![]() |
|
|
Vol. 9, Issue 2, 355-373, February 1998
Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, Missouri 63110
Submitted June 30, 1997; Accepted November 7, 1997| |
ABSTRACT |
|---|
|
|
|---|
Integral membrane proteins are predicted to play key roles in the biogenesis and function of nuclear pore complexes (NPCs). Revealing how the transport apparatus is assembled will be critical for understanding the mechanism of nucleocytoplasmic transport. We observed that expression of the carboxyl-terminal 200 amino acids of the nucleoporin Nup116p had no effect on wild-type yeast cells, but it rendered the nup116 null strain inviable at all temperatures and coincidentally resulted in the formation of nuclear membrane herniations at 23°C. To identify factors related to NPC function, a genetic screen for high-copy suppressors of this lethal nup116-C phenotype was conducted. One gene (designated SNL1 for suppressor of nup116-C lethal) was identified whose expression was necessary and sufficient for rescuing growth. Snl1p has a predicted molecular mass of 18.3 kDa, a putative transmembrane domain, and limited sequence similarity to Pom152p, the only previously identified yeast NPC-associated integral membrane protein. By both indirect immunofluorescence microscopy and subcellular fractionation studies, Snl1p was localized to both the nuclear envelope and the endoplasmic reticulum. Membrane extraction and topology assays suggested that Snl1p was an integral membrane protein, with its carboxyl-terminal region exposed to the cytosol. With regard to genetic specificity, the nup116-C lethality was also suppressed by high-copy GLE2 and NIC96. Moreover, high-copy SNL1 suppressed the temperature sensitivity of gle2-1 and nic96-G3 mutant cells. The nic96-G3 allele was identified in a synthetic lethal genetic screen with a null allele of the closely related nucleoporin nup100. Gle2p physically associated with Nup116p in vitro, and the interaction required the N-terminal region of Nup116p. Therefore, genetic links between the role of Snl1p and at least three NPC-associated proteins were established. We suggest that Snl1p plays a stabilizing role in NPC structure and function.
| |
INTRODUCTION |
|---|
|
|
|---|
Nuclear pore complexes (NPCs)1 are
large proteinaceous assemblies that provide the only known portals for
the nucleocytoplasmic transport of macromolecules. A requisite step in
the assembly of an NPC is the formation of a pore through the nuclear
envelope, presumably via the regulated fusion of the outer and inner
nuclear membranes. The mechanism by which this fusion event occurs and the subsequent factors required for the coordinated assembly of the
distinct substructures of an NPC have not been elucidated. High-resolution cryoelectron microscopy and transmission scanning electron microscopy studies have revealed the major structural components of the vertebrate NPC (Ris, 1991
; Akey, 1995
; Goldberg and
Allen, 1995
; Pante and Aebi, 1996
), with three-dimensional reconstructions resolving the basic framework to ~10 nm (Hinshaw et al., 1992
; Akey and Radermacher, 1993
). The overall
architecture is based on eight radially symmetrical spokes that are
sandwiched between two rings anchoring the filamentous structures on
both the cytoplasmic and nuclear faces. The spokes also appear
connected to both an inner spoke ring encompassing the cytoplasmic
central plug and an outer ring in the nuclear envelope lumen. The
latter suggests a requirement for integral membrane proteins to
traverse the pore membrane. Moreover, models for NPC biogenesis have
suggested that interactions between integral membrane proteins may be
required for formation of the pore, and integral membrane proteins are presumed essential for anchoring an NPC in the pore (Macaulay and
Forbes, 1996
; Goldberg et al., 1997
).
On the basis of an estimated molecular mass of more than
108 daltons and the polypeptide complexity of purified
yeast NPCs (Reichelt et al., 1990
; Rout and Blobel,
1993
), an NPC may comprise at least 50 different polypeptides. To date,
more than 20 yeast NPC-associated peripheral membrane proteins
(nucleoporins) and one yeast pore-associated integral membrane protein
have been identified (reviewed in Corbett and Silver, 1997
; Doye and
Hurt, 1997
). A precise understanding of NPC-mediated transport will depend not only on revealing the complete biochemical composition of an
NPC, but also on integrating the location and assembly interactions of
such proteins into the context of NPC architecture.
Two basic approaches have been used in attempts to identify NPC
assembly factors: analysis of yeast nucleoporin mutants for perturbations of NPC structure and characterization of in vitro NPC
assembly in Xenopus laevis egg extracts. With regard to
the latter, vertebrate cell-free systems have provided excellent models for studying the assembly of nuclear structures (Lohka and Masui, 1983
;
Burke and Gerace, 1986
; Newport, 1987
). Mitotic NPC assembly and
disassembly can be reconstituted in vitro, and a general framework for
the stages of NPC assembly has been revealed. Nuclear pore and NPC
formation requires the prior assembly of a double nuclear membrane
(Macaulay and Forbes, 1996
), and is blocked by the addition of GTP
S,
BAPTA, or NEM (Newmeyer and Forbes, 1990
; Pfaller et al., 1991
; Boman et al., 1992a
,b
; Newport and
Dunphy, 1992
; Vigers and Lohka, 1992
; Sullivan et al.,
1993
; Macaulay and Forbes, 1996
; Goldberg et al., 1997
).
Depletion of either vesicular or soluble components from the in vitro
extract can also prevent NPC formation (Sheehan et al.,
1988
; Dabauvalle et al., 1990
; Finlay and Forbes, 1990
;
Finlay et al., 1991
; Vigers and Lohka, 1991
). These
studies suggest that both integral and peripheral membrane proteins are essential mediators of assembly.
A striking array of different NPC structural perturbations has
been observed in numerous mutant yeast strain backgrounds (reviewed in
Rout and Wente, 1994
; Corbett and Silver, 1997
; Doye and Hurt, 1997
;
Wente et al., 1997
). Perturbations include clustering of NPCs in localized patches, decreased NPC number per nucleus, the presence of intranuclear annulate lamellae, and extensive lobulation of
the nuclear envelope. In previous studies, we characterized an unusual
temperature-sensitive structural perturbation of yeast NPCs lacking the
nucleoporin Nup116p (Wente and Blobel, 1993
). Although the mutant NPCs
were still anchored to the inner nuclear membrane, the outer membrane
became detached and the inner membrane appeared continuous over the
cytoplasmic face of the NPC. Temperature-sensitive alleles of two other
genes that encode NPC-associated proteins, npl4-2 and
gle2-1, also exhibit similar nuclear membrane/NPC
herniations (DeHoratius and Silver, 1996
; Murphy and Wente, 1996
). The
absence or alteration of these proteins may have affected NPC
biogenesis or the stability of intact NPCs and the surrounding pore
membrane. In our model describing the nup116
phenotype, we speculated that a membrane fusion event involving the
pore membrane resulted in the herniation structures (Wente and Blobel,
1993
). Revealing the structural basis for herniation formation in such
mutant cells may provide insight into the pathways for maintaining NPC
and nuclear pore structure.
With our long-range goal aimed at determining nucleoporin roles
in transport and/or NPC assembly events, recent efforts have focused on
revealing the function of each structural region in Nup116p. Nup116p is
a member of the GLFG family of nucleoporins, characterized by a region
containing 33 repeats of the tetrapeptide glycine-leucine-phenylalanine-glycine (GLFG) (Figure
1A) (Wente et al., 1992
;
Wimmer et al., 1992
). This particular GLFG region is
essential for growth at 37°C (Iovine et al., 1995
).
Several investigations strongly support a role for GLFG regions in
mediating nuclear export by interaction with factors containing nuclear export sequences (Stutz et al., 1995
; Fritz and Green,
1996
; Murphy and Wente, 1996
; Stutz et al., 1996
; Iovine
and Wente, 1997
). However, the GLFG region is not sufficient for
complete Nup116p function. The flanking amino (N)-terminal and carboxyl
(C)-terminal regions are also required, but their functions are unknown
(Iovine et al., 1995
). The presence of
phenylalanine-glycine (FG) repeats similar to those in other
nucleoporins suggests a role for the N-terminal region in transport.
