![]() |
|
|
Vol. 9, Issue 2, 497-511, February 1998
Department of Molecular Genetics & Cell Biology, The University of Chicago, Chicago, Illinois 60637
Submitted September 8, 1997; Accepted November 5, 1997| |
ABSTRACT |
|---|
|
|
|---|
Formation and discharge of dense-core secretory vesicles depend on controlled rearrangement of the core proteins during their assembly and dispersal. The ciliate Tetrahymena thermophila offers a simple system in which the mechanisms may be studied. Here we show that most of the core consists of a set of polypeptides derived proteolytically from five precursors. These share little overall amino acid identity but are nonetheless predicted to have structural similarity. In addition, sites of proteolytic processing are notably conserved and suggest that specific endoproteases as well as carboxypeptidase are involved in core maturation. In vitro binding studies and sequence analysis suggest that the polypeptides bind calcium in vivo. Core assembly and postexocytic dispersal are compartment-specific events. Two likely regulatory factors are proteolytic processing and exposure to calcium. We asked whether these might directly influence the conformations of core proteins. Results using an in vitro chymotrypsin accessibility assay suggest that these factors can induce sequential structural rearrangements. Such progressive changes in polypeptide folding may underlie the mechanisms of assembly and of rapid postexocytic release. The parallels between dense-core vesicles in different systems suggest that similar mechanisms are widespread in this class of organelles.
| |
INTRODUCTION |
|---|
|
|
|---|
Dense-core secretory vesicles, also called secretory granules, are
specialized vesicles with a condensed protein core (Halban and
Irminger, 1994
). The vesicle core can be described as a dynamic aggregate. First, it is assembled within the secretory pathway from
previously soluble proteins. Conversion of a set of soluble proteins to
a temporarily insoluble form can serve diverse functions, including
their efficient storage in a state that imposes a reduced osmotic
burden. Secondly, when an appropriate exocytic stimulus triggers the
fusion of the vesicle membrane with the plasma membrane, the
dissemination of the secreted contents involves re- or dis-assembly of
the core. Granule core dynamics exemplify the potential for compartment-specific regulation of protein interactions in the secretory pathway (Arvan and Castle, 1992
), and offer the opportunity to investigate the underlying mechanisms.
Interactions among proteins in transit may be influenced by their
microenvironments, as for example gradients of pH and calcium concentration within and between secretory compartments. The potential importance of such modulation is not limited to granule assembly. For
example, the assembly of T-cell receptor subunits may be controlled by
their calcium-specific binding to BiP (Suzuki et al., 1991
), and ligand-binding by the ER retrieval receptor may be regulated by the
pH difference between the ER and the Golgi (Wilson et al., 1993
). For proteins forming the dense cores of neuroendocrine granules,
a combination of these factors in the TGN and newly formed secretory
vesicles have been implicated in the induction of
aggregation/condensation (references in Natori and Huttner, 1996
).
The regulation of core assembly and dispersal may involve several
mechanisms, two of which are considered here. The first is direct
modulation of protein folding by the succession of ionic environments
experienced during transport. Such conformational maturation has been
suggested in the case of newly synthesized proinsulin and several
other secreted proteins, on the basis of progressive changes in the
accessibility of protein disulfide bonds (references in Huang and
Arvan, 1995
). Second, regulation may be indirect, as exemplified by the
action of granule-specific endoproteases called prohormone convertases
(Rouille et al., 1995
). Many well-studied neuroendocrine
granule core proteins are synthesized as proproteins and cleaved during
granule maturation by prohormone convertases, to generate the
biologically active polypeptides.
Ciliated protozoa are useful organisms for studying granule synthesis
and function (Hutton, 1997
), in part because the sequential transitions
that characterize neuroendocrine granules have also been well-described
in several of these organisms (Adoutte, 1988
; Peck et al.,
1993
). In addition, several species are genetically and biochemically
accessible. In both Tetrahymena thermophila and
Paramecium tetraurelia, granule core synthesis occurs by
assembly of soluble proteins into an insoluble, well-ordered lattice
(Anderer and Hausmann, 1977
). Organization of core proteins as a
crystalline lattice is also a feature of some metazoan granules (Tooze
et al., 1989
). The second core transition is postexocytic
decondensation. In ciliates this takes the form of a rapid spring-like
expansion of the core lattices, projecting them from the cell (Anderer
and Hausmann, 1977
). In an analogous manner, granule core expansion in
several mammalian cell types can also facilitate rapid dispersal of
core contents (reviewed in Rahaminoff and Fernandez, 1997
).
Normal core assembly, in both neuroendocrine cells and ciliates, is
strongly correlated with proteolytic processing in the maturing granule
(Adoutte et al., 1984
; Orci et al., 1987
;
Turkewitz et al., 1991
). The mechanisms by which processing
facilitates or drives core assembly are not known, but may be related
to structural differences between proproteins and their products.
Little information is available addressing these issues, particularly
regarding changes as prohormones are processed to mature forms.
Mechanisms involved in postexocytic decondensation are also largely
unknown. The mechanism of lattice expansion in Paramecium
involves binding of extracellular calcium (Bilinski et al.,
1981
; Lima et al., 1989
), but the protein targets are
difficult to analyze because the lattice is estimated to consist of
more than 100 proteins (Madeddu et al., 1995
). Lattice composition in Tetrahymena appears less complex, although
only the pattern of polypeptide bands has thus far been described
(Maihle and Satir, 1986
). Expansion has been shown to depend in vivo on the presence of the abundant core protein, Granule
lattice protein 1 (Grl1p), although its precise role is unknown (Chilcoat
et al., 1996
). A suggestive hint is that Grl1p binds calcium
in vitro. Any model explaining how extracellular calcium triggers
expansion must take account of the fact that early compartments of the
secretory pathway, through which granule proteins must initially be
transported, are also likely to contain high levels of free calcium
(Pozzan et al., 1994
; Sambrook, 1990
).
