|
|
|
|
Vol. 9, Issue 12, 3399-3415, December 1998

§
¶
and
#Howard Hughes Medical Institute,
*Department of Cell
Biology, Vanderbilt University, Nashville, Tennessee, 37212;
Department of Biology, Queen's University, Kingston,
Ontario K7L 3N6, Canada;
Plant Biotechnology Institute,
National Research Council of Canada, Saskatoon, Saskatchewan S7N
0W9, Canada
| |
ABSTRACT |
|---|
|
|
|---|
Schizosaccharomyces pombe cells respond to nutrient deprivation by altering G2/M cell size control. The G2/M transition is controlled by activation of the cyclin-dependent kinase Cdc2p. Cdc2p activation is regulated both positively and negatively. cdr2+ was identified in a screen for regulators of mitotic control during nutrient deprivation. We have cloned cdr2+ and have found that it encodes a putative serine-threonine protein kinase that is related to Saccharomyces cerevisiae Gin4p and S. pombe Cdr1p/Nim1p. cdr2+ is not essential for viability, but cells lacking cdr2+ are elongated relative to wild-type cells, spending a longer period of time in G2. Because of this property, upon nitrogen deprivation cdr2+ mutants do not arrest in G1, but rather undergo another round of S phase and arrest in G2 from which they are able to enter a state of quiescence. Genetic evidence suggests that cdr2+ acts as a mitotic inducer, functioning through wee1+, and is also important for the completion of cytokinesis at 36°C. Defects in cytokinesis are also generated by the overproduction of Cdr2p, but these defects are independent of wee1+, suggesting that cdr2+ encodes a second activity involved in cytokinesis.
| |
INTRODUCTION |
|---|
|
|
|---|
The eukaroytic cell cycle is regulated by a number of
evolutionarily conserved gene products. The fission yeast,
Schizosaccharomyces pombe, has been used extensively as a
model organism to isolate and study these genes, especially those
involved in the progression from G2 to M. The best
described of these is cdc2+, which encodes a
cyclin- dependent protein kinase, whose periodic activation controls
progression into both M and S phases of the cell cycle (Nurse and
Bissett, 1981
; Piggot et al., 1982
). Mutational analyses of
S. pombe have identified temperature-sensitive alleles of
cdc2 that arrest in G2, unable to progress into
M phase, as well as alleles that arrest in both G2 and
G1, unable to progress into M or S phase (Nurse and
Bissett, 1981
).
Other regulators of G2/M progression have also been
identified, and several of these encode regulators of Cdc2p (reviewed by Berry and Gould, 1996
). cdc13+ encodes a
B-type cyclin that binds to Cdc2p as a positive regulatory subunit
(Booher and Beach, 1988
; Hagan et al., 1988
; Booher et al., 1989
). The gene products of wee1+ and
cdc25+ regulate activation of Cdc2p by
phosphorylation (inhibitory) and dephosphorylation (activating) of
Cdc2p Y15, respectively, which sets the timing of mitosis (reviewed by
Morgan, 1995
; Berry and Gould, 1996
). Y15 phosphorylation is not only a
critical control point for G2/M progression, but it also
determines cell size at mitosis (Gould and Nurse, 1989
) and thus
provides a link between mitotic control and growth.
S. pombe cells grow by tip extension, such that increasing cell
mass is reflected by increasing cell length (Mitchison, 1957
). At the
end of the cycle, cells "fission" or divide medially, generating two identical daughter cells. S. pombe cells are also able
to adjust cell length by changing the timing of mitosis (Fantes, 1977
).
For a population of cells to be able to maintain an average cell size,
cells born with a smaller-than-average length must spend more time
growing, before initiating mitosis and dividing, than do cells born
with an average cell length. The reverse is true for cells born with a
larger-than-average cell length.
The sizing mechanism linking growth to division, or the
G2/M cell size checkpoint, has been studied extensively in
S. pombe through the analysis of mutant alleles of
wee1 (Nurse, 1975
; Fantes and Nurse, 1978
; Thuriaux et
al., 1978
; Nurse and Thuriaux, 1980
; Fantes, 1981
; Russell and
Nurse, 1987a
). The G2/M cell size checkpoint is missing in
wee1 mutants, so that cells initiate mitosis at a length
much shorter than wild type (Fantes and Nurse, 1978
). Because
wee1 cells spend a longer time than wild type in
G1, it was also determined that a G1/S cell
size checkpoint exists, forcing cells to achieve a critical cell length
in G1 before progressing into S phase. Since the
G2/M cell size checkpoint is missing in wee1
mutants, it is thought that this checkpoint operates through Wee1p-inhibitory phosphorylation of Cdc2p Y15.
For both immediate and long-term survival, S. pombe cells
must be able to respond to changes in nutrition by changing the rate of
growth and division (Fantes and Nurse, 1977
). Nutritional changes
trigger the G2/M cell size control mechanism, shifting the
size required for mitotic progression so that cells growing in rich
medium divide with a longer cell size, whereas cells growing in poor
medium divide with a smaller cell size. Also, when faced with severe
shortages of nitrogen, S. pombe cells are able to adapt by
altering G2/M cell size control so that cells arrest in
G1 with a much reduced cell size. If the cells are sexually competent and the proper mating partner is present, they differentiate sexually and mate (reviewed by Egel, 1989
). However, if there is no
sexual partner present, the arrested cells enter a long-term state of
dormancy, also referred to as G0 or quiescence. Cells arrested in G0 are able to survive over extended periods of
time and are resistant to environmental stresses such as heat shock.
In a search for potential regulators of the G2/M cell size
control, Young and Fantes (1984
, 1987
) carried out a genetic screen in
which they isolated mutants that were unable to alter G2/M size control in response to nitrogen deprivation. It was anticipated that such a screen would identify genes involved in G2/M
progression control and also those involved in nutritional sensing and
monitoring. To date, only one complementation group from this screen,
cdr1+ (changed division response), has been
further characterized (Russell and Nurse, 1987b
; Feilotter et
al., 1991
; Coleman et al., 1993
; Parker et
al., 1993
; Wu and Russell, 1993
; Wu et al., 1996
;
Belenguer et al., 1997
; Rupes et al., 1997
; Wu
and Russell, 1997
). cdr1+ was also isolated as
nim1+ (new inducer of mitosis), a multicopy
suppressor of cdc25-22 (Russell and Nurse, 1987b
). Like all
cdr mutants, cdr1/nim1 mutant cells are unable to
respond properly to nitrogen deprivation and arrest as large cells in
G2 rather than as smaller cells in G1 (Young
and Fantes, 1984
, 1987
; Belenguer et al., 1997
; Wu and Russell, 1997
). Moreover, cycling cdr1/nim1 cells are longer
than wild type, suggesting that their mitotic control has been altered. Molecularly, it has been shown that cdr1/nim1 encodes a
serine-threonine protein kinase and acts as a mitotic inducer by
negatively regulating Wee1p activation; thus, it is a component of
mitotic control (Russell and Nurse, 1987b
; Feilotter et al.,
1991
; Coleman et al., 1993
; Parker et al., 1993
;
Wu and Russell, 1993
).