The C-terminal region of Nup116p displays remarkable homology to
regions in two other GLFG nucleoporins: the C-terminal region of Nup100
(Nup100-C), and the middle region of Nup145p (Nup145-M) (Figure 1A)
(Wente et al., 1992
; Fabre et al., 1994
;
Wente and Blobel, 1994
). These related regions each contain a peptide
octamer designated the nucleoporin RNA-binding motif (NRM) that others
have suggested is necessary for in vitro binding to homopolymeric RNA
of guanine residues [poly(G)] (Fabre et al., 1994
).
However, the molecular requirement for such poly(G) binding in NPC
structure and function remains to be determined.
|
In this article, we have further defined the roles of the N and
C-terminal regions of Nup116p. The NPC-associated factor Gle2p directly
bound Nup116p in vitro, and the N-terminal region of Nup116p was both
necessary and sufficient for the Gle2p interaction. A lethal
nup116-C mutant phenotype was characterized that
required expression of the C-terminal NRM-containing region. In a
genetic selection, a novel high-copy suppressor of the
nup116-C phenotype was identified and designated
SNL1 (for suppressor of
nup116-C lethal).
SNL1 encodes an integral membrane protein with a
calculated molecular mass of 18.3 kDa. Interestingly,
SNL1 is also a high-copy suppressor of both the
gle2-1 and nic96-G3 temperature
sensitive phenotypes. In addition, the nup116-C
phenotype was rescued by overexpression of Gle2p or Nic96p, an
essential NPC assembly factor (Zabel et al., 1996
). On
the basis of these results, we predict that Snl1p plays a stabilizing
role in NPC function and biogenesis.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Strains and Plasmids
The plasmids used in this study are described in Table
1. Bacterial strains
were cultured in SOB media and transformed by standard methods
(Sambrook et al., 1989
). Escherichia coli strain DH5
was used as the bacterial host for all plasmids. The yeast strains were grown in either rich media (YPD; 1% yeast extract, 2%
bactopeptone, 2% glucose), or synthetic minimal media (SM) supplemented with appropriate amino acids and 2% of the indicated sugar (glucose, raffinose, or galactose). Yeast transformations were
performed using the lithium acetate method (Ito et al.,
1983
), and general yeast manipulations were conducted as described
(Sherman et al., 1986
). The haploid yeast strains used in
this study include: W303
(MAT
ade2-1 ura3-1 his3-11,15
trp1-1 leu2-3,112 can1-100), SWY27 [nup116
(Wente and Blobel, 1993
)], SWY1136 [gle2-1 (Murphy et al., 1996
)], SWY1225 [gle2
(Murphy
et al., 1996
)]], SWY1191 [gle1-4 (Murphy and
Wente, 1996
)], SWY423 (MAT
nup133
::HIS3 ade2-1
ura3-1 his3-11,15 trp1-1 leu2-3,112 can1-100; gift from M. Bucci, Washington University, St. Louis, MO]), PSY826
[npl4-2 (DeHoratius and Silver, 1996
)], pom152
null (MATa ade2-1 ura3-1 his3-11,15 trp1-1
leu2-3,112 pom152-2::HIS3, generous gift from R. Wozniak, University of Alberta, Edmunton, Canada), SWY1209 [MATa nup100::HIS3 gle3-1(nic96-G3)
ade2-1 ade3::HISG ura3-1 his3-11,15 leu2-3,112 trp1-1
LYS2 + pSW201 (Murphy et al., 1996
)], SWY1031
(MAT
nup100::HIS3 ade2-1 ade3 ura3-1 his3-11,15
leu2-3, 112 TRP1 lys2 + pSW201), SWY1599 (MAT
nup100::HIS3 ade2-1 ade3::HISG ura3-1 his3-11,15
leu2-3,112 TRP1 lys2 NIC96:LEU2), SWY1353
(snl1::HIS3, see below),
mtr7-1/acc1-7-1 [MAT
mtr7-1 ura3-52
(Schneiter et al., 1996
)], MLY1846 [MATa
ura3-52 his4-619 sec17-1 (Novick et al., 1980
;
Latterich and Schekman, 1994
)], and MLY1888 [MATa ura3-52 his4-619 sec18-1 (Novick et al., 1980
;
Latterich and Schekman, 1994
)].
|
Electron Microscopy
Samples were prepared using the protocols described in
Wente and Blobel (1993)
for preservation of both protein and membrane structures. Briefly, SWY27 cells harboring pSW171 were grown to early
logarithmic phase in SM-trp 2% raffinose before shifting to SM-trp 2%
glucose, or SM-trp 2% galactose overnight. Samples were fixed by
resuspension of the cell pellet in 40 mM potassium phosphate buffer (pH
6.5), 0.5 mM MgCl2, 2% glutaraldehyde, and 2%
formaldehyde and were incubated on ice for 30 min. After cell wall
digestion and osmium postfixation (Byers and Goetsch, 1991
), the
samples were embedded in Epon. Thin sections (collected on nickel grids
coated with formvar and stabilized with carbon) were contrasted by
staining with uranyl acetate and Reynold's lead. Specimens were
visualized with a Zeiss-902 electron microscope, and photographs were
taken on Kodak electron microscopy film.
Cloning and Disruption of SNL1
SNL1 was identified in a high-copy suppressor
screen of the nup116-C lethal strain (SWY27 harboring
pSW171) from a yeast genomic library in vector YEp24 (Carlson and
Botstein, 1982
). Approximately 61,000 transformants were screened for
the ability to grow on SM-trp 2% galactose after 7 d at 23°C. A
total of 178 suppressors were identified and the 19 best growers were
further analyzed. Two did not grow well after losing pSW171 and were
not further analyzed. Five of the strains were identified as harboring
an NUP116 plasmid by colony polymerase chain reaction (PCR)
with appropriate oligonucleotides complementary to NUP116.
The library plasmids from the remaining 12 best growers were recovered
from yeast cells and transformed into DH5
cells. After reisolation from bacteria, plasmids were retransformed into the nup116-C
lethal strain and only two isolates were able to reconfer high-copy
suppression. The ends of the library fragments were sequenced using
oligonucleotide primers hybridizing to the tet gene sequence
immediately flanking the insertion point of the genome fragments
(Sequenase kit version 2.0, United States Biochemical, Cleveland, OH).
The resulting DNA sequences were compared with sequences in the yeast
genomic sequencing database. One harbored the TRP1 gene and
the other contained the fragment shown in Figure 3A.
The snl1::HIS3 null strain was made according to
the method of Baudin et al. (1993)
with pBM2815 and two
64-mer oligonucleotides (P18-D5 = GTTGGTGAAAAAATAGCACCAGAAGGGCAATTGTACGTTTCCGTAGGCCTCCTCTAGTACACTC, P18-D3 = TATGAATTCGGCAAGAGCCGTTATCTATAAACTAAAAATACAAACGCGCGCCTCGTTCAGAATG). PCR amplification generated an ~1100-bp HIS3 fragment
flanked on the 5
end with 45 bp of sequence from
45 to
1 of
SNL1 and on the 3
end with 45 bp of sequence from bp 481 to
bp 526. In a similar manner, a kanr fragment flanked
by the same SNL1 sequence was generated. The fragments were
transformed into either haploid W303
or diploid W303 cells.
Isolation of viable haploid null strains
[snl1::HIS3 (SWY1353);
snl1::kan (SWY1678)] was confirmed by colony PCR
and immunoblotting.