Understanding granule assembly and disassembly will require analysis of
the set of core proteins in a manipulable model system. The range of
powerful molecular genetic tools including gene replacement that have
recently been developed in T. thermophila make this organism
an attractive choice (Cassidy-Hanley et al., 1997
; Gaertig and Gorovsky, 1995
; Sweeney et al., 1996
; Yao and Yao,
1991
). We have begun by identifying the set of abundant core
polypeptides that bind calcium in vitro. Their cloning and initial
characterization are described in this article. To understand how these
proteins and their interaction with calcium may contribute to the
dynamics of the granule core, we have tried to correlate the
morphological transitions during both core synthesis and disassembly
with changes in individual proteins. The availability of characterized
exocytosis mutants facilitated the analysis of granule proteins before
and after both proteolytic processing and exocytosis (Orias et
al., 1983
)(Melia et al., in press). The results are
consistent with the idea that one function of compartmentalization in
the secretory pathway is the regulation of protein interactions through
programmed changes in their folding.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Reagents were from Sigma Chemical Co. (St. Louis, MO) unless otherwise noted.
Cells and Cell Culture
Cells were grown at 30°C with agitation in 2% proteose
peptone, 0.2% yeast extract (both from Difco Laboratories, Detroit, MI) with 0.003% ferric EDTA. All Tetrahymena strains were
derived from the inbred B strain. Tetrahymena strains are
described by their micronuclear diploid genotype, followed by their
macronuclear-determined phenotype in parentheses (Bruns, 1986
). The
heterokaryon strain CU428.1, mpr1-1/mpr1-1 (mp-s, VII) was
provided by Peter Bruns (Cornell University, Ithaca, NY) and is wild
type with respect to exocytosis. Strain MN173,
mpr1-1/mpr1-1 (mp-r, V) is an exocytosis-defective strain
in which granules accumulate in the cytoplasm rather than docking at
the plasma membrane (Melia et al., in press). Strain SB281,
gal1-1/gal1-1 (dg-r, III), isolated by (Orias et
al., 1983
) and provided by Ed Orias (UC Santa Barbara) is a mutant
in which granule proproteins fail to undergo normal proteolytic
processing (Ding et al., 1991
)(Turkewitz et al.,
1991
).
In Vitro Calcium Binding
45Ca was incubated with nitrocellulose transfers of
granule proteins as described by (Volpe et al., 1988
).
Samples were visualized using a PhosphorImager (Molecular Dynamics,
Sunnyvale, CA).
Cloning of Genes Encoding Granule Proteins
On the basis of findings presented in this article, it appears that single granule protein precursors may generate at least two stable fragments. To indicate these, we will adopt the following convention. The precursor of Grl4p before processing (not including removal of the signal peptide) will be referred to as proGrl4p. The amino-terminal fragment of Grl4p will be referred to as N-Grl4p, and the carboxyl-terminal fragment as C-Grl4p.
Granule proteins were isolated, separated by SDS-PAGE on 20% gels,
transferred to a polyvinylidene difluoride membrane, and lightly
stained with Coomassie blue as previously described (Chilcoat et
al., 1996
). Bands corresponding to those which bound calcium in
vitro on nitrocellulose membranes were excised and subjected to
amino-terminal sequencing (Carol Beach, University of Kentucky; Mark
Crankshaw, Washington University, St. Louis, MO). Degenerate oligonucleotide primers were designed from these peptide sequences on
the basis of known codon usage (Martindale, 1989
) and paired with
vector-specific primers for PCR amplification from a cDNA library
kindly provided by Tohru Takemasa (Tsukuba, Japan). The vector-specific
forward primer was: AGCAAGTTCAGCCTGGTTAAG; the reverse
primer was CTTATGAGTATTTCTTCCAGGGTA. Peptide-based primers were designed corresponding to the following sequences: in proGrl3p, residues 234-239; in proGrl4p, residues 246-252 and 228-234; in proGrl5p, residues 75-80; in proGrl7p, residues 71-76. PCR conditions were as follows: 94°C, 15 s; 5 × [92°C, 30 s;
50°C, 30 s; 72°C, 60 s]; 24 × [92°C, 15 s;
50°C, 30 s; 72°C, 60 s]; 72°C, 10 min. The buffer was 50 mM
KCl, 50 mM Tris-HCl pH 9, 1% Triton X-100 (Boehringer Mannheim,
Indianapolis, IN), 2.5 mM MgCl2, 1 µM in each primer,
0.25 mM dNTPs and 2.5U Taq polymerase. A limited number of
bands were produced in each reaction, which were then cloned and
sequenced to confirm the presence of the expected peptide sequence
adjacent to the peptide-based primer sequence. Nondegenerate oligonucleotides were designed on the basis of the sequences of the
positive clones, and used to amplify the remaining portions of the
cDNAs from the library. Clones were sequenced by primer walking.
Potential sequencing errors resulting from the degeneracy of the
initial primers or incorporation of errors in the initial clones were
rectified by direct sequencing of the amplification products of genomic
and cDNA. Sequence analysis was using the Lasergene software (DNAStar,
Madison, WI).
Preparation of Cell Lysates and Secretory Granules
Two hundred milliliters of cells were grown overnight to
stationary phase, then rapidly chilled and pelleted at 150 × g for 5 min in conical bottles. All subsequent operations
were performed cold. Cells were washed once in 10 mM K-HEPES pH 7.0;
the pellet was then measured, washed, and resuspended in 2 volumes of
buffer A [0.3 M sucrose, 10 mM K-HEPES pH 7, 28.8 mM KCl, 2 mM
MgCl2, 2 mM EGTA (Fluka, Ronkonkoma, NY)] containing 0.1%
gelatin and the following protease inhibitors: leupeptin (0.5 µg/ml),
antipain (12.5 µg/ml), E-64 (10 µg/ml) and chymostatin (10 µg/ml). The resuspended pellet was homogenized by ~15 passages
through a ball-bearing cell cracker (Hans Issel, Palo Alto, CA) with a
nominal clearance of 0.0005 in. The entire homogenate was pelleted at
200,000 × g for 2 h. The supernatant was
withdrawn and the pellet was resuspended in 1-2 ml of Buffer A lacking
sucrose, to induce hypotonic lysis of membrane-bound organelles.