We present the characterization of a second complementation group
isolated in the Young and Fantes screen. Similar to
cdr1/nim1, cdr2 mutant cells initiate mitosis
with a cell length longer than wild type and arrest in G0
from G2 with a large cell size in response to nitrogen
deprivation (Young and Fantes, 1984
, 1987
; Rupes et al.,
1997
). We have found that cdr2+ is nonessential
and is predicted to encode a serine-threonine protein kinase. We
present genetic evidence to demonstrate that cdr2+ functions in G2 as a negative
regulator of wee1+. We also show that
cdr2+ has an additional role in cell division.
Cells lacking Cdr2p or overexpressing cdr2+ fail
to undergo cytokinesis and septation normally; these defects are
independent of Wee1p function.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Yeast Methods and Strains
S. pombe strains used in this study are listed in
Table 1. Strains were grown in yeast
extract medium, minimal medium with appropriate supplements, or minimal
medium lacking ammonium chloride as the nitrogen source (Moreno
et al., 1991
). Crosses were performed on glutamate medium
(minimal medium lacking ammonium chloride and containing 0.01 M
glutamate, pH 5.6). Tetrad analysis was performed as described (Moreno
et al., 1991
). Yeast transformations were performed by
electroporation (Prentice, 1991
). Genomic DNA was isolated as described
(Moreno et al., 1991
; Hoffman, 1993
).
|
Molecular Biology Techniques
All plasmid manipulations and bacterial transformations were by
standard techniques (Sambrook et al., 1989
). Essential
features of plasmid construction are described below. All sequencing
was performed using Sequenase 2.0 (United States Biochemical,
Cleveland, OH) according to manufacturer's instructions. All PCR
reactions except those for the construction of epitope-tagged strains
were performed using Taq DNA polymerase and the GeneAmp PCR
kit (Perkin Elmer-Cetus, Norwalk, CT) in a PTC-100 programmable thermal
controller (PTC-100; MJ Research, Watertown, MA) programmed as follows:
94°C, 1 min; 50°C, 2 min; 72°C, 2 min (40 cycles); 72°C, 10 min. TaqPlus Precision (Stratagene, La Jolla, CA) was used to amplify
the cdr2HA sequence in a PTC-100 programmable thermal
controller (PTC-100; MJ Research) programmed as follows: 95°C, 1 min;
65°C-1°C per cycle, 1 min; 72°C, 5 min (15 cycles); 95°C, 1 min; 50°C, 1 min; 72°C, 5 min (30 cycles); 72°C, 10 min.
Physiological Experiments
For analysis of synchronous cell populations, 4 l of cells were grown to midlog phase (8 × 106 cells/ml) at 30°C in minimal medium. Cells were separated on the basis of size by centrifugal elutriation in an elutriator rotor (JE 5.0; Beckman, Fullerton, CA). Cells synchronized in early G2 were collected in minimal medium and split into two cultures. Cells from each culture were collected on filters and released into either minimal medium or minimal medium lacking nitrogen at 30°C. Synchrony was monitored at 20- and 30-min intervals by scoring 100 cells for the presence of a septum. Samples were collected periodically for determination of cell length, DNA content, cell number increase, binculeate cells, and protein analysis.
For asynchronous nitrogen deprivation experiments, cells were grown to midlog phase in minimal medium at 30°C. Cells were collected on filters and then inoculated into minimal medium lacking nitrogen. Samples were collected periodically and were processed to determine DNA content.
To determine long-term viability and resistance to heat shock in
response to nitrogen deprivation, cells were grown and deprived of
nitrogen as described (Su et al., 1996
). For viability,
samples were collected periodically over a 20-d time course, diluted
appropriately, and plated in triplicate on YE plates at 25°C, and
colonies were counted 5 d later. For heat shock, cells were
incubated at 42°C for 5 min, diluted appropriately, and plated in
triplicate on YE plates at 25°C, and colonies were counted 5 d later.
To determine total cell number, cells were collected and fixed in 0.12 M NaCl, 3% formaldehyde, diluted appropriately, sonicated briefly, and then counted in triplicate using the Coulter Multisizer II (Coulter Electronics, Hialeah, FL). Total cell number was taken as the average of each triplicate.
To determine DNA content, cells were fixed in ice-cold 70% ethanol,
washed in 50 mM sodium citrate, incubated with 0.1 µg/ml RNase A in
50 mM sodium citrate for 2 h at 37°C, and then stained with 1 µM Sytox green (Molecular Probes, Sunnyvale, CA) for 2 h. Cells
were sonicated and analyzed by flow cytometry as described (Sazer and
Sherwood, 1990
).
To determine cell length, fixed cells were measured microscopically using phase optics and a 100× objective with an eyepiece drum micrometer. To determine average cell length, 100 cells were measured. To determine septation length, 50 cells containing a septum were measured.
Microscopy
All light and fluorescence microscopy was performed on a Zeiss
microscope (Axioskop; Carl Zeiss, Thornwood, NY) using appropriate filters. Cells were either fixed in 100% methanol at
20°C for 8 min or in 30% formaldehyde for 10 min at room temperature and then
washed with PBS and processed as described by Balasubramanian et
al. (1997)
. To visualize DNA and/or cell and septal material, cells were fixed in methanol or formaldehyde and stained with DAPI
and/or Calcofluor.
Cloning and DNA Sequence of cdr2+
The cdr2-96 cdc25-22r1 leu1-32
(Q1045) strain was transformed with a S. pombe genomic
library that was prepared from HindIII and Sau3A
partially digested genomic DNA inserted into pWH5 (Wright et
al., 1986
; Hudson et al., 1990
; Young and Beach,
unpublished results). Transformants were selected at 25°C for 2 d on minimal medium lacking leucine and then shifted to 35°C.
Plasmids were recovered from viable colonies and were transformed into
the cdr2-96 leu1-32 strain (KGY519). Only one
plasmid (pcdr2.1) was able to restore the nitrogen deprivation response
of cdr2-96, and this plasmid was subjected to further
subcloning to identify a minimal complementing fragment of 3.0 kilobases (kb).