Antibodies and Immunoblotting
The C-terminal region of Snl1p was fused in-frame behind
glutathione S-transferase (GST) (pSW552), expressed, and
purified from DH5
bacteria as follows. Fusion protein synthesis was
induced after growth in SOB/amp media (50 µg/ml ampicillin) to
logarithmic phase by the addition of isopropyl
-D-thiogalactopyranoside (IPTG) to 0.3 mM, and growth
continued at 37°C for 4 h. Bacteria were harvested and lysed by
treatment with 1 mg/ml lysozyme in 300 mM NaCl and 50 mM sodium
phosphate (pH 8.0) for 30 min on ice and were sonicated for a total of
15 min (cycles of 1-min bursts and 1-min rests). The lysate was
centrifuged at 4°C for 30 min at 10,000 × g. The
protein concentration was diluted to 50 mg/ml, and the fusion protein
was purified using glutathione agarose resin (Sigma Chemical, St.
Louis, MO). The antigen was sent to Cocalico Biologicals (Reamstown,
PA) for production of rabbit anti-serum WU975. C-terminal Snl1p was
also fused in-frame behind the maltose-binding protein. Maltose-binding
protein-Snl1p was purified from DH5
cells transformed with pSW640
via induction with 0.3 M IPTG and cell lysis as described above,
followed by purification over amylose resin (New England Biolabs,
Beverly, MA). Antiserum to Snl1p was subsequently purified by affinity chromatography over a maltose-binding protein-Snl1p Affi-Gel 10 (Bio-Rad, Hercules, CA) column.
Protein samples were separated by electrophoresis in SDS-polyacrylamide
gels and transferred to nitrocellulose membranes. Blots were probed
with affinity-purified rabbit polyclonal anti-Nup116p C-terminal
antibody (Iovine et al., 1995
) at a 1:2500 dilution (1 h at
room temperature), affinity-purified rabbit polyclonal anti-Snl1p
C-terminal antibody at 1:250 (16 h at 4°C), rabbit polyclonal
anti-Kar2p antibody (Rose et al., 1989) at 1:20,000 (1 h
room temperature), rabbit polyclonal anti-Kex2p C-tail serum KXR-B6
(gift from Robert S. Fuller, University of Michigan, Ann Arbor, MI) at
1:2000 (16 h, 4°C), or affinity-purified rabbit anti-GST antibody at
1:2000 dilution (16 h at 4°C; provided by J. Watkins). All dilutions
were made in 10 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 0.05% Tween 20 (TBST)/2% nonfat dry milk. After washing in TBST, blots were processed
by the ECL system (Amersham, Arlington Heights, IL) according to the
manufacturer's directions or by incubating with affinity-purified
alkaline phosphatase conjugated anti-rabbit IgG (Promega, Madison, WI;
diluted 1:7500) for 1 h and developing with nitro blue tetrazolium
and 5-bromo-4-chloro-3-indoyl-1-phosphate (Promega).
Immunofluorescence Microscopy
Immunofluorescence experiments were performed using a
modified method of Kilmartin and Adams (1984
; Wente et al.,
1992
). Wild-type or SWY1354 (snl1::HIS
pSNL1-ProtA) yeast cells in early log phase were fixed for 1 min in 3.7% formaldehyde and 10% methanol and were incubated with
affinity-purified anti-Snl1p rabbit antibodies at 1:1 or with rabbit
anti-mouse IgG (Cappel Laboratories, Organon Teknika Corp., Durham, NC)
at 1:250 for 16 h at 4°C. They were then washed with M buffer
(40 mM K2HPO4, 10 mM
KH2PO4, 150 mM NaCl, 0.1% NaN3.
0.1% Tween 20, 2% nonfat dry milk). Bound antibody was detected by
incubation with affinity-purified fluorescein isothiocyanate
(FITC)-conjugated goat anti-rabbit IgG (Cappel Laboratories, Organon
Teknika Corp.) at a 1:200 dilution for 60 min at room temperature.
After additional washes in M buffer and 1% bovine serum
albumin/phosphate-buffered saline, cells were mounted in 90% glycerol
and 1 mg/ml p-phenylenediamine (pH 8.0), with or without
0.05 µg/ml 4
,6-diamidino-2-phenylindole. Double immunofluorescence
labeling experiments were performed as above using a 1:1 mixture of the
affinity-purified anti-Snl1p rabbit antibodies and tissue culture
supernatant of either mAb414 (Davis and Blobel, 1986
) or mAb118C3
(Strambio-de-Castillia et al., 1995
). Bound antibodies were
detected by incubation with affinity-purified FITC-conjugated goat
anti-mouse and Texas red-conjugated goat anti-rabbit antibodies (1:200)
(Cappel Laboratories). Photographs were taken for equal exposures using
the 100× objective on an Olympus microscope with Kodak T-MAX 400 film.
Subcellular Fractionation: Nuclear Envelope Isolation, Extraction, and Digestion
Total yeast cell extracts were made as described (Yaffe and
Schatz, 1984
). Yeast spheroplasts were prepared from 12 l of early log phase W303 diploid cells and were lysed by mechanical shearing in
PVP solution (8% polyvinylpyrrolidone PVP, 20 mM potassium phosphate,
pH 6.5, 0.75 mM MgCl2). The crude nuclei/membrane and cytosol fractions were separated by centrifugation, and the crude nuclei/membrane fraction was further subfractionated on a three-step sucrose/PVP solution gradient (2.0 M, 2.1 M, and 2.3 M sucrose) (centrifuged at 28,000 rpm/Beckman SW28 rotor, 4 h, 4°C, as
described in Rout and Kilmartin, 1990
). Nuclear envelopes were isolated from the enriched nuclei fraction as described in Strambio-de-Castillia et al. (1995)
. To extract peripheral proteins from the
membranes, 25 mg of purified nuclear envelopes were diluted in 500 µl
of 10 mM bisTris (pH 6.5), 0.1 mM MgCl2, 1 mM
dithiothreitol, and 0.1 mM phenylmethylsulfonyl fluoride. One
milliliter of 0.2 M Na2CO3 (pH 11) was added to
produce a final concentration of 0.1 M Na2CO3
(pH 11) and it was incubated on ice for 20 min. Membranes were pelleted
at 436,000 × g in a TLA 100.3 rotor at 4°C. The supernatant fraction was trichloroacetic acid (TCA) precipitated and
the membrane pellet was resuspended in 20 µl of SDS sample buffer.
Topology Analysis with Snl1p-Suc2p Fusion
The sequence encoding Suc2p (starting at the third residue of
the mature protein) was inserted in-frame in an NsiI site at the C terminus of Snl1p (pSW575, NsiI site inserted
immediately before the stop codon). The Snl1p-Suc2p fusion protein was
expressed in an snl1
strain (SWY1353). The
N-linked glycosylation status of the fusion protein was
evaluated with a modified protocol of Wilkinson et al.
(1996)
. Cells were grown in SM-leu/glucose to an OD600 of
0.4. Ten A600 units were collected and resuspended in 250 µl of lysis buffer (20 mM Tris, pH 7.5, 5 mM MgCl2, 2% Triton X-100, 150 mM NaCl), and glass beads were added to the meniscus
and vortexed for 10 min (70 s on, 30 s rest). The lysate was
centrifuged at 1600 rpm for 10 min, and 50 µl of the supernatant were
added to 1.2 ml of 50 mM sodium phosphate (pH 6), 0.5 mM phenylmethylsulfonyl fluoride, and the indicated amount of
Endoglycosidase H (Boehringer Mannheim, Indianapolis, IN). The mixture
was incubated at 37°C for 4 h, TCA precipitated, and boiled in
SDS sample buffer for immunoblot analysis.
Cloning of GLE3
The SWY1209 (gle3-1) strain identified in a
nup100 synthetic lethal screen was transformed with a yeast
genomic library in vector YEp13 (Nasmyth and Tatchell, 1980
).
Approximately 11,000 transformants were screened for the ability to
sector after 7 d of growth at 30°C on SM-leu/glucose plates.
Sectoring isolates were screened for the presence of NUP100
by genomic colony PCR with appropriate oligonucleotides. The novel
rescuing library plasmids were recovered from the yeast cells and
transformed into DH5
cells. After reisolation from bacteria, the
ends of the library fragment in rescuing plasmid pSW847 were sequenced.