Aliquots were frozen in liquid nitrogen and stored at
80°C.
Isolated secretory granules were prepared from lysates of MN173 cells
as previously described (Chilcoat et al., 1996
). Protein concentrations were determined using bicinchoninic acid (Pierce, Rockford, IL).
Calcium Concentrations
All noncalcium-containing buffers included 2 mM EGTA (Fluka,
Ronkonkoma, NJ). To adjust calcium concentrations, samples were mixed
with equal volumes of the same buffer but containing CaCl2. Compositions of calcium buffers were calculated following Fabiato and
Fabiato (1979)
. The pH of calcium-containing stocks was preadjusted with KOH to balance the acidification that occurs when calcium is added
to EGTA-containing buffers. The pH in these experiments did not shift
by more than 0.05 units.
Heat Solubilization
Isolated DCGs in Buffer A (with added calcium where noted) were incubated for 30 min at 95°C, and then centrifuged at room temperature, either for 20 min at 17,000 × g in an Eppendorf centrifuge (Brinkmann Instruments, Westbury, NY), or for 2 h at 150,000 × g in an SW50.1 rotor (Beckman Instruments, Carlsbad, CA).
Protein Electrophoresis and Antibody Blotting
SDS-PAGE was performed according to (Laemmli, 1970
).
Quantitation of Coomassie Blue-stained bands was using a computing
densitometer (Molecular Dynamics, Sunnyvale, CA). Antibody blotting was
according to (Towbin et al., 1979
), and antibodies were
visualized using the ECL system (Amersham, Arlington Hts, IL). The
rabbit antiserum specific for Grl1p (previously called p40) has been
described (Turkewitz et al., 1991
).
Proteolytic Digestion
Preincubations of samples with Triton X-100, CaCl2 (Fluka, Ronkonkoma, NJ) or EGTA were for 10 min on ice. Chymotrypsin (Worthington, Freehold, NJ) was added from a stock solution of 10 mg/ml in 50% glycerol. Digestion was on ice for 45 min, and was terminated by addition of PMSF to a concentration of 2 mM. After 20 min, samples were solubilized by addition of an equal volume of hot SDS-PAGE sample buffer containing 2% SDS and 10% 2-mercaptoethanol, and incubated for 3 min at 100°C.
Electron Microscopy
All reagents were from EM Sciences (Ft. Washington, PA). Cells were fixed in 2% glutaraldehyde, 0.5% osmium tetroxide, 1.3 mM sodium phosphate pH 7.0, 0.5% sucrose for 1 h at room temperature. After partial dehydration, cells were stained for 1 h with 1% uranyl acetate in 70% ethanol. After dehydration through a graded series of ethanol solutions and propylene oxide, samples were embedded in EMbed 812. Sections were stained with uranyl acetate and lead citrate, and viewed using a JEOL CX100 electron microscope. Purified granules were fixed overnight as pellets in 2% glutaraldehyde, 1% osmium tetroxide in buffer A, and processed as above. Purified granules were adsorbed to carbon-coated grids and stained with 2% sodium phosphotungstate near pH 7. Negative staining of expanded granules was with 2% uranyl acetate.
| |
RESULTS |
|---|
|
|
|---|
Expansion of Granule Cores in the Presence of Calcium
The secretory granules in Tetrahymena, called mucocysts, are docked near the plasma membrane in resting cells (Figure 1A). Granules can be readily isolated from the exocytosis-defective strain MN173, where they fail to dock but instead accumulate in the cytoplasm. Negative staining of such isolated condensed granules shows a dense protein lattice that constitutes their core (Figure 1B). Cores are exposed to the high concentration of extracellular calcium after exocytic membrane fusion of the granule and plasma membranes. To test whether calcium could trigger lattice expansion, we first incubated pellets of isolated granules with nonionic detergent to remove the limiting membrane, and then exposed them to 1 mM calcium. This treatment led to notable expansion of the pellet size, suggesting that expansion of the lattices had occurred (our unpublished observations). Negative staining of isolated granules using uranyl acetate allowed visualization of the expanded granules, which increase in length by >sixfold while maintaining a lattice structure (Figure 1C). Expansion upon exocytosis in vivo drives the rapid release of core proteins within seconds, as illustrated in Figure 1D. The process may occur through a series of ordered states, since intermediate expanded forms can be identified within individual granules (Figure 1E).
|
Identification of Calcium-binding Proteins
To identify components that underlie this dramatic expansion
and/or the process of core assembly, isolated granules were subjected to SDS-PAGE, transferred to nitrocellulose, and overlaid with 45Ca. Previous work had demonstrated in vitro calcium
binding activity of Grl1p (Granule lattice
protein 1), a 24-kDa polypeptide that migrates, however,
with a MWa of 40 kDa (Turkewitz et al., 1991
). Subsequently, a change in gel running conditions to resolve smaller species revealed a set of abundant polypeptides that also show in vitro
calcium binding activity (Figure 2). In
contrast, none of the proteins of MWa > 40 kDa, of which
three are prominent, shows calcium binding. We prepared seven prominent
bands below 40 kDa for amino terminal sequencing. On the basis of
densitometry of Coomassie Blue-stained gels, these polypeptides make up
more than 80% of total granule protein. With the exception of
the single smallest band, which gave more than one residue at each
position, each polypeptide yielded a unique sequence. Sequences
obtained are shown in Table
1, along with the
MWa of the fragments from which they were derived.