To characterize the complementing DNA, the 3.0-kb genomic fragment was further subcloned, and appropriate plasmids were sequenced in both directions to generate 2656 base pairs (bp) of sequence. This sequence contained a single open reading frame (ORF) of 2247 bp but terminated without a stop codon. Comparison of this sequence to the S. pombe sequence database revealed that this sequence was identical to a sequence contained on cosmid c57A10 from chromosome I. Cosmid c57A10 contained the complete ORF of 2325 bp.
For integration mapping, a leu1-32 strain (KGY1) was
transformed with linearized pcdr2.2. Transformants were selected on
minimal medium lacking leucine. The resulting Leu+ strain
(Q1046) was crossed to cdr2-96 leu1-32 (KGY519),
to verify cosegregation of the Cdr2+ phenotype with the
Leu+ phenotype. Only Cdr2+ Leu+ and
Cdr2
Leu
progeny were produced, indicating
that pcdr2.2 had integrated within or very close to the
cdr2+ locus.
Deletion of cdr2+
To generate a full-length cdr2+ construct containing 5'- and 3'-flanking genomic sequence, the 3.0-kb fragment containing 2247 bp of cdr2+ sequence and 400 bp of 5'-flanking sequence was subcloned into pSK (Stratagene) generating pMB17. Next, a NdeI site was introduced at the initiating codon of the cdr2+ sequence, and two endogenous NdeI sites were removed by site-directed mutagenesis (Chameleon Double Stranded Mutagenesis Kit; Stratagene) in pMB17 generating pKG939. To generate the 3'-coding region missing from pMB17, the oligonucleotides CSB51 (5'-CGTATGAATGAGAATGA-3') and CSB52 (5'-CCTTGCTCTAGACATGCAAG-3') were used to PCR amplify from genomic DNA a 1300-bp fragment consisting of 876 bp of the 3'-cdr2+ coding region plus 424 bp of 3'-flanking genomic sequence. After digestion with XbaI, the 3'-fragment was subcloned into pMB939, exchanging the incomplete 3'-end of the cdr2+ coding region with the complete 3'-coding sequence plus flanking sequence, generating pKG943. pKGY943 was sequenced to verify accuracy of the cdr2+ coding region.
To generate a deletion construct containing cdr2+ flanking sequence but lacking the cdr2+ coding region, the cdr2+ coding sequence plus flanking sequences were first shuttled into pTZ from pKG943 as a SacI-SmaI fragment to generate a construct containing a unique EcoRV site (pKG935). pKG935 was digested with NdeI and EcoRV, removing all but the last 289 bases of the cdr2+ coding sequence, and replaced with a 1.8-kb fragment containing the ura4+ gene, generating pKG1275 (see Figure 2A). Digestion of pKG1275 with SmaI and SacI liberated the deletion fragment, which was transformed into a ura4-D18/ura4-D18 diploid strain (KGY137). Ura+ diploid transformants were selected on minimal medium lacking uracil and were subjected to tetrad analysis. All spores were viable, and the Ura+ prototrophs were subjected to Southern hybridization analysis to verify deletion of the cdr2+ sequence.
Conjugation Efficiency Assay
To determine conjugation efficiency, homothallic
cdr2::ura4+ (KGY1480) and wild-type
homothallic (KGY68) strains were plated onto glutamate agar for 48 h. Samples were analyzed under light microscopy, and conjugation
efficiency was determined as described (Wu and Russell, 1997
).
Overexpression Analysis
To determine whether the nitrogen deprivation defect of the
cdr2 null could be rescued by overexpression of genes
encoding mitotic components, a
cdr2::ura4+ ura4-D18
leu1-32 strain (KGY1519) was transformed with plasmids containing cDNAs encoding cdc2+,
cdc13+, and cdr2+ under
control of the S. pombe nmt1 (no message in thiamine)
thiamine repressible promoter (Maundrell, 1993
). To generate
pREP1cdr2+ (KG947), pKG939 was digested with
XbaI, treated with Klenow, and then digested with
NdeI. The resulting fragment was subcloned into
NdeI/SmaI-digested pREP1. The transformed strains
were grown to midlog at 30°C in minimal medium containing thiamine,
recovered on filters, released into minimal medium containing thiamine
but lacking nitrogen, and incubated at 30°C for 48 h. Rescue was
determined by phenotype and by DNA content. To determine whether
overexpression of cdc25+ could rescue the
nitrogen deprivation defect of the cdr2 null, a
cdc25-22 strain containing cdc25+
under control of the nmt1 promoter integrated at the
cdc25 locus (GL122) was crossed to the cdr2 null.
The resulting double mutant (KGY1637) was grown in minimal medium
containing thiamine to midlog at 25°C, washed to remove the thiamine,
and then incubated in minimal medium for 18 h to induce expression
of cdc25+. Cells were then collected on filters,
released into minimal medium lacking nitrogen, and incubated for
48 h at 25°C.
To analyze the phenotype of cdr2+ overexpression in wild-type cells and in the absence of wee1+ activity, a wild-type strain (KGY246) and the wee1::ura4 ura4-D18 leu1-32 strain (KGY4) were each transformed with pREP1 vector alone and pREP1cdr2+ (KG947). The transformed strains were grown at 25°C in minimal medium containing thiamine to midlog, collected, washed to remove the thiamine, and then released into minimal medium lacking thiamine for 18 h.
Construction of Epitope-tagged Strains
To construct a genomic 3'-3XHA epitope-tagged
cdr2+ strain (KGY1628), a PCR
amplification-based strategy was utilized as described previously
(Bähler et al., 1998
). Oligonucleotides 5'-cdr2long (5'-CGGCATCCAGACCTGTTTCTCGAATGAGTGTAAGTAGTAGTCCTTTTGCTGTATTTCGTCAACGACAATCCGTCCAAAGTCGGATCCCCGGGTTAATTAA-3') and 3'-cdr2long
(5'-CCAAAGCATCACGAGAAAAATGAAGTTTGCAAAGGTTTTGGAGAATCAAAAAAAAATGATAATAATAATAATAAAAGAATGAATTCGAGCTCGTTTAAAC-3') were used to PCR amplify a fragment containing a 3XHA epitope tag
kanamycin resistance (kanMX6) cassette flanked on either
side with cdr2+ 3'-genomic sequence. A wild-type
strain (KGY246) was transformed with the amplified fragment, plated
onto YE medium overnight, and then replica plated onto YE medium
containing the drug G418 to select for recombinants. Recombinants were
outcrossed to wild type to confirm segregation of the kanMX6
marker and were screened by immunoblotting with the
12CA5 monoclonal antibody specific to the hemagglutinin (HA)
epitope. Proper integration of the HA epitope in
cdr2+ was confirmed by Southern hybridization
analysis and functionality was assessed by phenotype.
