![]() |
|
|
Vol. 9, Issue 5, 1065-1080, May 1998

§ and
*Center for Gene Science, Hiroshima University, Kagamiyama 1-4-2, Higashi-Hiroshima 739-8527, Japan; and
Department of
Biology, Faculty of Science, Osaka City University, Sumiyoshi-ku, Osaka
558-8585, Japan
| |
ABSTRACT |
|---|
|
|
|---|
When proliferating fission yeast cells are exposed to nitrogen starvation, they initiate conjugation and differentiate into ascospores. Cell cycle arrest in the G1-phase is one of the prerequisites for cell differentiation, because conjugation occurs only in the pre-Start G1-phase. The role of ste9+ in the cell cycle progression was investigated. Ste9 is a WD-repeat protein that is highly homologous to Hct1/Cdh1 and Fizzy-related. The ste9 mutants were sterile because they were defective in cell cycle arrest in the G1-phase upon starvation. Sterility was partially suppressed by the mutation in cig2 that encoded the major G1/S cyclin. Although cells lacking Ste9 function grow normally, the ste9 mutation was synthetically lethal with the wee1 mutation. In the double mutants of ste9 cdc10ts, cells arrested in G1-phase at the restrictive temperature, but the level of mitotic cyclin (Cdc13) did not decrease. In these cells, abortive mitosis occurred from the pre-Start G1-phase. Overexpression of Ste9 decreased the Cdc13 protein level and the H1-histone kinase activity. In these cells, mitosis was inhibited and an extra round of DNA replication occurred. Ste9 regulates G1 progression possibly by controlling the amount of the mitotic cyclin in the G1-phase.
| |
INTRODUCTION |
|---|
|
|
|---|
Each cell must duplicate its cellular constituents for
proliferation. Two major events in this process are precise replication of the whole genome and accurate transmission of the duplicated genomes
to two daughter cells. A typical eukaryotic cell cycle consists of four
distinct phases, i.e., G1, S, G2, and M. Among these phases, G1 is most important for strict regulation of
cell proliferation in many types of cells. Before the specific duration in the G1-phase called the 'restriction point' in
mammalian cells or the 'Start' in yeast, a cell determines whether it
enters the next cell cycle or ceases proliferation (Hartwell et
al., 1974
; Nurse and Bissett, 1981
; Pardee, 1989
). To make this
decision, cells in the G1-phase monitor many types of
environmental and intracellular information such as the presence or
absence of nutrients, completion of the events of the previous cycle,
and cell size. When all requirements are fulfilled, the cells override
the restraint for the restriction point/Start control and are committed
to progression through G1 to the S-phase. In contrast, when
environment conditions, such as the absence of essential nutrients or
the presence of negative growth factors, are unfavorable for cell
proliferation, cells exit the cycling phase and enter into a quiescent
G0-phase.
Tumor cells have many characteristics that differ from those of normal
cells. The most noticeable one is their uncontrolled proliferation,
suggesting that cell cycle regulation is ruined in tumor cells (Sherr,
1996
). Tumor cells override the restraint for the "restriction
point" even under unfavorable conditions for growth. Indeed, many
oncogenic proteins strongly induce cell proliferation. Conversely, most
of the tumor suppressor genes encode proteins that restrain progression
to the S-phase from G1. Inactivation of these tumor
suppressor genes leads to uncontrolled cell multiplication due to lack
of the inhibition of G1/S progression. Therefore, cell
cycle regulation in the G1-phase is very important to
guarantee normal cell proliferation.
Fission yeast, Schizosaccharomyces pombe, has provided a
useful model system with which to study these cell cycle controls (Nurse, 1990
; Forsburg and Nurse, 1991
; MacNeill and Fantes, 1995
). There are three alternative fates for the proliferating fission yeast
cells in response to environmental situation; they continue to
proliferate, enter into a dormant stationary phase, or differentiate into ascospores (Egel, 1989
; Su et al., 1996
). Upon nitrogen
starvation, the cells arrest in the pre-Start G1 period and
withdraw from the cycling phase (Costello et al., 1986
). In
homothallic (h90) strains, haploid vegetative
cells of opposite mating types conjugate to form a diploid zygote that
subsequently undergoes meiosis and sporulation to differentiate into
dormant ascospores. Alternatively, heterothallic cells
(h+ or h
) exit from a
proliferating phase and maintain quiescence (Costello et
al., 1986
; Su et al., 1996
). Importantly, cells can
initiate the conjugation process only in the pre-Start
G1-phase (Nurse and Bissett, 1981
). Once the cells pass
Start, they are committed to a new round of the mitotic cycle and never
enter the developmental cycle until they complete mitosis and again
arrest in the pre-Start G1 period. Thus, in fission yeast
as in other eukaryotes, the regulatory mechanism operates to block cell
cycle progression in the G1-phase in response to
unfavorable environmental conditions.