|
|
Cloning and Sequence Analysis of Granule Lattice Proproteins
PCR using degenerate oligonucleotide primers, in combination
with vector-based primers, was used to amplify the corresponding genes
from a
gt10 cDNA library. Sequencing of the cloned genes established
unique open reading frames encoding the expected polypeptide sequence,
and each conformed to the expectations for Tetrahymena codon
usage and AT-rich nontranslated regions. Sequence analysis revealed
that the six polypeptides are derived from four precursors that range
in size from 377-402 residues. Together with the previously described
GRL1 gene product, these proteins can be considered to
constitute a family of granule lattice proproteins (proGrlps). Each
begins with a signal sequence, and features of interest are diagrammed
in Figure 3, while the sequences
themselves are shown in Figure 4. For the
purposes of comparison, proGrl1p is also included. A panel of features
is generally duplicated within each precursor. First, each proGrlp
contains two large blocks of predicted coiled-coil-forming residues.
The heptad repeats that are predicted to form these coiled-coils are
nearly continuous in some cases, and more fragmented in others. These
blocks have a high density of negatively charged residues, with the
result that these proteins are all calculated to be strongly acidic,
and predicted to bind calcium with low affinity. The calculated acidity
of granule polypeptides is consistent with previous observations
(Maihle and Satir, 1986
)(Turkewitz, unpublished data). Preceding each
block of coiled-coils is a small stretch with a high concentration of
positively charged residues. In proGrl1p and proGrl3p, the basic block
near the amino terminus is absent. The amino termini of granule core
polypeptides derived from these precursors are located directly
following the basic stretches, suggesting that these regions are
directly or indirectly recognized by processing proteases. A notable
feature of these stretches is that they contain virtually all of the
methionine residues in the proteins. Every internal methionine in the
proGrlps lies within or very close to a basic stretch, and only one
basic stretch lacks a methionine. The conservation of a methionine
residue strongly suggests its functional significance, since it, along with tryptophan, is the amino acid most susceptible to change by point
mutation.
|
|
Overall sequence identity between the proGrlps is not greater than 22% between any two members, a substantial part derived from common residues that define the coiled-coil-forming heptad repeats (Figure 4). The similarities between the proGrlps suggest that they may fold into related structures. The approximate repeat of features noted in each protein may reflect gene fusion or duplication. ProGrl5p in particular contains a suggestive internal repeat between the amino- and carboxyl-terminal halves, as shown in Figure 5.
|
In general, conservation of structure rather than specific sequence is
consistent with a role for the Grlps in forming the architectural units
of the dense core lattice. This impression was reinforced by a search
of the protein sequence database. The most similar sequences were in
granule proteins of Paramecium, called trichnins or
trichocyst matrix proteins (Tmps), which also form an expandable
lattice structure (Gautier et al., 1996
). Examination of the
three known Tmp sequences revealed that they encode similarly sized
proteins with comparable blocks of coiled-coil regions, also preceded
by methionine-rich basic stretches (Figure 4). The proGrlps share
approximately the same level of sequence identity with the Tmps as they
do with one another. In addition to the pattern of structural
similarity without sequence conservation, there are also small regions
of sequence identity, described below, that are shared between
Paramecium and Tetrahymena proteins. The significance of this conservation is underlined by the fact that the
two ciliates diverged at least several hundred million years ago
(Wright and Lynn, 1997
), and suggests that the proteins are anciently
derived from common precursors.
Granule Proproteins Are Processed at Multiple Conserved Sites
Many metazoan granule polypeptides are derived by processing of precursors into nonoverlapping fragments by cleavage at multiple sites. This also occurs during granule synthesis in Tetrahymena. As shown in Table 1 and Figure 4, the N-termini of two abundant polypeptides were both located within the same precursor, proGrl4p. N-Grl4p begins at Gly63, and C-Grl4p began at Phe226 (see terminology in MATERIALS AND METHODS). Although we have not identified the C-termini of the fragments, the MWa of N-Grl4p (12.3 kDa) suggests that these are nonoverlapping fragments, because the predicted molecular mass for a polypeptide extending from residue 63 to 225 would be 18.4 kDa. The generation of the two fragments from proGrl4p can be explained by two distinct endoproteolytic processing events.
To characterize proprotein processing, we looked for conserved sequence
motifs near the known amino termini. Metazoan prohormone convertases
cleave at specific positions in their prohormone substrates (Rouille
et al., 1995
). Important residues at these positions include
both a target residue, after which cleavage occurs, and surrounding
residues that are likely to form specific secondary structures.
Sequence comparison between the proGrlps suggested at least three kinds
of processing sites. A first putative processing site was identified in
proGrl4p (generating N-Grl4p) and proGrl5p. In these, the residue
before the amino-terminus of the processed polypeptide is glycine,
which is also present at an equivalent position in three of the Tmps.
Comparison of all five sequences suggests the consensus shown in Figure
6A. We note that the spacing of conserved
hydrophobic residues within this consensus does not conform to a
standard heptad motif.
|
A second kind of site occurs in proGrl4p and proGrl7p, as well as in the previously cloned Grl1p. Cleavage occurs following a single basic residue (Lys188 in proGrl1p, Lys225 in proGrl4p, Arg56 in proGrl7p) (Figure 6B). In the first two, this site is associated with a fragment generated from the carboxyl-terminal half of the proprotein, whereas in the last, the fragment comes from the amino-terminal half.
A third type of site is noted in proGrl3p, associated with the carboxyl-terminal fragment. Here the residue after which cleavage occurs appears to be Asn226 rather than a basic residue. Cleavage following Asn has also been deduced for a Paramecium Tmp. Several nearby residues are also common to both proteins (Figure 6C).
In addition to the sequences associated with cleavage sites, a conserved sequence that is not overtly associated with a cleavage site is located near the prominent central stretch of basic residues discussed above. Sequence conservation was not detected within the basic region itself but is evident in the faithful maintenance of a tetrapeptide at what may be considered the amino-terminal junction of the basic region (Figure 6D). The identical motif is also found in the corresponding position in Paramecium Tmps.