Southern Hybridization Analysis
Approximately 0.5 µg of genomic DNA was digested overnight at
37°C, size fractionated on an 0.8% agarose gel, and transferred to a
GeneScreen Plus membrane (New England Nuclear Life Science Products,
Boston, MA) overnight. The membrane was treated for 1 h in
hybridization buffer (5× Denhardt's solution, 0.5% SDS, 5× SSPE,
and 100 µg of hydrolyzed yeast RNA per ml), and then overnight at
65°C in hybridization buffer containing a random-primed
-[32P]dCTP-labeled probe (rediPrime;
Amersham, Arlington Heights, IL). The membrane was then washed two
times for 30 min at 65°C in 2× SSC-0.2% SDS. Hybridizing bands
were detected by autoradiography.
Immunoblotting
S. pombe denatured lysates were prepared as described
(Gould et al., 1991
). Approximately 2.4 × 108 cells were lysed, and total protein in each lysate was
determined by BCA (BCA Protein Assay Reagent Kit; Pierce Chemical,
Rockford, IL). For Western blot analysis, lysates were resolved by
SDS-PAGE and electrophoretically transferred to a polyvinylidene
difluoride membrane (Immobilon-P, Millipore, Bedford, MA). Blots were
probed with either monoclonal antibodies specific to the HA epitope
(12CA5) at 2 µg/ml, PSTAIRE domain of cyclin-dependent kinases
(Yamashita et al., 1991
; Sigma Chemical, St. Louis, MO) at 2 µg/ml, or a polyclonal antibody specific to S. pombe
Cdc13p (GJG56, Den Haese and Gould, unpublished results). Antibody
GJG56 was affinity purified as described previously (Olmsted, 1981
) and
used at 1:100 dilution. In S. pombe, the PSTAIRE antibody
detects two PSTAIRE motif-containing proteins, p34 (Cdc2p) and p31,
which encodes a PSTAIRE-related protein (Tournier et al.,
1997
). Primary antibodies were followed with the appropriate
peroxidase-conjugated secondary antibody (Sigma). Reactive proteins
were visualized by enhanced chemiluminescence (Amersham Life
Sciences). For quantitation of immunoblotting
data, ECL Plus reagents (Amersham Life Sciences) were used. Data were collected on a Molecular Dynamics Storm instrument and quantified by
ImageQuant version 1.1.
| |
RESULTS |
|---|
|
|
|---|
cdr2+ Encodes a Putative Serine-Threonine Protein Kinase
Since none of the previously characterized cdr2 mutant
alleles imparted a conditional phenotype, we took advantage of the strong negative interaction between cdr2 and
cdc25 mutant alleles to clone the
cdr2+ gene (Young and Fantes, 1987
). A double
mutant between cdr2-96 and a non-temperature-sensitive
allele of cdc25, cdc25-22r1 (Hudson et
al., 1990
), was constructed. While viable at 25°C,
cdr2-96 cdc25-22r1 is temperature sensitive for
growth at 35°C. This strain was transformed with a S. pombe genomic library (Wright et al., 1986
; Young and
Beach, unpublished results), and only one transformant that grew at
35°C contained a plasmid that was also able to restore the ability of
cdr2-96 to arrest with a small cell size in response to
nitrogen deprivation. The complementing plasmid was further characterized to identify a minimal rescuing fragment of 3.0 kb. Integration mapping confirmed that the 3.0-kb fragment contained the
cdr2+ gene and not a high-copy suppressor.
Sequencing of the 3.0-kb genomic rescuing fragment uncovered a
continuous ORF of 2247 bp that did not contain a stop codon. When this
ORF was compared with the S. pombe sequence database, an
identical sequence was found on cosmid c57A10 from S. pombe chromosome I. The complete cdr2+ ORF encoded a
protein of 775 amino acids with a predicted molecular weight of 85,917 (Figure 1A). Further
comparison of the Cdr2p amino acid sequence to sequences in the
databases revealed the presence of amino- terminal motifs that are
signatures of protein kinase catalytic domains (Hanks et
al., 1988
). The putative catalytic domain of Cdr2p showed highest
sequence similarity to the Snf1p subfamily of serine-threonine protein
kinases of which the Saccharomyces cerevisiae carbon
catabolite derepressing kinase Snf1p is the prototypical member.
Members of the Snf1p subfamily to which Cdr2p has high similarity in
the catalytic domain include the S. cerevisiae protein
Gin4p, Cdr1p/Nim1p in S. pombe, and the Cdr1p/Nim1p S. cerevisiae homologue, Hsl1p (Figure 1B) (Russell and Nurse, 1987b
; Feilotter et al., 1991
; Ma et al., 1996
; Atman
and Kellogg, 1997
). Although limited, Cdr2p also has sequence
similarity to Gin4p outside the catalytic domain (Figure 1C).
|
Analysis of a cdr2 Null Mutant
To determine the phenotype of a strain in which cdr2+ has been deleted, the one-step gene disruption method was used to replace one copy of the cdr2+ coding sequence with the S. pombe ura4+ selectable marker as described in MATERIALS AND METHODS. We found that cdr2+ is a nonessential gene; Southern hybridization analysis of genomic DNA isolated from a Ura+ haploid colony confirmed that the cdr2+ coding sequence had been replaced by ura4+ (Figure 2B). However, cells lacking cdr2+ were longer than wild type, septating at an average length of 19.5 µm in minimal medium, the same length at which cdr2-96 septates, while wild-type cells septated at an average of 13.0 µm (Figure 2C).
|
The original cdr2 mutant alleles were isolated by virtue of
their inability to respond normally to nitrogen deprivation (Young and
Fantes, 1984
, 1987
). Subsequent analyses demonstrated that the
cdr2 mutants were longer than wild-type cells under all
growth conditions. Moreover, it was determined that during nitrogen
deprivation, cdr2 mutants failed to arrest in G1
and instead arrested in G2 (Young and Fantes, 1984
, 1987
;
Rupes et al., 1997
). To determine whether the
cdr2 null strain behaved similarly, we performed flow cytometry on cdr2 null and wild-type strains undergoing
nitrogen deprivation. Over the course of the experiment, wild-type
cells became short and rounded (Figure 2D). The majority of the cells contained a 1 N content of DNA, demonstrating that these cells had
arrested in G1. In contrast, the majority of
cdr2 null cells remained longer than wild-type cells and
contained a 2N content of DNA. Hence, the cdr2 null
cells behaved identically to cdr2-96 cells in these assays.