The Rum1 protein encodes a critical regulator of the
G1-phase in fission yeast (Labib and Moreno, 1995
). First,
it acts as an inhibitor of the S-phase onset, delaying Start until a
cell has attained a critical minimal mass. Second, Rum1 influences the
dependence of Start and the S-phase upon completion of the mitosis of
the previous cycle. Third, the Rum1 protein defines the cell as being
in the pre-Start G1 period and prevents such a cell from
undergoing mitosis. As an inhibitor of cdk, Rum1 inhibits cdk activity
of the Cdc2/Cdc13 complex strongly and the Cdc2/Cig2 complex weakly
(Correa-Bordes and Nurse, 1995
). The rum1 gene is not
essential for viability, and the rum1 mutant grows normally. However, the rum1 mutant cannot arrest its cell cycle in the
pre-Start G1-phase upon nitrogen starvation and is sterile
(i.e., mating-deficient) (Moreno and Nurse, 1994
).
Although Rum1 is an important regulator of G1-phase progression, our knowledge about the cellular mechanism of G1 arrest upon unfavorable environmental conditions is not enough. To identify other genes involved in this control, we have searched for mutants whose phenotype mimicked the rum1 mutant. In this paper, we provide evidence that the ste9 mutant exhibits defects indistinguishable from those of the rum1 mutant. The Ste9 regulates the G1-phase progression possibly by down-regulating the amount of mitotic cyclin (Cdc13) during G1-phase.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
General Techniques for Yeast
The S. pombe strains used in this study are listed in
Table 1. Yeast cells were grown in YE
(complete medium), EMM2, or SD (minimal medium). For mating and
sporulation, MEA and SSA were used. For liquid culture, EMM2 and its
nitrogen-free version (EMM2
N) were used. Standard methods for
S. pombe were as described (Gutz et al., 1974
;
Moreno et al., 1991
). Sterile mutants were crossed using
protoplast fusion (Kitamura et al., 1990
). Transformation of
S. pombe cells was done by the lithium acetate method
(Okazaki et al., 1990
). Viability was monitored by plating
and counting the number of colonies after 3-4 d of incubation. To
discriminate haploid cells from diploid cells, the cells were plated
onto YE medium containing phloxine B (Moreno et al., 1991
).
|
Molecular Cloning and Gene Disruption of ste9
A diploid strain DS9-1, harboring the nonsense ste9-B36 mutation homozygously, was transformed by the S. pombe genomic library and plated onto SSA. Two sporulating colonies were identified by staining with iodine vapor, and plasmids were recovered from both colonies. Restriction mapping revealed that two plasmids contained the overlapping genomic DNA. A 5-kilobase (kb) HindIII fragment (Figure 1A), which was sufficient for rescue of the ste9 mutation, was integrated into a genome of the ste9 mutant. The resultant stable integrant normally conjugated and sporulated as did wild-type cells. Tetrad analysis of this integrant revealed that the integrated HindIII fragment contained the ste9+ gene itself, not a multicopy suppressor. A SalI-HindIII fragment of 3.4 kb, which complemented the ste9 mutation, was cloned into pAL-SK vector (kindly provided by Dr. K. Tanaka), and the resultant plasmid was named pAL(ste9). The nucleotide sequence of ste9+ has been submitted to the DDBJ/EMBL/GenBank databases under accession number AB001285.
|
Chromosomal disruption of the ste9 gene was carried out by
one-step gene disruption (Rothstein, 1983
). The
BclI-BclI fragment of 1.5 kb was replaced by the
S. pombe ura4+ gene (Figure 1A; Grimm et
al., 1988
). Although deleted construct covered a part of the
5'-untranslated sequence, we confirmed by 5'-rapid amplification of
cDNA ends analysis that this region was transcribed to ste9
mRNA. The resultant SalI-HindIII fragment containing the disrupted ste9 allele was used to transform
wild-type cells, and stable Ura+ transformants were
obtained from haploid and diploid strains. Successful replacement of
the wild-type gene by the disrupted allele was confirmed by genomic
Southern analysis.