The resulting DNA sequence was compared with the yeast genome database,
revealing a ~6.5-kb pair insert from chromosome VI that harbored
NIC96. A subclone expressing only the NIC96 gene
was sufficient for complementation of the nonsectoring phenotype
(pSW278). To prove that NIC96 was allelic to
gle3-1, the NIC96 locus was marked by
integration of a NIC96-LEU2 plasmid (pSW848) in strain
SWY1031. The resulting NIC96-LEU2 strain (SWY1599) was mated
with SWY1209, the diploids were sporulated and dissected, and the
products of 13 tetrads were examined. In all cases, the nonsectoring
phenotype segregated with leucine auxotrophy, indicating linkage of the
synthetic lethal mutation to NIC96. The mutant allele
isolated in the nup100 synthetic lethal screen will be
subsequently referred to as nic96-G3 (for gle3).
Further analysis of the nic96-G3 strain at a variety of growth temperatures revealed a temperature-sensitive defect at 38°C.
In Vitro Translation and Immunoprecipitation
Cell-free translation was performed using purified DNA in the
TNT Reticulocyte Lysate System as described below. pSW691 harboring a
C-terminally hemagglutinin (HA)-epitope tagged GLE2 -HA
(isolated from strain SWY1013, Murphy et al., 1996
) or
pSW851 harboring NIC96 was cotranslated with the indicated
plasmids bearing sequences of NUP116 or NUP145.
The resulting mixture of labeled peptides (12.5 µl) was diluted in
100 µl of lysis buffer (20 mM Tris, pH 7.5, 5 mM MgCl2,
2% Triton X-100, 150 mM NaCl). Subsequently, 1 µl of
affinity-purified rabbit polyclonal anti-GLFG antibody (provided by J. Watkins and H. Kaplan, Washington University, St. Louis, MO) or 3 µl
of mAb12CA5 (anti-HA) tissue culture supernatant and 20 µl of packed
protein A-Sepharose beads (Pharmacia Biotech, Uppsala, Sweden) were
added. The mixture was incubated for 90 min at 4°C on a rotator. The
beads were centrifuged and washed six times with 0.5 ml of ice-cold
wash buffer (0.05% Tween, 150 mM NaCl, 50 mM Tris, pH 7.5).
Immunoprecipitates were resuspended in 20 µl of SDS loading buffer,
boiled, and electrophoresed on 7% SDS-polyacrylamide gels.
| |
RESULTS |
|---|
|
|
|---|
Characterization of an nup116-C Lethal Phenotype that Requires the NRM Motif
Complete deletion of NUP116 results in a
temperature-sensitive growth phenotype at 37°C (Wente et
al., 1992
). In a previous study, we examined the requirements for
the different Nup116p structural regions with a plasmid shuffle assay
in the nup116 null (
) strain (Iovine et al.,
1995
). Expression of only the C-terminal region of Nup116p
(nup116-C) under control of the NUP116 promoter
did not rescue the temperature sensitivity of the nup116
strain, and surprisingly, the nup116
strain expressing
nup116-C was inviable at all growth temperatures. Expression
of this C-terminal region by either the NUP116 or
GAL10 promoters in wild-type NUP116 cells did not
inhibit cell growth (Iovine et al., 1995
). These results
suggested that the expression of the C-terminal region alone had a
gain-of-function, lethal perturbation in the absence of full-length
(FL) Nup116p. To test this possibility, the sequence encoding the
C-terminal region (amino acids 726-1113) was fused in-frame to GST and
placed under the control of the inducible GAL10 promoter.
The plasmid was transformed into both NUP116 and nup116
haploid strains, and the relative expression level
of the fusion protein was detected by immunoblotting
(Figure 1C). The effect on cell growth was monitored on plates
containing either galactose (inducing) or glucose (repressing) as a
carbon source. As shown in Figure 1B, expression of GST-Nup116-C
rendered the nup116
strain inviable at 23°C, whereas at apparently
similar expression levels the wild-type NUP116 strain was
viable and formed colonies.
To test whether expression of the homologous regions from Nup100p and
Nup145p had similar lethal perturbations in nup116
cells,
sequences encoding the Nup100-C and Nup145-M regions were fused to
GAL10-GST. The plasmids were transformed into the
nup116
strain, and the cells were analyzed for growth
perturbations and protein expression levels (Figure 1, B and C). The
presence of either Nup100-C or Nup145-M inhibited nup116
cell growth at 23°C. This similar capacity for growth inhibition of
nup116
cells supported the hypothesis that the Nup116-C,
Nup100-C, and Nup145-M regions perform analogous roles in NPC function
(Wente et al., 1992
; Fabre et al., 1994
; Wente
and Blobel, 1994
).
The nup100
and nup145
N strains are viable
at all growth temperatures, and these mutant cells do not exhibit the
membrane herniations found in nup116
cells (Wente and
Blobel, 1993
, 1994
). The NPCs in nup100
cells appear
identical to wild type, whereas the NPCs in nup145
N cells
are clustered. To determine whether the lethal effect of Nup116-C
expression was specific to the nup116
genetic background,
we tested for growth perturbations in nup100
or
nup145
N strains harboring the
GAL10-GST-nup116-C plasmid. At 23°C, the expression of
Nup116-C was not toxic to nup100
or nup145
N
cells as reflected by colony growth on galactose plates (our
unpublished results). Thus, the nup116-C lethal phenotype required the absence of FL Nup116p.
To further define the region in the Nup116-C polypeptide responsible
for the nup116-C lethal phenotype, each half of the
C-terminal region was fused to GST and expressed from the
GAL10 promoter in nup116
cells (Figure 1, B
and C). The amino-terminal half of Nup116-C (Nup116-CN: amino acids
726-919) did not inhibit cell growth at 23°C. In contrast,
expression of the carboxyl-terminal half of the Nup116-C region
(Nup116-CC; amino acids 914-1113) resulted in lethality. Since the NRM
resides in the Nup116-CC region, we tested directly for its role by
replacing the sequence encoding the NRM octamer with that for a
single glycine residue (designated Nup116-CC
NRM). Expression of
Nup116-CC
NRM in nup116
cells did not confer lethality
(Figure 1, B and C). Therefore, the NRM was required for the lethal
nup116-C phenotype.
Nuclear Membrane Herniations Are Present in the nup116-C Cells
The nup116
temperature-arrested cells have
herniations of the nuclear envelope associated with NPCs (Wente and
Blobel, 1993
). To test whether the lethal nup116-C phenotype
was related to the null phenotype, the nuclear envelope of
nup116
cells expressing Nup116-C was examined by thin
section electron microscopy. After induction of Nup116-C expression in
galactose containing media for 5 h at 23°C, the cells were fixed
and processed. As shown in Figure
2, A and B, the nuclear
envelope of nup116-C lethal cells exhibited nuclear membrane
herniations remarkably similar in structure to those observed in
nup116
cells at 37°C. At the nucleoplasmic base of each
herniation, an electron-dense structure presumably representing the NPC
was present. The inner nuclear membrane appeared to be anchored to this
NPC structure, but the membrane was continuous over the cytoplasmic
face of the NPC. The outer nuclear membrane was not attached to these
NPCs and resided over the herniated inner membrane. Such herniations
were not observed when the nup116-C cells were grown in
repressing glucose media (Figure 2C). Therefore, the presence of the
C-terminal region appeared to further destabilize NPC and pore membrane
structure in nup116
cells.
|
Identification of SNL1 in a Screen for High-Copy Extragenic Suppressors of the nup116-C Lethal Phenotype
We predicted that the nup116 lethal phenotype might be
rescued by overexpression of factors that stabilize the NPC and pore membrane. The nup116-C mutant appeared superior to
nup116
for genetic analysis because the
nup116-C phenotype was dependent on the presence of a
defined protein region (and not the absence of a protein). In addition,
the nup116-C lethal phenotype may be more easily suppressed
at 23°C than suppression of temperature sensitivity at 37°C. Thus,
a genetic screen was conducted for high-copy suppressors of the
nup116-C lethal phenotype at 23°C. A yeast 2 µ genomic
library was transformed into nup116
cells harboring a
plasmid expressing nup116-C under control of the
GAL10 promoter. Among approximately 61,000 possible
transformants, 178 isolates that grew on galactose containing media at
23°C were classified according to their doubling rates at 23°C. A
subset of seven strains whose growth on galactose was both dependent on
the presence of the library plasmid and similar to that of wild-type
cells was further analyzed.