cdr2 Mutants Arrest in G0 in Response to Nitrogen Deprivation
S. pombe cells responding to nitrogen deprivation have
two choices: they either enter G0, or they initiate sexual
differentiation if the proper mating partner is present. Cells arrested
in G0 are able to maintain viability over long periods of
time and are able to withstand extracellular stresses such as heat
shock (reviewed by Egel, 1989
). To examine the ability of
cdr2 cells to enter G0 from G2,
long-term viability and heat-shock tolerance were measured in
cdr2 null and wild-type strains undergoing nitrogen deprivation. There was no significant difference in the long-term viability of the cdr2 null strain compared with wild type
(Figure 3A), nor was there a difference
in their ability to withstand heat shock over time (Figure 3B). This
demonstrates that the cdr2 null is able to enter
G0 from G2, which is similar to the phenotype exhibited by cdr1/nim1 and also a subset of sterile mutants
such as nuc2 (Kumada et al., 1995
; Belenguer
et al., 1997
; Wu and Russell, 1997
).
|
cdr2+ Is Not Required for Sexual Differentiation
In wild-type S. pombe, nutrient deprivation is a
necessary prerequisite for sexual differentiation. Lack of nitrogen
lowers intracellular cAMP levels by 50% (Maeda et al.,
1990
; Kawamukai et al., 1991
; Mochizuki and Yamamoto, 1992
).
This, in turn, triggers the induction of ste11+,
whose protein product induces transcription of genes required for
sexual differentiation (Sugimoto et al., 1991
). To
determine whether cdr2+ played a role in this
response, we examined the induction of ste11+
mRNA. We found that the transcription of ste11+
mRNA was up-regulated in both wild-type and cdr2 null
strains upon nitrogen deprivation (our unpublished results).
In order for S. pombe cells to mate, they must first arrest
in G1 in response to nitrogen deprivation. This is a
critical step because each cell must have a 1C DNA content before
undergoing conjugation and nuclear fusion. Although the induction of
ste11+ appeared normal, we still might expect
cdr2 null cells to have a mating defect because of their
inability to arrest in G1. To examine this question, we
generated a homothallic, or self-mating, cdr2 null strain
and compared its mating efficiency to a wild-type homothallic strain.
As illustrated in Figure 3C, there was no significant difference
between the mating efficiencies of wild type and cdr2 null
strains. The ability of the cdr2 null cells to mate at
levels similar to wild type suggests that the cdr2 null
cells must be able to arrest in G1 under conditions
suitable for mating, i.e., low nitrogen levels and the presence of
pheromones expressed from cells of the opposite mating type (reviewed
by Neilsen and Davey, 1995
).
The G2 Delay Exhibited by the cdr2 Null Is Exacerbated during Nitrogen Deprivation
Since the cdr2 null was not defective in undergoing sexual differentiation in limiting nitrogen, or arresting in G0 in response to nitrogen deprivation, it seemed unlikely that cdr2+ functioned as a nutritional sensor or monitor. Another possibility for the inability of the cdr2 null cells to arrest in G1 is a defect in G2/M progression. The longer cell length of the cdr2 null suggests that it takes a longer period of time for cells lacking cdr2+ to initiate mitosis. Such a delay might inhibit the ability of the cdr2 null cells to alter mitotic control in response to nitrogen deprivation.
To carefully measure the ability of cells to undergo mitosis in response to nitrogen deprivation, we utilized cultures synchronized in the cell cycle by centrifugal elutriation. Either wild-type or cdr2 null strains were grown to midlog phase in minimal medium at 30°C. Newborn cells, which we found using the new DNA dye, Sytox green, were actually in S phase (see Figure 4F), were selected by centrifugal elutriation and collected on filters, and then released immediately into either minimal medium or minimal medium lacking a nitrogen source. Samples were collected periodically during a 48-h time course to follow cell length, DNA content, cell number increase, and time of septation, and for protein analysis.
|
Wild-type cells inoculated into minimal medium began to septate at 100 min, with a septation peak at 160 min for the first cell cycle and at 340 min for the second cell cycle (Figure 4A). The peaks of binucleate cells were at 140 and 340 min (Figure 4B). Similarly, the cdr2 null cells inoculated into minimal medium exhibited a peak of septation at 180 min in the first cell cycle and at 360 min in the second (Figure 4A). The binucleate peaks were at 160 and 340 min (Figure 4B).
Cells deprived of nitrogen behaved differently. Nitrogen-deprived wild-type cells exhibited a significant delay in septation: they did not begin to septate until 180 min, exhibiting a peak of septation at 210 min, after which the synchrony of the culture was lost (Figure 4C). The peak of binucleates was similarly delayed, exhibiting a first peak at 180 min (Figure 4D). The cdr2 null cells inoculated into minimal medium without nitrogen did not begin to septate until 210 min, and then only a few cells were able to septate at any given time, suggesting that the synchrony of the culture was lost by the time the first cells initiated septation (Figure 4C). The binucleate peak also appeared later (Figure 4D). That the cell cycle delays occurred in G2 rather than in mitosis was confirmed by determining that the appearance of mitotic spindles was also delayed (our unpublished results).
By determining cell number increases and DNA content of the cells throughout this experiment, we found that wild-type cells deprived of nitrogen underwent two rounds of cell division; cell number approximately quadrupled (Figure 4E). Interestingly, using the improved DNA stain, Sytox green, rather than propidium iodide, we were able to discern in this and other experiments (our unpublished results) that the smallest S. pombe cells isolated by centrifugal elutriation were in S phase rather than G2. After completion of DNA replication, they divided synchronously and then underwent a final cell cycle and arrested in G1 (Figure 4F). In contrast to wild-type cells, the cdr2 null cells underwent only one round of cell division, doubling their cell number over the course of the experiment (Figure 4E). Because they did not go through another round of mitosis, they were arrested in G2 (Figure 4F).
As mentioned above, wild-type cells deprived of nitrogen alter cell
size control and divide at a reduced cell size (Fantes and Nurse,
1977
). To determine whether cdr2 null cells were similarly able to alter cell size control upon nitrogen deprivation, mean cell
lengths were determined throughout this synchronous cell experiment
(Figure 4G). The newborn wild-type cells isolated by centrifugal
elutriation were, on average, 6.7 µm in length. At the first round of
division, the average length of cells containing a septum was 7.9 µm.