The implication of sequence conservation at cleavage sites is that two
to three distinct endoproteases are involved in processing of the
proGrlps. In addition to these endoproteases, the size of the processed
polypeptides indicates that exoproteases may also contribute to granule
protein maturation. Many of the isolated polypeptides appear to be
smaller than the sizes predicted by simple endoproteolytic cleavage of
precursors at the recognized motifs. For example, the predicted size of
C-Grl4p is 18.4 kDa, but the size estimated by SDS-PAGE is
approximately 12.5 kDa. More direct evidence for a carboxypeptidase
activity comes from sequencing data. Two well-resolved polypeptides
differing in MWa by ~1 kDa were found to have the
identical amino terminus (9/9 residues), corresponding to Phe226 in
proGrl4p. The difference between the two species, which appear to be of
roughly equal abundance on the basis of Coomassie Blue staining, was
unlikely to be attributable to nonphysiological proteolysis, since the
pattern of polypeptides appears identical whether isolated from
secreted protein or from isolated granules (Chilcoat et al.,
1996
). Another possible cause for such a mobility shift,
post-translational glycosylation, appears to be extremely limited, if
it occurs at all, in Tetrahymena granule proteins (Attanoos
and Allen, 1987
). Since Southern blotting also indicated that
GRL4 is a unique gene (our unpublished results), these two
species may be accounted for by alternative carboxyl-terminal trimming
of the same initial fragment.
In summary, the results of peptide sequencing and gene cloning indicate that the polypeptides comprising the bulk of Tetrahymena dense-cores are derived from five structurally related proproteins. These polypeptides form the basis for the ordered expandable lattice, and may therefore be expected to undergo rearrangements during assembly and disassembly. Since calcium binding and/or proprotein processing may contribute to regulation of these events, we designed experiments to detect their influence at the level of the polypeptides.
Assessment of Grlp Conformation by Proteolytic Digestion
Isolated demembranated granules were incubated in buffers of defined calcium concentration, and then exposed to protease. Products were analyzed by Coomassie staining after SDS-PAGE. We looked for changes in proteolytic patterns that might indicate altered accessibility of protease-sensitive sites. Since the electrophoretically separated Grlps can be individually recognized, this approach was well suited for assessing the mixture of proteins in the physiological lattice. In addition, we found that this assay could also be applied to crude cell lysates, followed by detection with specific antibodies on Western blots.
First, a variety of proteases were incubated with granule samples in the absence of calcium. The majority had no discernible effect on any of the proteins visualized by SDS-PAGE, indicating that the core proteins in general were highly protease resistant (our unpublished results). However, addition of chymotrypsin resulted in rather specific cleavage of Grl1p, with the appearance of 2 smaller products (Figure 7 lane 4). Higher concentrations of chymotrypsin produced 3 major proteolytic products, as visualized by antibody blotting with an antiserum against Grl1p (Figure 7 lanes 7, 9, 11). Similar results were obtained using hypotonically lysed particulate fractions of MN173 homogenates (Figure 7 lane 15). MN173 cells, in which the granules accumulate in a nondocked state, were used for these experiments to avoid the inevitable low level of exocytosis that occurs during preparation of wild-type lysates.
|
Effect of Calcium
Having establishing a baseline digestion pattern, we asked whether
addition of calcium would alter the chymotrypsin sensitivity of any
Grlps. In the presence of calcium, Grl1p became highly resistant to
chymotryptic digestion (Figure 7 lanes 5, 8, 10, 12). Other Grlps
did not show altered proteolytic sensitivity. The same result with
Grl1p was obtained using a crude particulate fraction (Figure 7 lane
16). The calcium-dependent decrease in protease sensitivity of Grl1p
suggested the polypeptide had adopted a more stable conformation.
Alternatively, it could indicate masking of an accessible site by bound
calcium or by another lattice component during expansion. Results
presented below argue strongly in favor of the first explanation.
Chymotrypsin itself is not inhibited by calcium (Fioretti et
al., 1994
); this was directly confirmed for these experimental
conditions in Figure 12.
Characterization of the Response to Calcium
To see whether the apparent change in Grl1p conformation might be
related to calcium-dependent expansion after exocytosis, we tested
three predictions. These also served to distinguish the role played by
calcium in this system from its known activity in regulation of many
cytosolic proteins, which occurs at low micromolar concentrations.
First, the calcium concentration required to promote the putative
conformational transition should be consistent with extracellular
levels. T. thermophila inhabits a variety of fresh water
bodies in which the range of calcium concentrations is roughly 0.1 to
several millimolar (Wetzel, 1983
). We exposed isolated granules to
chymotrypsin in calcium-buffered solutions, and found that the
transition to chymotrypsin resistance took place in the relevant range
of 0.1 to 1 mM calcium (Figure 8), where
in vitro granule expansion also occurs.
|
Granule expansion is a unidirectional process that is not reversed if
calcium is subsequently removed (Hayashi, 1974
). This suggests that
individual steps driving the reaction may also be unidirectional, and
we therefore examined the reversibility of the Grl1p transition.