Five of the suppressing plasmids were identified as harboring
NUP116 by genomic colony PCR with appropriate
oligonucleotides. The presence of a high-copy NUP116 plasmid
would effectively rescue the nup116
phenotype to wild
type, in which background the expression of Nup116-C is not lethal. The
sixth suppressor plasmid was identified as harboring TRP1
and it most likely mediated growth by allowing loss of the
GAL10-nup116-C/TRP1 plasmid. Immunoblot analysis
confirmed that the strain with the TRP1 library plasmid was
not expressing Nup116-C (our unpublished results). The remaining strong
suppressor plasmid appeared to be novel and specific. By DNA sequence
analysis and comparison to the yeast genome database, the library
plasmid insert contained the region of chromosome IX shown in Figure
3A. Four open reading frames (ORFs) were
present: the FL BAR1 gene, which encodes a protease for
factor mating pheromone; an FL ORF for a hypothetical 18.3-kDa protein
(YIL016W in the yeast genomic database); and partial genes for
hypothetical proteins of 105 and 79 kDa.
|
High-copy plasmids harboring a DNA fragment encoding only the 105-kDa protein did not suppress the nup116-C phenotype. In addition, a plasmid with a 1885-kb BglII fragment removed (between the BAR1 and 105-kDa genes) was not capable of suppression. However, when the BglII fragment alone was tested in high-copy plasmids, growth of the nup116-C cells was rescued. The BglII fragment in a low-copy CEN vector did not support growth of the nup116-C strain. This suggested that the ORF encoding a putative protein with a predicted molecular mass of 18.3 kDa was both necessary and sufficient for mediating high-copy suppression of the nup116-C lethal phenotype. Therefore, this gene was designated SNL1 (for suppressor of nup116-C lethal).
The 159-amino acid residue sequence for Snl1p is shown in Figure 3B.
Using BLAST programs (Altschul et al., 1990
), no significant homology to any other proteins in the yeast genome database was revealed. Interestingly, analysis of the Snl1p sequence identified a
span of 20-amino acid residues with sufficient hydropathy to function
as a transmembrane segment (Figure 3C). This region from residues 16 to
35 was immediately flanked on either side by charged, basic residues.
Pom152p is the only reported integral membrane protein associated with
NPC function (Wozniak et al., 1994
). Therefore, the ALIGN
program (Dayhoff et al., 1983
) was used to directly examine
Snl1p and Pom152p for structural similarities. As shown in Figure
4, FL Snl1p overlapped with a region of
the Pom152p sequence from residues 170 through 326. The C-terminal 41 residues of Snl1p in particular were 70% similar to Pom152p (13/41
identical and 16/41 with similarity). We have detected no significant
homology between Snl1p and gp210 or Pom121p, the two vertebrate
NPC-associated integral membrane proteins (Gerace et al.,
1982
; Wozniak et al., 1989
; Greber et al., 1990
;
Hallberg et al., 1993
). The previously reported 19-amino
acid segment of similarity shared between yeast Pom152p and rat Pom121p
is separate from the Pom152p homology with Snl1p (Wozniak et
al., 1994
).
|
SNL1 and POM152 Null Alleles Are Not Synthetically Lethal
To test whether SNL1 encoded an essential gene product,
the chromosomal allele of SNL1 was replaced by homologous
recombination with HIS3, or
kanr resulting in a null (
) mutant
allele. Sporulation and dissection of a heterozygous diploid null
strain resulted in the recovery of four viable spores (our unpublished
results). The absence of Snl1p in snl1
::HIS3
haploids was confirmed with anti-Snl1p antibodies (see below). The
disruption conferred no obvious growth defects as compared with
wild-type cells at 14, 23, 30, or 37°C in rich media. Therefore,
SNL1 is not required for cell growth under these conditions.
The observation that pom152 null mutants are viable suggested that an unidentified yeast integral membrane protein(s) functionally compensates for its absence (Wozniak et al.,
1994
). To test for functional links, the phenotype of a haploid strain harboring both the snl1 and pom152 null
alleles was examined. A doubly disrupted, heterozygous
diploid strain (snl1
::HIS3/SNL1 pom152
:: HIS3/POM152) was induced to sporulate
and subjected to tetrad analysis. In all cases, all four spores from
each asci were viable (our unpublished results). Furthermore, for
tetrads where the HIS3 markers cosegregated, the His+
colonies were viable at all tested growth temperatures (14, 23, 30, and
37°C). This indicated that the snl1 and pom152
null mutations were not lethal in combination. The lack of synthetic
lethality between snl1 and pom152 null mutants
possibly reflects their redundant function in cells with yet
unidentified integral membrane proteins.
Snl1p Is a Type I Integral Membrane Protein Localized to the Nuclear Envelope and Endoplasmic Reticulum
To further characterize Snl1p, the localization of Snl1p was
determined by both indirect immunofluorescence microscopy and subcellular fractionation. Sequences encoding five tandem IgG binding
domains from Staphylococcus aureus protein A were fused in-frame before the stop codon for SNL1. The epitope-tagged
gene, under control of the endogenous promoter, was expressed in the snl1
strain from both high-copy and low-copy vectors.
Localization of the C-terminally tagged protein A-Snl1p was visualized
in fixed cells by the binding of FITC-conjugated antibody. As shown in Figure 5, the staining was predominantly
on the nuclear envelope as well as on the endoplasmic reticulum, which
is continuous with the outer nuclear membrane. The variable protein
A-Snl1p staining level between different cells in Figure 5, upper
panel, was probably due to plasmid-copy number differences. A similar
pattern but extremely faint staining was observed with expression from
a low-copy vector. To confirm that the localization was not an artifact
of overexpression, rabbit polyclonal antibodies were raised against a
bacterially expressed GST fusion protein with residues 36-159 of
Snl1p. The antibodies were affinity purified and were tested on both
wild-type SNL1 cells and snl1
cells. The
staining pattern in wild-type SNL1 cells for endogenous
protein was identical to that observed with protein A-Snl1p (Figure 5,
middle panel). In snl1
cells, only diffuse background
staining was present, demonstrating the specificity of the polyclonal
anti-Snl1p antibodies (Figure 5, lower panel).
|
To confirm that the apparent nuclear envelope and endoplasmic reticulum
staining for Snl1p was distinct from the punctate nuclear rim staining
reported for nucleoporins, double immunofluorescence experiments were
conducted. Wild-type yeast cells were double labeled with affinity-
purified rabbit anti-Snl1p antibodies and mouse monoclonal antibodies
recognizing either nucleoporins (mAb414) (Davis and Blobel, 1986
; Rout
and Blobel, 1993
) or Pom152p (mAb118C3) (Strambio-de-Castillia et al.,
1995
). Both the nucleoporin (Figure 6B,
right) and the anti-Pom152p (Figure 6A, right) staining were predominantly confined to the circumference of the nuclear envelope. In
both cases, the anti-Snl1p staining overlapped with the nuclear envelope staining (corresponding left panels of Figure 6). However, the
anti-Snl1p nuclear localization was not strictly punctate on the
nucleus, and it also extended throughout the presumptive endoplasmic
reticulum. To further analyze the subcellular distribution of Snl1p,
yeast cells were fractionated and tested by
immunoblotting with antibodies specific for the lumenal
endoplasmic reticulum protein Kar2p, the nucleoporin Nup116p, and Snl1p
(Figure 7). All three proteins coenriched
with the crude nuclei/membrane fraction from lysed yeast spheroplasts
(Figure 7, lane 3). As previously reported (Strambio-de-Castillia et
al., 1995
), when this crude fraction was further subfractionated on a
three-step sucrose gradient, the nuclear envelope and endoplasmic
reticulum markers became separated. The majority of Kar2p was observed
in lane 5, whereas the majority of Nup116p was observed in lane 7. Interestingly, Snl1p distribution was unique, with approximately
equivalent levels peaking in both lanes 5 and 7. These results
suggested that Snl1p was equally distributed between the nuclear
envelope and endoplasmic reticulum membranes, and was therefore not
exclusively localized at the NPC.