This represents a reduction from ~13.0 µm at septation of wild-type
cells grown in minimal medium. After 24 h and 48 h of
nitrogen starvation, the mean cell lengths of wild-type cells had
diminished to 4.4 µm and 3.9 µm, respectively. Newborn
cdr2 null cells isolated by centrifugal elutriation were 11.0 µm in length. At the first round of division, the average length
of cells containing a septum was 16.0 µm. This is somewhat reduced
from the average septation length of 19.5 µm in nitrogen-containing minimal medium. After 24 and 48 h of nitrogen starvation, the mean
cell lengths of the cdr2 null cells were 9.4 and 9.6, respectively. Thus, cdr2 null cells do adjust cell size at
division in response to nitrogen deprivation but not to the same
proportion as wild-type cells.
Genetic Interactions with Mitotic Control Genes
To better understand the role of
cdr2+ in mitotic control, we examined genetic
interactions between the cdr2 null and a variety of mitotic
control mutants. cdr2 mutants display strong negative interactions with mutations in cdc25 and lower the
restrictive temperature of alleles of cdc2 and
cdc13 (Young and Fantes, 1987
). As mentioned previously, the
cdr2 null appeared phenotypically similar to the initially
characterized cdr2 mutant alleles. We found that the
cdr2 null displayed genetic interactions with alleles of
cdc25, cdc2, and cdc13 similar to
those found with the cdr2 mutant alleles (Table
2). Interestingly, mutations in
wee1 or dominant alleles of cdc2 are epistatic to
mutations in cdr2, including the cdr2 null; cells
lacking both wee1 and cdr2 were small in length
(Young and Fantes, 1987
; Figure 6B). This result would be consistent
with the possibility that Cdr2p acts as a negative regulator of Wee1p.
|
To determine whether overexpression of several known mitotic
control genes could compensate for the lack of
cdr2+, the cDNAs encoding
cdr2+, cdc2+,
cdc13+, and cdc25+, under
control of the S. pombe nmt1 (no message in thiamine) thiamine-repressible promoter (Maundrell, 1993
), were overexpressed in
the cdr2 null strain. Only overexpression of
cdr2+ or cdc13+ could
restore the wild-type response to nitrogen deprivation; these cells
arrested in G0 with a small cell size that was
indistinguishable from wild type (Figure
5A).
|
The ability of additional Cdc13p to restore the wild-type response to
nitrogen deprivation suggested that Cdc13p levels may be altered in the
cdr2 null. The level of Cdc13p is highly regulated. During
mitosis, Cdc13p levels decline (Booher et al., 1989
; Hayles and Nurse, 1995
; Creanor and Mitchison, 1996
). Also, Cdc13p is degraded in response to nitrogen deprivation (Broek et al.,
1991
). To determine whether Cdc13p levels are perturbed in the
cdr2 null strain, Cdc13p levels were assayed from samples
collected from the same experiment described in Figure 4. We found that
Cdc13p was degraded with similar kinetics in both the wild-type and the cdr2 null strains (Figure 5B). Quantification of the Cdc13p
signal standardized with the Cdc2p loading control indicated that in both wild-type and cdr2 strains, the percent of Cdc13p
signal dropped to 8 and 10% of starting levels, respectively, by 180 min. Since cdr2 null cells must grow substantially before
initiating septation even during nitrogen deprivation, as shown in
Figure 4, this timely degradation of Cdc13p partially explains why
cdr2 null cells struggle to initiate mitosis after nitrogen
deprivation and also might explain why increased levels of Cdc13p are
sufficient to rescue this defect of the cdr2 null.
cdr2 Mutants Have an Additional Defect in Cell Division
Although no temperature-sensitive phenotype was initially ascribed
to the cdr2 mutants (Young and Fantes, 1987
), we observed that the cdr2 null strain exhibited temperature-associated
growth abnormalities. When incubated at 36°C, cdr2 null
cells were more elongated and showed defects in cytokinesis; cells
contained multiple septa and misplaced septa and septum material
(Figure 6A). However, these defects did
not result in lethality and were only observed when cells were
incubated in YE. Moreover, the defects at 36°C were suppressed by the
addition of sorbitol to the medium (our unpublished results).
|
Since cdr2+ activity is not required in the absence of wee1+ with respect to cell length, we wanted to know whether loss of wee1+ activity also suppressed the cytokinesis defect of the cdr2 null. To determine this, the cdr2 null wee1-50 double mutant was incubated at 36°C in YE. As can be seen in Figure 6B, loss of wee1+ did not suppress the cytokinesis defect associated with loss of cdr2+. The double mutant not only had defects in cytokinesis but also accumulated multiple nuclei. The same was found to be true in a cdr2 null wee1 null double mutant (our unpublished results). The inability of the loss of wee1 function to suppress the cytokinesis defect of the cdr2 null suggested the possibility that cdr2+ has two separate roles: one in the decision to enter mitosis, dependent on wee1+, the other in cytokinesis, independent of wee1+.
Overexpression of cdr2+ Has a Dominant Negative Effect
To further characterize the function of
cdr2+, we overexpressed the
cdr2+ gene in a wild-type strain. If
cdr2+ functions as a negative regulator of
wee1+, similar to
cdr1+/nim1+, then we
might expect overexpression of cdr2+ to cause
cells to become wee in size, as in the case of
cdr1+ overexpression (Russell and Nurse, 1987b
).
Contrary to this expectation, overexpression of
cdr2+ in the wild-type strain was lethal and
generated elongated, highly branched cells that contained two or more
septa (Figure 7A). Thus, the
overexpression of cdr2+ has an apparent dominant
negative effect.
|
To determine whether the cdr2+ overexpression phenotype was dependent on wee1+, we overexpressed cdr2+ in the wee1 null strain. Overexpression of cdr2+ in the wee1 null was lethal, and these cells displayed septation defects that were similar to the defects that resulted from overexpression of cdr2+ in wild-type cells (Figure 7B). However, the wee1 null cells overexpressing cdr2+ did not become elongated, supporting the idea that cdr2+ function is dependent on wee1+ with respect to cell length, but is independent of wee1+ with respect to its role in cytokinesis.
Cdr2p Abundance Is Regulated during Nitrogen Deprivation
The results from the experiments above suggested that Cdr2p is required for cells to initiate mitosis at the appropriate time. Thus, we might expect Cdr2p abundance to be regulated during the cell cycle and/or during nitrogen deprivation. We first determined that the level of cdr2+ mRNA did not vary during the cell cycle or during nitrogen deprivation (our unpublished results).