Detergent-permeabilized granules were incubated with millimolar
calcium, and EGTA was subsequently added to reduce free calcium to less
than micromolar levels. Once exposed to calcium, Grl1p remained in a
chymotrypsin-resistant state (Figure 9
lanes 2, 3, 4). As a control, the addition of EGTA before calcium
prevented Grl1p from acquiring chymotrypsin resistance (Figure 9 lane
5). This also supports the expectation that calcium binding by Grl1p is
of low affinity and therefore not competitive with high affinity binding by EGTA.
|
Since the transition required exposure to calcium but not sustained
binding, these results could be explained by a model in which calcium
acts to lower a folding barrier, permitting a transition from a
metastable to a stable conformation. Such a folding barrier might also
be overcome by thermal energy. We accordingly tested whether a similar
transition could be promoted by heat-treatment. A small fraction of
Grl1p can be solubilized from secreted (expanded) lattices by
incubating them at elevated temperature (Turkewitz et al.,
1991
). We repeated this procedure, but substituted isolated condensed
granules as substrate. Heat treatment of condensed lattices results in
extensive and preferential release of Grl1p and a set of smaller Grlps
(Figure 10). Effective solubilization
of Grl1p was inhibited by preexposure to calcium (Figure 10 lane 3),
explaining the much smaller yield we previously observed from expanded
lattices. This may be a result of a change in lattice contacts upon
expansion. In the absence of calcium, soluble Grl1p was obtained from
the heat-treated supernatant after a 2 h, 150,000 × g spin.
|
The ability to isolate soluble Grl1p by heat treatment also made it possible to study its chymotrypsin sensitivity in the absence of an extended lattice, an issue discussed above. This soluble fraction was found to be strikingly resistant to chymotryptic digestion, similar to Grl1p in calcium-treated granules (Figure 11). In fact, no additional change in protease sensitivity was observed after addition of calcium to this preparation. In summary, these data indicate that chymotrypsin resistance does not depend on stabilization within an expanded lattice. Instead, protease resistance may reflect a stable conformation of Grl1p alone or in a soluble complex that does not depend on extensive lattice connections. Furthermore, both transient heating and transient exposure to calcium appear to produce a similar effect on Grl1p conformation. These data can be explained by a transition that occurs on discharge, involving the relaxation of a kinetically trapped intermediate.
|
Protein Folding during Granule Synthesis
Core assembly involves conversion of proteins from a soluble to insoluble form. In addition, the experiments described above hint at functional changes during this process; for example, Grl1p may be converted to calcium sensitivity. The correlation between proprotein processing and core assembly, in these as well as in neuroendocrine granules, suggested that processing might play a regulatory role at this stage.
The hypothesis that processing might alter the calcium sensitivity of the granule protein was tested by examining chymotryptic sensitivity in the presence and absence of calcium. We made use of the exocytosis-defective Tetrahymena strain SB281 in which proGrl1p is not processed to mature Grl1p, so that only the former is detected by antibody blotting of a cell lysate (Figure 12 lane 1). Use of SB281 allowed unambiguous identification of the chymotryptic products of proGrl1p. In the absence of calcium, incubation of an SB281 crude membrane fraction with low concentrations of chymotrypsin generated discrete proGrl1p fragments with mobilities similar to that of in vivo-processed Grl1p and the major chymotryptic fragment thereof (Figure 12 lane 2). In marked contrast to the results seen with processed Grl1p, addition of calcium before chymotrypsin did not reduce the degree of digestion (Figure 12 compare lanes 3 and 6), although the proteolytic products formed were slightly shifted in mobility. This difference suggested there was no comparable stabilization by calcium of a folded proGrl1p structure.
|
The relative chymotryptic sensitivities of proGrl1p vs. Grl1p were examined by repeating this experiment using lysates from MN173 cells, which contain both precursor and processed forms (Figure 12 lanes 5, 6). ProGrl1p underwent extensive digestion at chymotrypsin concentrations that caused only minor digestion of the processed protein (Figure 12 lane 5). To identify intermediate digestion products of proGrl1p, we incubated SB281 lysates with a lower concentration of chymotrypsin (Figure 12 lane 8). The addition of calcium to these reactions appeared to destabilize these products, since they accumulated only in the absence of calcium (Figure 12 lanes 8, 9). Similar results were obtained with MN173 cells (Figure 12 lanes 12, 13). The precise intermediates formed were somewhat variable between experiments, and may reflect variability in the ratio of chymotrypsin to substrate. In all cases these intermediates appeared to be destabilized in the presence of calcium.
We examined the reversibility of the apparent destabilization, using sequential additions of calcium and EGTA followed by chymotrypsin at a concentration that generated intermediate digestion products. In contrast to the irreversible calcium stabilization of mature Grl1p, the destabilization of precursor-derived intermediates was quantitatively reversed by addition of EGTA after calcium, and before chymotrypsin (Figure 12 lanes 10, 14). Taken together, these data indicate that proGrl1p differs from processed Grl1p both in its response to calcium exposure and in the reversibility of that response. Combined with evidence that the two forms also differ in their chymotrypsin sensitivity, these data are consistent with a model in which proGrl1p undergoes a change after processing, in a manner that affects its interaction with calcium.
| |
DISCUSSION |
|---|
|
|
|---|
The contents of vesicles along most membrane traffic pathways are generally considered as passive cargo. In contrast, the morphological changes during core formation of secretory granules have focused attention on the physical and biochemical conversion of cargo proteins. Numerous factors have been described that may influence granule protein condensation in the TGN and immature granule, including the regulated action of prohormone convertases. What is less clear is the actual mechanism of core assembly. Both assembly and dispersal reflect the coordination of a group of proteins in which individual species may have unique roles, entailing interactions with one another and with membrane proteins.
One approach is to identify a system in which a simple set of granule
proteins can be individually analyzed. On the basis of results reported
here, a substantially complete molecular catalog of the abundant
proteinaceous granule contents in T. thermophila may be
easily compiled. More than 80% of granule contents are derived by
proteolytic processing of five ~40 kDa GRL gene products to produce polypeptides of approximately 12-25 kDa. Supporting this
conclusion, a study of transcripts induced during periods of massive
granule synthesis identified gene products already cloned by the
reverse genetic methods described in this article, but no additional
GRL-related transcripts (Haddad and Turkewitz, 1997
)(Haddad,
unpublished data). On the basis of the pattern of Coomassie
Blue-stained bands after SDS-PAGE, three larger species of
approximately 50 kDa, 80 kDa and 90 kDa constitute a large fraction of
the remainder of the major granule contents. These appear less acidic
and do not show in vitro calcium binding, suggesting that they are
unrelated to the GRL products described here.
