cloning
artifact. First, the seventh exon, which contains A and B WD repeats
and an 87-aa variable region, is predicted as a continuous strong
condon-biased peak. Second, there are no consensus sequences for
intron-exon junctions between the B repeat and the end of the seventh
exon. Furthermore, the independently recovered pC1 and pC2 overlap and
are identical at the 3' end of the seventh exon. The functional
significance of this region remains to be tested.
|
|
The regions outside of the WD repeats are mainly composed of
-helices and turns. Analysis with the Coils program predicts two
juxtaposed coiled coils (99 and 60% propensity with a window size of
28) in the C terminus (Figure 3, approximately amino acids 920-1020).
With the exceptions of IC78 and IC2, the coiled-coil structure is also
found in the other IC members, including the C terminus of IC69, IC3,
and the N-terminus of IC2C, a cytoplasmic dynein homologue (Figure 5B;
see Mitchell and Kang, 1991
; Paschal et al., 1992
; Ogawa
et al., 1995
; Wilkerson et al., 1995
).
Binding of IC140 to the Axoneme
To explore the function of IC140, fusion protein and antibody
probes were produced. A N-terminally 6-His tagged 53-kDa fusion protein
was overexpressed in E. coli strain BL21(DE3). The cells were transformed with a pET28 (a) expression vector containing the
1.6-kb cDNA from pC1 (Figure 1), inserted in frame. This construct contains the C-E' WD repeats and the C terminus (Figure 5B). The fusion protein was purified on an Ni+ column and used to
raise polyclonal antibodies and for the microtubule binding assays
described below. A rabbit polyclonal antibody specifically recognized
IC140 on Western blots of isolated dynein I1 (Figure 6A) or isolated flagella and axonemes
(Figure 6, A and B). In contrast, the antibody failed to recognize
IC138 from the I1 complex (Figure 6B), confirming that IC138 and IC140
are distinct proteins (Habermacher and Sale, 1997
; King and Dutcher,
1997
). Immunofluorescent staining, using the IC140 antibody, revealed
an even distribution of IC140 along the length of both flagellar
axonemes in wild-type Chlamydomonas (Figure 6A, inset). The
preimmune serum failed to stain IC140 on immunoblots or by
immunoflorescence. Western blots of flagella or axonemes from mutant
cells lacking the outer dynein arms, radial spoke heads, central pair
apparatus, or the mbo2 gene product were indistinguishable
from wild type (Figure 6C, oda1, pf17, and
mbo2). In contrast, immunoreactivity is detectable but
greatly reduced in Western blots of whole axonemes from two strains
that fail to assemble the I1 complex (Figure 6C, pf9-3 or
pf28pf30) using either colorimetric or enhanced
chemiluminescence developing reagents (see MATERIALS AND METHODS). In
identical blots, immunoreactivity is completely absent in axonemes from ida7, an I1 mutant defective in the gene for IC140 (see
Perrone et al., 1998
). The low level of IC140 in
pf9-3 and pf28pf30, mutants shown to be defective
in an HC gene of I1 (Myster et al., 1997
), indicates that
IC140 can partially assemble independent of other I1 subunits,
consistent with a role for IC140 in anchoring the I1 complex to the
doublet microtubule cargo.
|
To further test this hypothesis, we examined whether the purified IC140
fusion protein would bind axonemes. The prediction was that the fusion
protein would bind doublet microtubules but only in the absence of
endogenous I1 complex, when the presumed I1 anchor would be exposed.