To measure Cdr2p protein abundance, we generated a C-terminal HA epitope-tagged cdr2+. The resulting Cdr2p-HA protein was determined to be functional as the tagged strain was indistinguishable from wild type in terms of cell length and response to nitrogen deprivation (our unpublished results). The Cdr2p-HA protein was detected as a doublet migrating at a molecular mass of ~90 kDa using monoclonal antibodies specific to the HA epitope (12CA5). This doublet was detected only in lysates from the tagged strain (Figure 8A).
|
A synchronous cell population was used to determine the abundance of
Cdr2p-HA throughout the cell cycle and during nitrogen deprivation.
While Cdr2p-HA levels remained constant throughout the cell cycle (our
unpublished results), the level of Cdr2p-HA decreased during nitrogen
deprivation but was detectable up to 100 min (Figure 8B). This is
contrast to Cdr1p/Nim1p, which is degraded immediately upon release
into medium lacking nitrogen (Wu and Russell, 1997
). These data also
support the hypothesis that Cdr2p acts as a mitotic inducer; Cdr2p is
present at the time in which cells are initiating mitosis.
| |
DISCUSSION |
|---|
|
|
|---|
cdr2+ was isolated in a screen for genes
required for the proper mitotic response to nitrogen deprivation in
S. pombe. Because the cdr mutants were not able
to respond properly to nitrogen deprivation, it was predicted that the
cdr+ genes would be involved in either
nutritional sensing and/or mitotic control (Young and Fantes, 1984
,
1987
). Early evidence supported both predictions; the two
complementation groups characterized, cdr1 and
cdr2, initiated mitosis with a longer cell length than wild
type, indicating a delay in G2, and they were unable to
respond properly to nitrogen deprivation. cdr1+,
also known as nim1+, has been shown to encode a
conserved serine-threonine protein kinase that promotes
G2/M progression through the inhibitory phosphorylation of
the wee1+ gene product, thus fulfilling one of
the predictions of the cdr screen (Russell and Nurse, 1987b
;
Feilotter et al., 1991
; Coleman et al.,
1993
; Parker et al., 1993
; Wu and Russell, 1993
). However, cdr1+/nim1+ does not
appear to have a role in nutritional sensing, and the defect in
responding to nitrogen deprivation by
cdr1+/nim1+ mutants is a
result of a delay in G2 (Belenguer et al., 1997
; Wu and Russell, 1997
). We have continued the characterization of
cdr2+ and have found that similar to
cdr1+/nim1+,
cdr2+ acts as an inducer of mitosis. However,
unlike cdr1+/nim1+,
cdr2+ has an additional role in cytokinesis.
We have found that cdr2+ is not an essential
gene. The cdr2 null is phenotypically similar to
cdr2 mutants; cdr2 null cells septate at the same
length as the cdr2-96 mutant. Utilizing the cdr2
null strain, we dissected the involvement of
cdr2+ in the response of S. pombe
cells to nitrogen deprivation. We found that, like
cdr1/nim1 mutants, the cdr2 null
mutant arrested in G2 instead of G1 when
starved for nitrogen and entered a state of quiescence or
G0. Since S. pombe cells can enter
G0 in response to nitrogen deprivation from either
G1 or G2 (Castello et al., 1986
),
the latter usually occurring from carbon deprivation, it is not
surprising that cdr2 mutants are able to enter
G0 from G2. However, we also found that the
cdr2 null was able to undergo sexual differentiation and
produce viable haploid progeny, which is surprising if the
cdr2 null cells had truly arrested in G2 under
the conditions employed in mating assays. However, mating assays differ
from nitrogen deprivation experiments in that low amounts of nitrogen
are present. Also, pheromones, produced under limiting nutrient
conditions (reviewed by Neilsen and Davey, 1995
), may help to promote a
G1 arrest in the mating assays. Thus, under these
conditions, it is likely that the cdr2 null cells are able to transiently arrest in G1 and undergo sexual
differentiation. These data indicate that cdr2+
is not required for nutritional sensing, and therefore it is not likely
that cdr2+ encodes a nutritional sensor or monitor.
To show that cdr2+ functions in G2/M
progression, we analyzed the mitotic response of wild-type and
cdr2 null cells to nitrogen deprivation. It has been
demonstrated previously that asynchronous populations of wild-type
cells respond to nitrogen deprivation by immediately altering
G2/M size control and entering mitosis with a reduced cell
size (Fantes and Nurse, 1977
). In our nitrogen deprivation experiments,
wild-type cells entered mitosis with a reduced cell size as seen
previously. However, there was an unexpected delay in G2
before these cells entered mitosis. Since the cells utilized in our
experiments were synchronized early in the cell cycle, they had not yet
reached the critical size for mitosis. Hence, these uniformly small
cells were forced to grow until the proper size was reached, even
though the G2/M size had indeed been reset in response to
nitrogen deprivation. When we analyzed asynchronous populations of
wild-type cells, we observed the acceleration into mitosis previously
described (our unpublished results) (Fantes and Nurse, 1977
).
The cdr2 null strain also exhibited a delay in G2 in response to nitrogen deprivation, but the delay in the cdr2 null cells was substantially longer than in wild-type cells. Furthermore, although cell size at mitosis was altered by nitrogen deprivation in the absence of Cdr2p function, the response was not proportionately as large as in wild-type cells. The cdr2 null cells did eventually undergo mitosis and divide, as reflected by the doubling of cell number, and arrested in G2 of the following cell cycle. Under the same regimen, wild-type cells nearly quadrupled in number, undergoing an additional round of mitosis and arresting in G1. These data demonstrate that Cdr2p acts as a mitotic inducer, which is especially important in conditions of limiting nitrogen.
To begin dissecting the molecular nature of Cdr2p's role in promoting
mitosis, we examined the genetic relationship between cdr2
and known mitotic control genes. From the initial characterization of
cdr2+, it is known that the restrictive
temperatures of alleles of cdc2, cdc25, and
cdc13 mutants are lowered in combination with cdr2 mutants, demonstrating that they interact genetically
(Young and Fantes, 1987
). Moreover, we found that ectopic expression of
cdc13+ was sufficient to rescue the nitrogen
deprivation response of the cdr2 null. This suggested that
Cdc13p might be limiting in the cdr2 null since Cdc13p
association with Cdc2p is required for activation of Cdc2p and entry
into mitosis (Booher et al., 1989
). When the level of Cdc13p
was examined in the cdr2 null, we found that it was the same
as in wild type (our unpublished results). Because Cdc13p protein is
turned over in response to nitrogen deprivation (Broek et
al., 1991
), we then tested the possibility that the kinetics of
Cdc13p degradation were altered in the cdr2 null. The
kinetics of Cdc13p degradation in response to nitrogen deprivation were
similar in the cdr2 null and wild-type cells. Since the
cdr2 null cells must grow proportionately longer than
wild-type cells before initiating mitosis, the decrease in Cdc13p
levels might contribute to their difficulty initiating mitosis. Because
of the limitations of detection on immunoblots, we would
not argue that these cells are initiating mitosis in the absence of
Cdc13p but rather that Cdc13p becomes limiting under these conditions.