|
|
Because Snl1p was localized to both the nuclear and endoplasmic
reticulum membranes and the hydropathy plot predicted a putative transmembrane span, we tested by subcellular fractionation whether Snl1p behaved as an integral membrane protein. Nuclei were purified from wild-type cells, and a nuclear envelope fraction was isolated using a sucrose flotation gradient (Strambio-de-Castillia et
al., 1995
). The nuclear membranes were extracted with 0.1 M sodium carbonate (pH 11) and peripheral versus integral membrane proteins were
separated by centrifugation into supernatant (s) and pellet (p)
fractions. Samples of the fractions were analyzed by
immunoblotting with the anti-Snl1p and anti-Nup116p
antibodies (Figure 8A). Snl1p resisted
high pH extraction as reflected by its exclusive association with the
pellet fraction. In contrast, Nup116p (a peripheral nucleoporin) was
fully extracted and in the supernatant fraction.
|
The single transmembrane span near the N terminus of Snl1p
predicts that the majority of the polypeptide will be either lumenally or cytoplasmically exposed. To define the Snl1p membrane topology, we
based our studies on the previous analysis of yeast endoplasmic reticulum membrane proteins (Sengstag et al., 1990
; Feldheim
et al., 1992
; Wilkinson et al., 1996
). The fusion
of Suc2p (invertase) to protein regions that are lumenally exposed
results in extensive N-linked glycosylation of the Suc2p
region with a coincident 20- to 26-kDa increase in apparent molecular
mass. In contrast, cytoplasmic localization of Suc2p results in a
nonglycosylated polypeptide that migrates at its predicted molecular
mass. We therefore fused Suc2p to the C terminus of Snl1p. If the
region C-terminal to the Snl1p membrane span is exposed to the cytosol,
the Snl1p-Suc2p hybrid would not be glycosylated and would migrate with
a predicted mass of ~76 kDa. Alternatively, if the C-terminal region
is lumenal, a larger glycosylated Snl1p-Suc2p polypeptide should be
observed. The Snl1p-Suc2p fusion protein was expressed in a
snl1
strain, and cell extracts were prepared, treated
with EndoH, and analyzed by immunoblotting. As a
control, the glycosylation state of endogenous Kex2p was monitored. As
previously reported (Fuller et al., 1989
; Wilcox and Fuller,
1991
), Kex2p was sensitive to treatment with EndoH as reflected by the
shift in apparent molecular mass between lanes 1 and 2 (Figure 8B,
top). In contrast, migration of the Snl1p-Suc2p polypeptide was not
affected by EndoH treatment (Figure 8B, bottom). Moreover, the apparent
molecular mass of the Snl1p-Suc2p hybrid was exactly the size predicted
without glycosylation (~76 kDa). The lack of glycosylation suggested
that the C-terminal region of Snl1p was exposed to the cytoplasm.
Immunofluorescence analysis showed that the Snl1p-Suc2p protein was
correctly targeted to membranes (our unpublished results). Correct
targeting was also observed with biochemical fractionation and membrane
extraction analysis of an Snl1p-protein A fusion, wherein the protein
A domain was inserted in the same position as the Suc2p (our
unpublished results). Interestingly, the type I topology for Snl1p is
the opposite orientation to that predicted for Pom152p. Therefore, either the limited sequence similarities between Pom152p and Snl1p are
not significant, or Pom152p is also oriented as a type I membrane protein. Pom152p topology has not been experimentally determined (Wozniak et al., 1994
). Overall, these data strongly suggest
that Sn1lp is a novel integral membrane protein that functionally
interacts with NPCs.
Specific Genetic Linkage between SNL1, GLE2, NIC96, and NUP116 Function
To examine whether high-copy suppression by SNL1 was
allele specific, other conditional mutant strains were transformed with a high-copy GAL10-SNL1 plasmid and tested for colony growth
at the restrictive temperature on galactose-containing media. High-copy SNL1 expression did not suppress the temperature-sensitive
lethal phenotypes of nup133
, gle1-4, and
npl4-2 mutants (Figure 9A) or
mtr7-1/acc1-7-1, sec17-1, and
sec18-1 mutants (our unpublished results). However,
overexpression of Snl1p did rescue the temperature sensitivity of
gle2-1 and gle3-1 cells. We previously
identified gle2-1 and gle3-1 in a synthetic
lethal genetic screen with a nup100 null mutant (Murphy
et al., 1996
). GLE2 encodes an NPC-associated protein that coimmunoprecipitates in a complex with Nup116p, the nuclear import factor Kap95p, and other unidentified nuclear proteins (Murphy et al., 1996
; Iovine and Wente, 1997
). At 37°C,
the gle2-1 mutant is lethal, inhibits RNA export, and
results in clusters of herniated NPCs similar in structure to the
herniations in nup116
and nup116-C cells
(Murphy et al., 1996
). The wild-type GLE3 gene is
allelic to NIC96 (see MATERIALS AND METHODS), a nucleoporin with an essential role in NPC assembly (Grandi et al., 1993
;
Aitchison et al., 1995
; Grandi et al., 1995a
,b
;
Nehrbass et al., 1996
; Zabel et al., 1996
). The
mutant nic96 allele from the nup100 synthetic lethal screen will be referred to henceforth as nic96-G3. In
a further test, overexpression of Snl1p did not suppress the
gle2
or nup116
temperature- sensitive
phenotypes (Figure 9), suggesting that Snl1p required the presence of
the mutant Gle2p protein or the Nup116-C polypeptide to exert its
suppression activity. Overall, the high-copy SNL1
suppression was specific to a subset of conditional NPC mutant
phenotypes and did not appear to be related to the general endoplasmic
reticulum mutants tested.
|
High-copy vectors harboring GLE1,
GLE2, NIC96, NPL4, and KAP95 were
tested for their ability to suppress the nup116-C lethal phenotype (data for GLE1, our unpublished results). Others
have reported that high-copy NPL4, which encodes an
NPC-associated protein, can partially suppress the growth defect of
nup116
cells at 37°C (DeHoratius and Silver, 1996
);
however, overexpressed NPL4 did not suppress the
nup116-C lethal phenotype (Figure 9B). The import factor
Kap95p physically interacts with Nup116p, whereas the nuclear export
factor Gle1p genetically interacts with Nup116p (Iovine et
al., 1995
; Murphy et al., 1996
; Murphy and Wente, 1996
; Iovine and Wente, 1997
), but neither high-copy
KAP95 nor GLE1 suppressed the nup116-C
growth defect. Interestingly, high-copy GLE2 and
NIC96 rescued the nup116-C lethal phenotype at
23°C. Like SNL1, GLE2 and NIC96 did
not allow growth of nup116
cells at 37°C. Therefore, an
additional genetic link between the functions of
NUP116, GLE2, NIC96, and
SNL1 was demonstrated. Moreover, only a subset of factors
with reported genetic and/or physical associations with Nup116p were
either rescued by SNL1 or prevented nup116-C lethality. These specific genetic interactions imply a possible functional or physical interaction among these proteins.