Axonemes were isolated from either control cells (pf28,
lacking the outer dynein arms but bearing the full compliment of inner
dynein arms) or experimental, double mutant cells (pf28pf30,
lacking both the outer dynein arms as well as the I1 complex: see Smith
and Sale, 1992
) and mixed with the 53-kDa fusion protein. After
reconstitution, the fusion protein specifically sediments with axonemes
derived from pf28pf30 (Figure 7). In contrast, little fusion protein
binds to axonemes derived from pf28 (Figure 7). Rebinding is
not affected by the addition of 1 mM ATP. This result suggests that
IC140 is capable of binding directly to the microtubule cargo and may
be involved in anchoring the I1 complex to the doublet microtubule. The
result also indicates that at least one IC140 domain, responsible for
binding, is located within the C-terminal 53 kDa (see Perrone et
al., 1998
).
|
Cross-linking of IC140 to a Second IC of I1
Cross-linking experiments using the zero length cross-linker EDC
were performed in an attempt to identify the putative axonemal docking
protein to which IC140 binds and to define interacting proteins within
the I1 complex (see King et al., 1991
; Koutoulis et
al., 1997
). Western blot analysis of both axonemes and dynein extract after exposure to increasing concentration of EDC revealed a
new band migrating at 240 kDa, suggesting that IC140 interacts with a
salt-extractable axonemal protein of ~100 kDa (Figure
8A). For these experiments, axonemes were
derived from pf28, lacking the outer dynein arms. However,
similar results were obtained using wild-type, pf14, and
pf2 cells. We hypothesized the ~100 kDa protein
cross-linked to IC140 is IC97 of the I1 complex. We therefore predicted
the 240-kDa cross-linked protein complex would be found in the 19S I1
fraction after salt extraction. To test this, EDC-treated
pf28 axonemes were extracted with 0.6 M NaCl/buffer A, and
the extract was fractionated by zonal centrifugation using 5-20%
sucrose gradients. As predicted, the 240-kDa protein in the
cross-linked axoneme was salt extractable and present solely in the I1
fraction (Figure 8A), just as IC140 is present solely in the I1
fraction in the control samples (Figure 8B). The results are consistent
with a model in which IC140 is closely associated with one of the other
ICs in the I1 complex.
|
| |
DISCUSSION |
|---|
|
|
|---|
Isolation of the Gene for IC140
We have recovered the complete genomic and cDNA sequence for
IC140 (Figure 3). The basis for this conclusion is founded on a number
of independent experiments. First, using DNA-mediated transformation,
an 11.5-kb genomic clone rescues a Chlamydomonas mutant
lacking the gene for IC140 (see Perrone et al., 1998
). Second, the net combined sequences of pC1, pC2, and pC3 (Figure 1)
total 3.7 kb, the size predicted from the Northern blots (Figure 2).
Because pC1 was derived from a cDNA library, and the
RT-PCR clones pC3 and pC2 contain multiple predicted exons, the clones represent the complete mRNA of IC140. Third, through a combination of
primer extension and sequencing, the transcription initiation site
(only 24 bp upstream of the pC3) was identified (Figure 3, nucleotide
750; see Perrone et al., 1998
). Consistent with this result,
probes made from the 290-bp XhoI fragment (nucleotides 415-710), which is 5' of the transcription initiation site, failed to
reveal any message. Fourth, the open reading frame predicts a protein
of 1024 aa that contains the three peptide sequences obtained by direct
protein sequencing (compare sequences in Table 1 and bold letters
Figure 3). Finally, a monospecific antibody against a 53-kDa fusion
protein constructed with the pC1 insert specifically recognizes IC140
by Western blot analysis.
Structural Domains in IC140: IC140 Is a WD-Repeat Protein
The structural basis for the assembly and docking of dynein is not
known. However, sequence and secondary structural predictions for the
IC proteins have shown that each is a member of the WD-repeat family of
proteins, implying functional homology among the ICs (Paschal et
al., 1992
; Ogawa et al., 1995
; Wilkerson et
al., 1995
). WD-repeat proteins were originally defined based on a
repeating module of approximately defined size that begins with a GH
and ends with WD, or respective equivalent residues (van der Voorn and
Ploegh, 1992
; Neer et al., 1994
). In each case the module repeats four to eight times, suggesting that multiple adjacent WD
modules are required for protein stability and function. The structural
predictions for WD-repeat proteins have been confirmed by the crystal
structure of the
subunit of G protein (Wall et al.,
1995
; Lambright et al., 1996
; Sondek et al.,
1996
). Crystallography reveals that G
folds into a
circular sevenfold
-sheet "propeller." Each blade consists of
four antiparallel
-strands. However, similar
-propeller
structures have also been discovered from non-WD-repeat proteins
consisting of repeated
-sheet structures (Faber et al., 1995
; Neer and Smith, 1996
), suggesting that the consensus expression for defining a WD-repeat protein is insufficient to identify the less
conserved repeats predicted to have the similar
-sheet structure.