The GRL genes encode five preproproteins that are, to our
knowledge, the only secreted proteins in T. thermophila for
which sequences have been reported. The signal sequences conform
closely to the established eukaryotic consensus (Von Heijne, 1985
). The proteins are similar in a number of predicted features, including an
abundance of aspartate and glutamate residues. Similar densities of
acidic residues have been correlated with calcium binding in many
proteins (Huttner et al., 1991
). This is specifically true for proteins in the lumen of the secretory pathway or exposed to the
extracellular environment, where the high calcium concentrations are
appropriate to the low-affinity high-capacity binding that is mediated
by grouped acidic side chains. As expected, the processed Grl
polypeptides show in vitro calcium binding. Abundant acidic proteins
have been well-characterized in neuroendocrine dense-core granules and
in the ER, where they can function as calcium buffers (Bastianutto
et al., 1995
; Winkler and Fischer-Colbrie, 1992
). In
contrast, the calcium content of ciliate granules (measured in
Paramecium) appears to be low (Schmitz et al.,
1985
). Thus, calcium binding may occur only when the core proteins are
exposed to extracellular calcium.
Three granule core proteins have been sequenced in a distantly related
ciliate Paramecium tetraurelia (Gautier et al.,
1996
). The amino acid sequences at sites of proteolytic processing have been highly conserved, strongly suggesting that the proteases themselves are also shared and were present in an early ciliate ancestor. A conserved tetrapeptide motif, if not involved in
processing, must be associated with another common function during
biogenesis or after secretion. In both organisms, the sequences predict
formation of multiple
-helical coiled-coils over large stretches of
the protein. Extensive coiled-coils may underlie the interactions in
the condensed lattice and/or the extended filamentous structure of
expanded lattices. This points out a specific ambiguity in structural
predictions of core polypeptides. Since these may exist in more than
one conformation, a 2° structure prediction may contain features of
two differently folded structures.
Although the core proteins in the two ciliates have suggestive similarities, they are used to construct markedly different structures. The Tetrahymena core can be approximated by a 1 µm-long cylinder with rounded ends; the Paramecium equivalent is much larger (3 µm) tapered cone with a distinct "tip" extension from the wide end that specifies the docking site. What the structures have in common is that they are well ordered, and that they expand rapidly and in an ordered manner upon exocytosis. The simplicity of the Tetrahymena core suggests that a complex dynamic lattice can be largely determined by a small number of proteins, whose individual functions can now be explored by gene disruption.
The lattice is constructed of processed fragments that may represent
only a fraction of the original proGrlp structures. For proGrl4p, both
amino and carboxyl-terminal fragments were identified, but for four of
the five proGrlps, only single fragments were recovered. It seems
unlikely that we are overlooking the additional products because of
comigration of multiple polypeptides. First, 2-D gel analysis revealed
only a single spots at any given molecular weight, with the exception
of the smallest identifiable band in the preparations (Turkewitz,
unpublished data)(Cole and Stuart, 1991
; Maihle and Satir, 1986
).
Secondly, N-terminal sequencing produced unique sequences, except for
that same band. The current data suggest that granule biosynthesis may
involve either extensive degradation of some polypeptides or their
sorting away from the maturing granule, both of which occur in
neuroendocrine granules (Halban and Irminger, 1994
). The first
possibility suggests that Tetrahymena granules, like
neuroendocrine granules, might contain small products as bioactive
peptides, an issue that has not been examined.
The only demonstrated role for granule proteins in
Paramecium or Tetrahymena is mechanical, in
driving ordered postexocytic expansion. Rapid expansion is also a
feature of metazoan granules, for example those in the oocyte cortex,
which undergo exocytosis after sperm penetration. In
Paramecium, exocytosis may be a defensive response to
predation (Harumoto and Miyake, 1991
). The speed of this expansion,
occurring in tens of milliseconds (Knoll et al., 1991
),
makes global protein rearrangements seem an unlikely mechanism. Grl1p
and its precursor, for which previous genetic evidence suggested a role
in expansion, are now shown to exist in at least three distinct states
with regard to chymotrypsin sensitivity. We interpret these as
alternative conformations. Other potentially informative assays, such
as circular dichroism, are difficult to apply to a multicomponent
lattice. Proprotein processing converts the protein from a
protease-hypersensitive to a sensitive state, which is then converted
to a protease-resistant state by exposure to calcium. Since
chymotrypsin shows no activity against other granule proteins under
these conditions, the data do not address the possibility of parallel
transitions. It is possible that the difference in chymotrypsin
sensitivity between Grl1p and the other Grlps reflects a genuine
structural distinction, since both proGrl1p and the processed
polypeptide are significantly longer than the others. Granules in cells
lacking Grl1p showed some limited core expansion (Chilcoat et
al., 1996
), indicating that Grl1p is an important but not unique
element in this process.
Calcium and heat treatment had the same apparent effect on Grl1p
structure, suggesting that calcium acts to promote a transition rather
than to maintain the final state. This transition may be connected with
granule expansion, since both are irreversible and triggered by high
calcium. We imagine that Grl1p, along with other polypeptides in the
granules, are essentially loaded springs, the stored energy of which is
released by specific ionic changes after exocytic membrane fusion. An
interesting mechanistic question is how such proteins are constrained
to fold into metastable, "loaded" conformations during granule
assembly. Folding pathways accessible to the proproteins may not permit
folding into the most stable conformations accessible to the processed
polypeptides. Although the compartments in which the transitions occur
are different, the folding pathway of Grl1p may bear comparison with
that of influenza hemagglutinin, which includes a long-lived
intermediate that is kinetically determined (Baker and Agard, 1994
).