Gle2p Interacts In Vitro with the N-Terminal Region of Nup116p
To test whether there was a physical basis for the genetic
interactions between NUP116, GLE2, and
NIC96, an in vitro analysis for direct
protein-protein interactions was conducted. Various combinations of
35S-labeled FL Gle2p [tagged at the C terminus with the HA
epitope (Murphy et al., 1996
)], FL Nic96p, and FL or
deleted/truncated Nup116p proteins were cotranslated in reticulocyte
lysates. The proteins were translated with approximately equal
efficiency. Gle2p was observed as a doublet (Figure
10A, lane 1, and C,
lane 2), possibly reflecting either differential in vitro translational initiation at the multiple methionines present in the N-terminal region
of Gle2p or posttranslational modification. We have also observed
endogenous Gle2p as a doublet when isolated from enriched, detergent-solubilized NPCs (Murphy et al., 1996
). To detect
interactions, mixtures of in vitro expressed proteins were incubated
with either affinity-purified rabbit polyclonal antibodies generated
against the GLFG region of Nup116p (Figure 10, A and B) or mouse
mAb12CA5 recognizing the Gle2p-HA epitope (Figure 10C). Bound proteins
were isolated with protein A-Sepharose resin and analyzed using
SDS-PAGE and autoradiography. The doublet from Gle2p was quantitatively isolated only in the presence of Nup116p. Gle2p was not
immunoprecipitated in the absence of Nup116p (Figure 10B, lane 1) or
with the first 591 residues of Nup145 (Figure 10B, lane 5). Similar
experiments with Nic96p did not detect any specific
coimmunoprecipitation with either Nup116p alone or with the
Nup116p-Gle2p complex (our unpublished results). In a recent study,
Nup116p and Gle2p copurified from total yeast nuclei lysates in a
complex along with Kap95p and several other unidentified nuclear
proteins (Iovine and Wente, 1997
). Therefore, these results suggested a
probable direct interaction between FL Nup116p and Gle2p.
|
Because high-copy GLE2 rescued the nup116-C
phenotype, Gle2p could mediate this activity by directly interacting
with the C-terminal region of Nup116p. To determine the region of
Nup116p that mediated in vitro binding to Gle2p, plasmids encoding
N-terminal and C-terminal Nup116p deletions were tested (Figure 10).
Nup116p lacking the N-terminal 180-amino acid residues did not
immunoprecipitate Gle2p (Figure 10B, lane 3), whereas Nup116p, lacking
the CC-region (last 194 amino acids), was capable of binding Gle2p
(Figure 10B, lane 4). These results correlate with our previous tests
in the two-hybrid assay, wherein FL Gle2p did not interact with the
GLFG or C-terminal regions of Nup116p (Murphy et al., 1996
).
Interestingly, a fragment of the N-terminal region alone (first 180 residues) specifically bound Gle2p (Figure 10C, lane 5). Therefore, the
N-terminal region of Nup116p was both necessary and sufficient for the
in vitro Gle2p-Nup116p interaction.
| |
DISCUSSION |
|---|
|
|
|---|
To identify mediators of NPC structure and function, we characterized a lethal nup116-C mutant phenotype in the yeast Saccharomyces cerevisiae. We report here the genetic isolation of SNL1 as a high-copy suppressor of the nup116-C lethality. SNL1 encodes a novel integral membrane protein localized to both the nuclear and endoplasmic reticulum membranes. Further analysis has suggested specific links between the role of Snl1p and at least three soluble NPC-associated proteins: Nup116p, Gle2p, and Nic96p. Since relatively little is known about the factors required for the biogenesis and maintenance of NPC structure, these results may have important implications for NPC function.
The hypothesis that Snl1p has a role in NPC structure is based on
several observations. First, high-copy SNL1 specifically rescues the growth of mutants with perturbed NPC/nuclear envelope structure. In Figure 11, the genetic
and physical interactions highlighted by the results in this report are
diagrammed. The actions of SNL1, NUP116,
GLE2, NIC96, and POM152 have been linked for
the first time in several different ways. High-copy SNL1, GLE2, and NIC96 all suppress nup116-C
lethality, and high-copy SNL1 suppresses the temperature
sensitivity of gle2-1 and nic96-G3 mutants. The
nic96-G3 (previously reported as gle3) and
gle2-1 mutant alleles are synthetically lethal with a null
allele of the closely related nup100 (Murphy et
al., 1996
). POM152 is included in this scenario based
on a report by others that a nic96 mutant allele is
synthetically lethal with the pom152 null mutant (Aitchison et al., 1995
). The specificity of these genetic interactions
and the fact that the nup116 and gle2 null
alleles are not high-copy suppressed strongly suggests that the
function of the encoded polypeptides is closely connected. Second,
Snl1p is only the second reported yeast integral membrane protein with
a functional connection to NPCs, the other is Pom152p (Wozniak et
al., 1994
), and critical roles for integral membrane proteins are
implicit in the proposed models for NPC function and biogenesis. The
entire length of Snl1p is homologous to a portion of Pom152p that
flanks the single membrane-spanning segment (Figure 4). Interestingly,
our results have shown that Snl1p is oriented as a type I membrane
protein, whereas Pom152p topology is predicted to be type II (Wozniak
et al., 1994
). If the sequence homology is significant,
Pom152p may in fact be a type I membrane protein with the bulk of its
mass cytoplasmically exposed. Experimental determination of Pom152p
topology will be required to test this model.
|
It is intriguing that nup116-C and gle2-1
mutants exhibit similar herniation phenotypes under lethal growth
conditions, and that they are both suppressed by overexpression of a
gene encoding an integral membrane protein, SNL1. In
addition, although nic96 mutants do not exhibit any
NPC/nuclear envelope herniated structures, nup188 mutants
that are synthetically lethal with nic96 have extensive nuclear envelope perturbations and herniation-like structures (Nehrbass et al., 1996
; Zabel et al.,
1996
). At this point, we predict that the increased levels of the
integral membrane protein Snl1p have a stabilizing influence on these
particular NPC mutants. If overexpressed Snl1p stabilizes mutant NPC
structures that are predisposed to forming herniation-like structures,
endogenous Snl1p may have a similar stabilizing role during NPC
biogenesis. We predict that Snl1p will be both spatially and temporally
poised for stabilization of either the pore membrane fusion event, the newly formed pore, or the assembling NPC substructures.
Alternatively, Snl1p may have a general endoplasmic reticulum function
that is indirectly required for normal nuclear envelope and NPC
function. The localization of Snl1p in both endoplasmic reticulum and
nuclear membranes is consistent with this hypothesis. Moreover, three
other proteins with primary roles in endoplasmic reticulum function
have reported connections to NPC structure and function. A mutant
allele of ACC1 (mtr7-1/acc1-7-1), encoding an
enzyme required for fatty acid biosynthesis, inhibits RNA export and
perturbs nuclear envelope structure (Mishina et al., 1980
; Schneiter et al., 1996
). Nuclear transport defects are also
observed with SEC63 mutants (npl1), a protein
required during polypeptide translocation across the endoplasmic
reticulum (Rothblatt et al., 1989
; Sadler et al.,
1989
). A fraction of Sec13p, a component of the COPII coatomer complex,
is coprecipitated with a subcomplex of NPC proteins (Barlowe et
al., 1994
; Siniossoglou et al., 1996
). However, in
terms of SNL1 function, the lack of
mtr7-1/acc1-7-1, sec17-1, and
sec18-1 suppression by high-copy SNL1 highlights a potential functional specificity for Snl1p at the NPC.