Based on a WD-repeat consensus sequence and homology among the ICs,
Wilkerson et al., (1995)
and Ogawa et al., (1995)
clearly established that the ICs are WD-repeat proteins. However, many repeats vary considerably from the consensus expression (for example, A
and C repeats of IC78; Figure 5A). Therefore, to assign the WD repeats
in IC140, we compared WD-repeat regions with the predicted
-sheet
structure and the homologous regions of the ICs. We discovered that on
this basis each dynein IC contains seven repeated structures, including
newly identified C' and E' repeats. The C' and E' repeats are located
in homologous positions among the ICs. Thus, repeating WD/
-sheet
units at equivalent positions in different proteins are more similar to
each other than to other repeating units within a protein (Figure 5A).
For example, the C repeat is more similar to the C repeat between ICs
than to other repeats in the same protein, suggesting each repeat
serves a conserved function. The simplest model is that each dynein IC
contains seven WD/
-sheet repeats, which are likely to be arranged in
a sevenfold
-sheet propeller, similar to that described in
G
.
Another region of conserved structure is the predicted coiled coil
present in the C termini of IC140 and IC69 (Figure 5), suggesting a
common role. For example, deletion of the C-terminal coiled coil in
IC69 resulted in failure to rescue Oda6 (Mitchell, personal
communication). We demonstrate here that the fusion protein containing
the last five WD repeats and the coiled coil of IC140 specifically
bound the axonemes missing I1, suggesting at least part of the
targeting domain for I1 is located in the C-terminal region of IC140.
Moreover, the N-terminal coiled coils of IC74 are critical for
interaction between dynein and dynactin (Vaughan and Vallee, 1995
;
Burkhardt et al., 1997
; Steffen et al., 1997
). Because the sheets within the propeller are not necessarily accessible, one plausible region for anchoring could be the coiled coil and/or the
loops and variable regions between the WD repeats. The structure outside the WD/
-sheet repeats is predicted to primarily form
-helices and turns. Thus, BLAST searches have identified homology between IC140 and filamentous proteins such as collagen, fibroin, and
intermediate filament protein. There may be little significance to
these homologies.
Function of IC140
Our primary goal was to test the hypothesis that IC140 anchors the
I1 complex to the doublet microtubule, targeting I1 proximal to the
first radial spoke. Evidence from two independent experiments is
consistent with this hypothesis. First, using an in vitro binding assay
we demonstrated that the purified IC140 fusion protein specifically binds to pf28pf30 axonemes, which lack the I1 complex
(Figure 7). In contrast, pf28 axonemes, which contain the I1
complex, bind greatly reduced amounts of the fusion protein. The
simplest interpretation is that I1 is anchored through interaction of
IC140 with the doublet microtubule. Second, low levels of IC140 are assembled, in vivo, onto axonemes derived from other I1 mutants defective in the heavy-chain genes (Figure 6C; also see Myster et
al., 1997
). The interpretation is that IC140 can be transported and anchored to the axoneme in the absence of assembly of other I1
components. This result is also consistent with a model that IC140
anchors I1 to the microtubule cargo. We therefore predicted that in
using in vitro binding experiments the IC140 fusion protein would
compete with the isolated I1 complex for binding to pf28pf30 axonemes. However, in preliminary reconstitution experiments, the IC140
fusion protein failed to block the rebinding of the I1 complex.
Evidently isolated I1 has a higher affinity than the fusion protein.
However the significance of this negative result is unknown.