The transition of the viral protein to its final folded state is
triggered as the virus enters a low pH endosome of an infected cell
((Bullough et al., 1994
), and references therein).
The assembly of an intracellular spring to be triggered by
extracellular calcium presented a curious paradox, since all the core
proteins in their proprotein forms are first required to pass through
the ER and the TGN, which themselves contain high Ca2+
concentrations (Pezzati et al., 1997
). The concentration in
mammalian ER appears to reach roughly 400 µM (Miyawaki et
al., 1997
). The nature of such a spring, however, is that it can
be released only once. One trivial explanation could be that ciliates
are aberrant in that the entire secretory pathway contains only low
levels of calcium. However, the role of the ER in cytosolic calcium
homeostasis suggests that its capacity to store calcium is an essential
eukaryotic feature (Montero et al., 1995
). In addition,
Tetrahymena microsomes, like those of mammalian cells, will
take up calcium in vitro in an ATP-dependent manner (Muto and Nozawa,
1985
).
Part of the resolution to this paradox may lie in the difference
between proGrl1p and Grl1p, in that the former cannot adopt a stable
conformation in the presence of calcium. The proregion may prevent
folding of the proprotein into the specific conformation favored by
processed Grl1p in the granule lattice. This inhibition may be direct,
or mediated by interaction with a second protein. Detergent-solubilized
proGrl1p sediments as a soluble 8.5S complex, which may be a
homo-oligomer (Turkewitz et al., 1991
). A function of
proproteins in this system may therefore be to allow transport through
the calcium-rich early secretory pathway. Once in the maturing granule,
protein processing results in generation of the mature polypeptides
that are incorporated into the core lattice. How then is processing
regulated to avoid premature expansion? In the case of the conversion
of proGrl1p to Grl1p, one solution would be to make processing itself a
calcium-regulated step: the protease(s) could be inhibited at calcium
concentrations high enough to trigger expansion. Although pH might also
be a regulatory factor, ciliate granules do not appear to be acidified
(Garreau de Loubresse et al., 1994
; Lumpert et
al., 1992
). A working hypothesis, presented in Figure
13, illustrates a putative mechanism
for step-wise coordination of a set of interactions. More broadly, our
results underscore the potential for programmed regulation for proteins encountering successive compartments of the secretory pathway.
|
| |
ACKNOWLEDGMENTS |
|---|
We thank William Szechinski for technical assistance, Alex Helsinger for assembling the calcium calculation program, and Deyou Cai, Michael Lewis, and John Perrino for electron microscopy. Judy Orias generously provided the image in Figure 1D. For helpful discussion and manuscript review we gratefully acknowledge Ted Steck, Adam Linstedt, Jim Miller, Nava Segev, Tobin Sosnick, and members of this laboratory.
| |
FOOTNOTES |
|---|
* Corresponding author: Department of Molecular Genetics & Cell Biology, 920 E. 58th Street, The University of Chicago, Chicago IL 60637.
The abbreviations used are: dg, 6-deoxygalactose; GRL, granule lattice; Grlp, granule lattice protein; mp, 6-methylpurine; Tmp, trichocyst matrix protein.
| |
REFERENCES |
|---|
|
|
|---|
-cells. Structural maturation probed by disulfide accessibility.
J. Biol. Chem.,
270, 20417-20423This article has been cited by other articles:
![]() |
A. Rahaman, W. Miao, and A. P. Turkewitz Independent Transport and Sorting of Functionally Distinct Protein Families in Tetrahymena thermophila Dense Core Secretory Granules Eukaryot. Cell, October 1, 2009; 8(10): 1575 - 1583. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. T. Cowan, G. R. Bowman, K. F. Edwards, J. J. Emerson, and A. P. Turkewitz Genetic, Genomic, and Functional Analysis of the Granule Lattice Proteins in Tetrahymena Secretory Granules Mol. Biol. Cell, September 1, 2005; 16(9): 4046 - 4060. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Stemm-Wolf, G. Morgan, T. H. Giddings Jr., E. A. White, R. Marchione, H. B. McDonald, and M. Winey Basal Body Duplication and Maintenance Require One Member of the Tetrahymena thermophila Centrin Gene Family Mol. Biol. Cell, August 1, 2005; 16(8): 3606 - 3619. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. R. Bradshaw, N. D. Chilcoat, J. W. Verbsky, and A. P. Turkewitz Proprotein Processing within Secretory Dense Core Granules of Tetrahymena thermophila J. Biol. Chem., January 31, 2003; 278(6): 4087 - 4095. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Touz, N. Gottig, T. E. Nash, and H. D. Lujan Identification and Characterization of a Novel Secretory Granule Calcium-binding Protein from the Early Branching Eukaryote Giardia lamblia J. Biol. Chem., December 20, 2002; 277(52): 50557 - 50563. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Haddad, G. R. Bowman, and A. P. Turkewitz New Class of Cargo Protein in Tetrahymena thermophila Dense Core Secretory Granules Eukaryot. Cell, August 1, 2002; 1(4): 583 - 593. [Abstract] [Full Text] [PDF] |
||||
![]() |
L Vayssie, N Garreau de Loubresse, and L Sperling Growth and form of secretory granules involves stepwise assembly but not differential sorting of a family of secretory proteins in Paramecium J. Cell Sci., January 3, 2001; 114(5): 875 - 886. [Abstract] [PDF] |
||||
![]() |
R. Kuliawat, D. Prabakaran, and P. Arvan Proinsulin Endoproteolysis Confers Enhanced Targeting of Processed Insulin to the Regulated Secretory Pathway Mol. Biol. Cell, June 1, 2000; 11(6): 1959 - 1972. [Abstract] [Full Text] |
||||
![]() |
N. D. Chilcoat, N. C. Elde, and A. P. Turkewitz An antisense approach to phenotype-based gene cloning in Tetrahymena PNAS, July 17, 2001; 98(15): 8709 - 8713. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||