We previously predicted that the different structural regions of
Nup116p would have distinct roles in NPC function (Wente et
al., 1992
). Moreover, we proposed that the respective FG and GLFG
regions are functionally unique from one another (Rout and Wente, 1994
;
Iovine et al., 1995
). The GLFG region may be involved in
nuclear export processes by interacting with exporting factors (Stutz
et al., 1995
; Fritz and Green, 1996
; Murphy and Wente, 1996
;
Stutz et al., 1996
; Iovine and Wente, 1997
; Powers et
al., 1997
). In particular, a nuclear export sequence-dependent
interaction of the nuclear import factor Kap95p with the GLFG region of
Nup116p has been characterized (Iovine and Wente, 1997
), and supports models for the GLFG region serving as a docking site for Kap95p recycling and nuclear exit. In contrast, the N-terminal region of
Nup116p was both necessary and sufficient for binding Gle2p in vitro
(Figure 10). This suggests that the N-terminal region is required for
docking Gle2p at the NPC and may mediate the role of Gle2p in RNA
export (Murphy et al., 1996
). Overall, our results suggest
that both the N-terminal FG and the GLFG regions of Nup116p mediate
nuclear export steps via interaction with distinct factors. These
interactions likely have significance in vivo because Nup116p, Gle2p,
and Kap95p coimmunoprecipitate in a complex from total yeast nuclei
lysates (Iovine and Wente, 1997
).
There are at least two possible mechanisms by which Snl1p could be connected to the function of Nup116p, Gle2p, and Nic96p: 1) Snl1p could directly interact with one or more of these peripheral membrane proteins or 2) Snl1p could associate with NPCs through an unidentified, intervening factor(s). Our preliminary membrane topology results suggest that the vast majority of the Snl1p is cytoplasmically exposed, and therefore direct protein-protein interactions between Snl1p and peripheral nucleoporins are possible. Because the SNL1 genetic suppression is specific to the nup116-C and gle2-1 mutant alleles (it does not suppress the corresponding null mutants), Snl1p is a good candidate for interaction with either the C-terminal region of Nup116p or with Gle2p, and direct tests are in progress. Determining which proteins directly interact with Snl1p will be critical for understanding its function.
If Snl1p does not interact with the C-terminal region of Nup116p, the factor that directly interacts with this region may be one of the remaining high-copy suppressors of the nup116-C lethal phenotype. GLE2 and NIC96 were not identified in the original analysis, reflecting the fact that the high-copy genetic screen for nup116-C suppressors was not saturating. Indeed SNL1 was identified from characterization of only 19 of the original 178 isolates. Revealing the factors that interact with the C-terminal region of Nup116p may provide insight into the maintenance of NPC structure and NPC-pore membrane interactions.
| |
ACKNOWLEDGMENTS |
|---|
We are indebted to our colleagues K. Iovine and J. Watkins for noting the lethal nup116-C phenotype and to R. Murphy for isolation of gle3. We thank J. Watkins for excellent technical assistance; Lori LaRose and Marilyn Levi for assistance with the electron microscopy; and numerous colleagues for generously sharing reagents: A. Tartakoff for the mtr7-1/acc1-7-1 strain; M. Latterich and R. Schekman for the sec17-1 and sec18-1 strains; P. Silver for the npl4 reagents; R. Wozniak for the pom152 strain; M. Bucci for the nup133 strain; M. Rose for the Kar2p antibody; R. Fuller for the Kex2p antibody; and C. Strambio-de-Castillia, G. Blobel, and M. Rout for the mAb118C3 antibody. K. Iovine, R. Murphy, M. Bucci, C. Nicchitta, D. Schnell, and K. Blumer provided valuable comments on the article and critical discussions. This work was supported by a grant from the National Institutes of Health, GM-51219, to S.R.W.
| |
FOOTNOTES |
|---|
* Corresponding author.
Abbreviations used: BAPTA,
1,2-bis-(O-Aminophenoxy)-ethane-N,N,N
,N
-tetra
acetic acid; FG, phenylalanine-glycine; GLFG, glycine-leucine-phenylalanine-glycine; GST, glutathione
S-transferase; NEM, N-ethylmaleimide; NPC, nuclear
pore complex; NRM, nucleoporin RNA-binding motif;
, null.
| |
REFERENCES |
|---|
|
|
|---|
ends encode secreted and intracellular forms of yeast invertase.
Cell
28, 145-154[Medline].
-S, and BAPTA.
J. Cell Biol.
132, 5-20This article has been cited by other articles:
![]() |
T. R. Dawson, M. D. Lazarus, M. W. Hetzer, and S. R. Wente ER membrane-bending proteins are necessary for de novo nuclear pore formation J. Cell Biol., March 9, 2009; 184(5): 659 - 675. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Miao, K. J. Ryan, and S. R. Wente The Integral Membrane Protein Pom34p Functionally Links Nucleoporin Subcomplexes Genetics, March 1, 2006; 172(3): 1441 - 1457. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Miller, M. Suntharalingam, S. L. Johnson, A. Audhya, S. D. Emr, and S. R. Wente Cytoplasmic Inositol Hexakisphosphate Production Is Sufficient for Mediating the Gle1-mRNA Export Pathway J. Biol. Chem., December 3, 2004; 279(49): 51022 - 51032. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Suntharalingam, A. R. Alcazar-Roman, and S. R. Wente Nuclear Export of the Yeast mRNA-binding Protein Nab2 Is Linked to a Direct Interaction with Gfd1 and to Gle1 Function J. Biol. Chem., August 20, 2004; 279(34): 35384 - 35391. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Sondermann, A. K. Ho, L. L. Listenberger, K. Siegers, I. Moarefi, S. R. Wente, F.-U. Hartl, and J. C. Young Prediction of Novel Bag-1 Homologs Based on Structure/Function Analysis Identifies Snl1p as an Hsp70 Co-chaperone in Saccharomyces cerevisiae J. Biol. Chem., August 30, 2002; 277(36): 33220 - 33227. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Marelli, C. P. Lusk, H. Chan, J. D. Aitchison, and R. W. Wozniak A Link between the Synthesis of Nucleoporins and the Biogenesis of the Nuclear Envelope J. Cell Biol., May 7, 2001; 153(4): 709 - 724. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Yoon, D. C. Love, A. Guhathakurta, J. A. Hanover, and R. Dhar Mex67p of Schizosaccharomyces pombe Interacts with Rae1p in Mediating mRNA Export Mol. Cell. Biol., December 1, 2000; 20(23): 8767 - 8782. [Abstract] [Full Text] |
||||
![]() |
A. K. Ho, T. X. Shen, K. J. Ryan, E. Kiseleva, M. A. Levy, T. D. Allen, and S. R. Wente Assembly and Preferential Localization of Nup116p on the Cytoplasmic Face of the Nuclear Pore Complex by Interaction with Nup82p Mol. Cell. Biol., August 1, 2000; 20(15): 5736 - 5748. [Abstract] [Full Text] |
||||
![]() |
W. A. Whalen, J. H. Yoon, R. Shen, and R. Dhar Regulation of mRNA Export by Nutritional Status in Fission Yeast Genetics, July 1, 1999; 152(3): 827 - 838. [Abstract] [Full Text] |
||||
![]() |
H. J. Chial, M. P. Rout, T. H. Giddings Jr., and M. Winey Saccharomyces cerevisiae Ndc1p Is a Shared Component of Nuclear Pore Complexes and Spindle Pole Bodies J. Cell Biol., December 28, 1998; 143(7): 1789 - 1800. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bucci and S. R. Wente A Novel Fluorescence-based Genetic Strategy Identifies Mutants of Saccharomyces cerevisiae Defective for Nuclear Pore Complex Assembly Mol. Biol. Cell, September 1, 1998; 9(9): 2439 - 2461. [Abstract] [Full Text] |
||||
![]() |
S. M. Bailer, C. Balduf, J. Katahira, A. Podtelejnikov, C. Rollenhagen, M. Mann, N. Pante, and E. Hurt Nup116p Associates with the Nup82p-Nsp1p-Nup159p Nucleoporin Complex J. Biol. Chem., July 28, 2000; 275(31): 23540 - 23548. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Strawn, T. Shen, and S. R. Wente The GLFG Regions of Nup116p and Nup100p Serve as Binding Sites for Both Kap95p and Mex67p at the Nuclear Pore Complex J. Biol. Chem., February 23, 2001; 276(9): 6445 - 6452. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||