The observation that IC140 preferentially binds to axonemes derived
from pf28pf30 cells supports the hypothesis that IC140 binds
to a docking complex, which specifically anchors and positions the I1
complex to the doublet microtubules. Unlike the outer dynein arms,
which can bind both axonemal and brain microtubules (Haimo et
al., 1979
) and can be cross-linked to tubulin (King et
al., 1991
), the I1 complex does not appear to be directly
associated with tubulin. For example, in vitro reconstitution studies
demonstrated that isolated I1 would bind to purified, single
microtubules, but that binding was prevented in the presence of MgATP
(Smith and Sale, 1991
). Evidently, the isolated I1 complex does not
bind the microtubule by an ATP-insensitive anchoring mechanism. In contrast, purified I1 bound specifically to axonemes, and ATP did not
interrupt binding (Smith and Sale, 1992
). Sequence analysis demonstrates that IC140 contains no homology to the microtubule binding
domains of structural MAPs such as tau, MAP2, and MAP4 (reviewed in
Chapin and Bulinski, 1992
). Finally, unlike IC78 of outer arm dynein,
we did not find that IC140 could be cross-linked to tubulin (Yang and
Sale, unpublished results). Therefore, it is not likely that IC140
binds directly to tubulin.
To attempt to directly identify the axonemal protein that anchors I1,
we adopted a chemical cross-linking approach. This approach has been
used successfully to identify protein-protein interactions in outer
arm dynein and radial spokes (King et al., 1991
; Diener et al., 1993
). However, despite working with two
cross-linkers, applying multiple conditions, and taking
advantage of a number of Chlamydomonas flagellar mutants, we
have failed to identify candidate anchor proteins interacting with
IC140. However, we demonstrated that treatment of isolated axonemes
with the zero-length cross-linker EDC resulted in a new 240-kDa band
that contained IC140 (Figure 8). The simplest explanation for this
result is that IC140 was cross-linked to an axonemal protein of ~100
kDa, and obvious candidates included the other ICs of the I1 complex. To test this, the I1 complex was purified after treatment of isolated axonemes with EDC, and as predicted, the 240-kDa cross-link product is
located in the I1 complex only (Figure 8B). Based solely on mass,
measured by SDS-PAGE, the simplest interpretation of these data is that
IC140 is cross-linked to IC97. However, we cannot yet rule out the
possibility that the 240-kDa product is a product of cross-linking
IC140 and IC138.
Assuming IC140 and IC97 are closely associated in the I1 complex, it is
possible they play a role similar to that of IC69 and IC78 in the outer
dynein arm in Chlamydomonas flagella. The basis for
predicting that IC140 and IC69 serve related roles includes sequence
homology between IC140 and IC69 and C-terminal coiled-coil and related
cross-linking studies of the outer dynein arm (King et al.,
1991
). Our model is that IC140, like IC69, bears a scaffold of multiple
domains responsible for interactions with the docking complex and other
subunits of the dynein complex. With the discovery of a null mutant for
IC140 (Perrone et al., 1998
), it is possible to test this
model by DNA-mediated transformation using modified IC140 constructs.
| |
ACKNOWLEDGMENTS |
|---|
We are grateful to Drs. M. Porter and C. Perrone (University of
Minnesota) for helpful suggestions and for our collaboration. We are
also thankful to Drs. C. Wilkerson and G. Witman (Worcester Foundation/University of Massachusetts) and E. Smith and P. Lefebvre (University of Minnesota) for providing the cDNA and genomic libraries and advice for cloning. Drs. S. Myster and M. Porter (University of
Minnesota) generously contributed the 1-
heavy-chain antiserum. Drs.
D. Mitchell (State University New York), S. L'Hernault, L. Quarmby,
and G. Benian (Emory University) contributed valuable suggestions. This
work was supported by grants from the National Institute of General
Medical Sciences, National Institutes of Health.
| |
FOOTNOTES |
|---|
* Corresponding author. E-mail address: win{at}cellbio.emory.edu.
| |
REFERENCES |
|---|
|
|
|---|
2-tubulin gene after deflagellation and during the cell cycle.
Mol. Cell. Biol.
14, 5165-5174
-tubulin in situ.
J. Biol. Chem.
266, 8401-8407
dimer at 2.1 Å resolution.
Nature
379, 369-374[Medline].
1Gi
a1
1
2.