Hence, addition of excess Cdc13p is sufficient to restore the wild-type
response to nitrogen deprivation in cdr2 null cells.
Genetic interactions between cdr2 and wee1
mutants also provide some insight into the molecular role of
cdr2+ in G2/M progression. It was
demonstrated by Young and Fantes (1987)
that
wee1+ was epistatic to both
cdr1+/nim1+ and
cdr2+, and they suggested that the
cdr genes may regulate wee1+
activity. Indeed, Cdr1p/Nim1p has been shown to inhibit Wee1p directly
by phosphorylation (Coleman et al., 1993
; Parker et
al., 1993
; Wu and Russell, 1993
). cdr2+
also encodes a putative protein kinase with homology to the N-terminal catalytic domain of the Snf1p subfamily of serine-threonine protein kinases. Does cdr2+ function as a negative
regulator of wee1+ as originally suggested?
cdr2+ overexpression data suggests that it does.
Overexpression of cdr2+ in wild-type cells led
to a delay in G2, followed by defects in cytokinesis, but
no G2 delay was detected when cdr2+
is overexpressed in cells lacking wee1+
activity. These data, combined with the epistatic relationship between
wee1 and cdr2 mutants, demonstrate that
cdr2+ activity is not required in the absence of
wee1+ to promote mitosis, and possibly Cdr2p
acts as an inhibitor of Wee1p. If cdr2+ is
acting as an inducer of mitosis acting through
wee1+, does it do so in a manner identical to
cdr1+/nim1+? Our data
suggest not. As mentioned above, overexpression of cdr2+ led to a delay in G2 followed
by defects in cytokinesis. This is in sharp contrast to
cdr1+/nim1+
overexpression, which promotes entry into mitosis at a reduced cell
size (Russell and Nurse, 1987
).
Genetic analysis of cdr1 and cdr2 mutants further
suggests that cdr2+ functions in a pathway
separate from
cdr1+/nim1+. Even though
a cdr2 null cdr1/nim1 null double
mutant is phenotypically indistinguishable from the cdr2
null, both cdr2 and cdr1/nim1 mutants were
sensitive to overexpression of the other (our unpublished results),
which demonstrates a lack of dependence between
cdr2+ and
cdr1+/nim1+. These data
suggest that cdr2+ and
cdr1+/nim1+ do not
function in a linear pathway and act independently to promote mitosis.
Since Wee1p is the key inhibitor of Cdc2p activity before mitosis
(Russell and Nurse, 1987a
), there are probably numerous factors and
signal transduction pathways, some yet uncharacterized, that regulate
wee1+ activity.
The additional role of cdr2+ in cytokinesis also
supports the idea that cdr2+ functions in a
pathway separate from
cdr1+/nim1+. Cells
lacking cdr2+ and cells overproducing
cdr2+ exhibited defects in forming septa and
undergoing cell separation. It appears then that
cdr2+ is required for proper septum formation
and cell separation. At this time, we do not understand the molecular
role of cdr2+ in cytokinesis, except that it is
independent of wee1+ activity. Thus, if
cdr2+ functions to negatively regulate
wee1+, it is doing so in a manner different from
that of cdr1+/nim1+. It
is possible that cdr2+ acts indirectly to
inhibit wee1+. Excess Cdr2p might sequester a
Wee1p inhibitory factor that is normally activated by Cdr2p; thus, a
G2 delay is produced when cdr2+ is
overexpressed. Another possibility is that Cdr2p influences the level
of Wee1p. In S. pombe, the level of Wee1p protein level is
cell cycle regulated; Wee1p levels decrease at mitosis, and this
reduced level is maintained into G1 (Aligue et
al., 1997
). In this scenario, Cdr2p may facilitate the degradation
of Wee1p to promote Cdc2p activation and entry into mitosis.
Interestingly, Cdr2p is most similar to the S. cerevisiae
protein kinase Gin4p. GIN4 encodes a nonessential
protein kinase that is required for the ability of NAP1
and CLB2 to promote normal mitotic progression (Altman
and Kellogg, 1997
). S. cerevisiae CLB2 encodes a B-type
cyclin analogous to S. pombe Cdc13p (Fitch et
al., 1992
; Richardson et al., 1992
), whereas the
NAP1 gene product was identified as a Clb2p-binding protein
(Kellogg and Murray, 1995
; Kellogg et al., 1995
). Gin4p
binds Nap1p, and Gin4p phosphorylation and activation in mitosis are
dependent on both Nap1p and Clb2p (Altman and Kellogg, 1997
). Since we
have shown that cdr2+ also promotes mitosis, it
will be interesting to see whether Cdr2p interacts with a protein
similar to Nap1p in S. pombe and whether such an interaction
influences its function. Our genetic data, however, suggest that at
least one function of cdr2+ lies upstream of
cdc2+/cdc13+ activation,
rather than being dependent upon it.
In conclusion, we have begun characterizing the role of cdr2+ in S. pombe and have found that, like cdr1+/nim1+, cdr2+ functions as a mitotic inducer that is especially important under nutrient limiting conditions and not as a sensor of nutrient limitation. Unlike cdr1+/nim1+, which acts directly on wee1+ to regulate mitosis, the role of cdr2+ in cell cycle regulation is more complex; cdr2+ has an additional role in cytokinesis and is required for proper septum formation and cell separation.
| |
ACKNOWLEDGMENTS |
|---|
We thank Drs. J. Bähler and J.R. Pringle for providing us with the HA-kan tagging cassette, and Dr. Paul Russell for discussion of unpublished results and S. pombe strain GL122. All current and past members of the Gould laboratory, including Drs. Dan McCollum and L.D. Berry, are appreciated for their valuable discussions and technical advice. This work was supported by NIH grant GM-47728 to K.L.G.; C.S.B. was supported by National Cancer Institute grant T32 CA-09592. P.G.Y. was supported by the Natural Sciences and Engineering Research Council of Canada. K.L.G. is an associate investigator of the Howard Hughes Medical Institute.
| |
FOOTNOTES |
|---|
Present addresses: §Institute of Child Health, University of London, 30 Guilford St., WC1N 1EH, United Kingdom; ¶Cell Division Laboratory, Institute of Molecular Agrobiology, The National University of Singapore, 1 Research Link, Singapore 117604.
| |
REFERENCES |
|---|
|
|
|---|