Cell
83, 1047-1058[Medline].
heavy chain of Chlamydomonas flagellar outer arm dynein.
J. Cell Sci.
107, 497-506[Abstract].This article has been cited by other articles:
![]() |
M. Wirschell, C. Yang, P. Yang, L. Fox, H.-a. Yanagisawa, R. Kamiya, G. B. Witman, M. E. Porter, and W. S. Sale IC97 Is a Novel Intermediate Chain of I1 Dynein That Interacts with Tubulin and Regulates Interdoublet Sliding Mol. Biol. Cell, July 1, 2009; 20(13): 3044 - 3054. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Bower, K. VanderWaal, E. O'Toole, L. Fox, C. Perrone, J. Mueller, M. Wirschell, R. Kamiya, W. S. Sale, and M. E. Porter IC138 Defines a Subdomain at the Base of the I1 Dynein That Regulates Microtubule Sliding and Flagellar Motility Mol. Biol. Cell, July 1, 2009; 20(13): 3055 - 3063. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Yang, H. A. Owen, and P. Yang Dimeric heat shock protein 40 binds radial spokes for generating coupled power strokes and recovery strokes of 9 + 2 flagella J. Cell Biol., January 28, 2008; 180(2): 403 - 415. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Lonergan, R. Chari, R. J. deLeeuw, A. Shadeo, B. Chi, M.-S. Tsao, S. Jones, M. Marra, V. Ling, R. Ng, et al. Identification of Novel Lung Genes in Bronchial Epithelium by Serial Analysis of Gene Expression Am. J. Respir. Cell Mol. Biol., December 1, 2006; 35(6): 651 - 661. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Yang, M. M. Compton, and P. Yang Dimeric Novel HSP40 Is Incorporated into the Radial Spoke Complex during the Assembly Process in Flagella Mol. Biol. Cell, February 1, 2005; 16(2): 637 - 648. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. W. Hendrickson, C. A. Perrone, P. Griffin, K. Wuichet, J. Mueller, P. Yang, M. E. Porter, and W. S. Sale IC138 Is a WD-Repeat Dynein Intermediate Chain Required for Light Chain Assembly and Regulation of Flagellar Bending Mol. Biol. Cell, December 1, 2004; 15(12): 5431 - 5442. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. DiBella, M. Sakato, R. S. Patel-King, G. J. Pazour, and S. M. King The LC7 Light Chains of Chlamydomonas Flagellar Dyneins Interact with Components Required for Both Motor Assembly and Regulation Mol. Biol. Cell, October 1, 2004; 15(10): 4633 - 4646. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Dymek, P. A. Lefebvre, and E. F. Smith PF15p Is the Chlamydomonas Homologue of the Katanin p80 Subunit and Is Required for Assembly of Flagellar Central Microtubules Eukaryot. Cell, August 1, 2004; 3(4): 870 - 879. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Wirschell, G. Pazour, A. Yoda, M. Hirono, R. Kamiya, and G. B. Witman Oda5p, a Novel Axonemal Protein Required for Assembly of the Outer Dynein Arm and an Associated Adenylate Kinase Mol. Biol. Cell, June 1, 2004; 15(6): 2729 - 2741. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. DiBella, E. F. Smith, R. S. Patel-King, K.-i. Wakabayashi, and S. M. King A Novel Tctex2-related Light Chain Is Required for Stability of Inner Dynein Arm I1 and Motor Function in the Chlamydomonas Flagellum J. Biol. Chem., May 14, 2004; 279(20): 21666 - 21676. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Yang, C. Yang, and W. S. Sale Flagellar Radial Spoke Protein 2 Is a Calmodulin Binding Protein Required for Motility in Chlamydomonas reinhardtii Eukaryot. Cell, February 1, 2004; 3(1): 72 - 81. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Qin, D. R. Diener, S. Geimer, D. G. Cole, and J. L. Rosenbaum Intraflagellar transport (IFT) cargo: IFT transports flagellar precursors to the tip and turnover products to the cell body J. Cell Biol., January 19, 2004; 164(2): 255 - 266. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Casey, K. Inaba, G. J. Pazour, S. Takada, K.-i. Wakabayashi, C. G. Wilkerson, R. Kamiya, and G. B. Witman DC3, the 21-kDa Subunit of the Outer Dynein Arm-Docking Complex (ODA-DC), Is a Novel EF-Hand Protein Important for Assembly of Both the Outer Arm and the ODA-DC Mol. Biol. Cell, September 1, 2003; 14(9): 3650 - 3663. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Ibanez-Tallon, N. Heintz, and H. Omran To beat or not to beat: roles of cilia in development and disease Hum. Mol. Genet., April 2, 2003; 12(90001): R27 - 35. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Kathir, M. LaVoie, W. J. Brazelton, N. A. Haas, P. A. Lefebvre, and C. D. Silflow Molecular Map of the Chlamydomonas reinhardtii Nuclear Genome Eukaryot. Cell, April 1, 2003; 2(2): 362 - 379. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Susalka, K. Nikulina, M. W. Salata, P. S. Vaughan, S. M. King, K. T. Vaughan, and K. K. Pfister The Roadblock Light Chain Binds a Novel Region of the Cytoplasmic Dynein Intermediate Chain J. Biol. Chem., August 30, 2002; 277(36): 32939 - 32946. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Yang, D. R. Diener, J. L. Rosenbaum, and W. S. Sale Localization of Calmodulin and Dynein Light Chain LC8 in Flagellar Radial Spokes J. Cell Biol., June 11, 2001; 153(6): 1315 - 1326. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Kovar, P. Yang, W. S. Sale, B. K. Drobak, and C. J. Staiger Chlamydomonas reinhardtii produces a profilin with unusual biochemical properties J. Cell Sci., January 12, 2001; 114(23): 4293 - 4305. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Porter and W. S. Sale The 9 + 2 Axoneme Anchors Multiple Inner Arm Dyneins and a Network of Kinases and Phosphatases that Control Motility J. Cell Biol., November 20, 2000; 151(5): F37 - F42. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Boylan, M. Serr, and T. Hays A Molecular Genetic Analysis of the Interaction between the Cytoplasmic Dynein Intermediate Chain and the Glued (Dynactin) Complex Mol. Biol. Cell, November 1, 2000; 11(11): 3791 - 3803. [Abstract] [Full Text] |
||||
![]() |
C. A. Perrone, S. H. Myster, R. Bower, E. T. O'Toole, and M. E. Porter Insights into the Structural Organization of the I1 Inner Arm Dynein from a Domain Analysis of the 1beta Dynein Heavy Chain Mol. Biol. Cell, July 1, 2000; 11(7): 2297 - 2313. [Abstract] [Full Text] |
||||
![]() |
P Yang, L Fox, R. Colbran, and W. Sale Protein phosphatases PP1 and PP2A are located in distinct positions in the Chlamydomonas flagellar axoneme J. Cell Sci., January 1, 2000; 113(1): 91 - 102. [Abstract] [PDF] |
||||
![]() |
G. J. Pazour, A. Koutoulis, S. E. Benashski, B. L. Dickert, H. Sheng, R. S. Patel-King, S. M. King, and G. B. Witman LC2, the Chlamydomonas Homologue of the t Complex-encoded Protein Tctex2, Is Essential for Outer Dynein Arm Assembly Mol. Biol. Cell, October 1, 1999; 10(10): 3507 - 3520. [Abstract] [Full Text] |
||||
![]() |
S. Takeda, Y. Yonekawa, Y. Tanaka, Y. Okada, S. Nonaka, and N. Hirokawa Left-Right Asymmetry and Kinesin Superfamily Protein KIF3A: New Insights in Determination of Laterality and Mesoderm Induction by kif3A-/- Mice Analysis J. Cell Biol., May 17, 1999; 145(4): 825 - 836. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Yang and W. S. Sale Casein Kinase I Is Anchored on Axonemal Doublet Microtubules and Regulates Flagellar Dynein Phosphorylation and Activity J. Biol. Chem., June 16, 2000; 275(25): 18905 - 18912. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||