Construction of nmt-ste9+ Gene and Ste9-overexpressing Strain
The coding region of ste9 was amplified by PCR using
sense (TGAAGTCAGGGATCCTAACG) and antisense
(GAGTGAATGGGATCCATTAC) oligonucleotide primers. To
facilitate cloning, BamHI sites (indicated by underlining) were introduced in front of the initiation codon and behind the termination codon. After digestion with BamHI, the amplified
DNA was inserted into the BamHI site of pREP1 or pREP2,
which contained the thiamine-repressible nmt1 promoter
(Maundrell, 1990
, 1993
). The strain harboring the integrated
nmt-ste9+ gene was constructed as follows. One
of the resultant plasmids, pREP2(ste9), was digested at the
unique AatI site in the ura4+ gene
and transformed yeast cells to integrate the linearized plasmid into
the genomic ura4-294 locus, after which stable
Ura+ integrants were isolated. The cells were maintained in
the presence of 5 µg/ml thiamine. To induce expression, the cells
were inoculated into thiamine-free medium after extensive washing.
Flow Cytometry and Microscopy
Cells were cultured as described in the text. For flow cytometry, cells were collected, washed once with cold water, and then fixed with 70% ethanol and stored at 4°C. After digestion by RNase A and staining with propidium iodide, the cells were analyzed by FACSCalibur (Becton-Dickinson, San Jose, CA). For microscopic observation, cells were fixed with 70% ethanol. After the cells had been washed with water, nuclei and septa were stained with DAPI and calcofluor, respectively, and inspected under a fluorescent microscope.
Immunoblotting
Cells were collected, washed once with water, resuspended in 100 µl of water, and then heated at 90°C for 5 min. Extracts were
prepared as described (Masai et al., 1995
). Briefly, the cells were disrupted by vigorous vortexing with glass beads in SDS
sample buffer containing 4 M urea. Sixty micrograms of protein per each
lane were fractionated by SDS-PAGE (8% acrylamide gel), and then
transferred to nitrocellulose paper. The blot was probed with
anti-Cdc13 antibody or anti-Cdc2 antibody specific for the PSTAIRE
region (kindly provided by Dr. M. Yanagida and Dr. M. Yamashita,
respectively). Rum1 protein tagged by triple hemagglutinin epitopes was
visualized with anti-HA monoclonal antibody (12CA5, Boeringer Mannheim,
Indianapolis, IN).
Assay of H1-Histone Kinase Activity
Cell extracts were prepared in HB buffer (Moreno et
al., 1991
) by vigorous vortexing with glass beads. Kinase reaction
was performed in HB buffer with H1-histone and
[
-32P]ATP for 15 min at 30°C. Reactions were
terminated by adding an equal volume of 2× sample buffer. Samples were
boiled for 5 min, run on a 12% polyacrylamide gel, and then quantified
with BAS1000 (Fuji film).
| |
RESULTS |
|---|
|
|
|---|
The ste9+ Gene Encodes a Homolog of Hct1/Cdh1 and Fizzy-related
To look for genes responsible for the regulation of cell cycle
progression in G1-phase, especially for the cell cycle
arrest, we examined whether the known sterile mutants exhibited the
phenotype similar to that of the rum1 mutant. As described
below in detail, the ste9 mutant conformed to this criterion
and exhibited defects indistinguishable from those of the
rum1 mutant. The ste9 mutant was identified
previously (Leupold and Sipiczki, 1991
), but its molecular
characterization has not been attempted. To determine its coding
product, the ste9+ gene was isolated by rescuing
the sterility of its mutant. Sequencing revealed one uninterrupted
large open reading frame composed of 556 amino acids (Figure 1A). A
characteristic motif, called the WD-repeat, was found in its C-terminal
half (Voorn and Ploegh, 1992
; Neer et al., 1994
). In
contrast, the N-terminal half showed no characteristic sequence.
Homology searching revealed that Ste9 belonged to the subfamily of
WD-repeat proteins including Cdc20 and Hct1/Cdh1 (Saccharomyces
cerevisiae), Fizzy and Fizzy-related (Drosophila
melanogaster), p55CDC (human and
rat), and Slp1 (S. pombe) (Sethi et al., 1991
;
Weinstein et al., 1994
; Dawson et al., 1995
;
Matsumoto, 1997
; Schwab et al., 1997
; Sigrist and Lehner,
1997
; Visintin et al., 1997
). All proteins contain seven
WD-repeats at the C-terminal region, and these WD-repeat domains of
these proteins are highly conserved. In addition, several proteins of
unknown function identified by genome sequencing project are also
homologous, such as a hypothetical protein on the S. pombe
chromosome II (genomic cosmid clone 1198, accession number U33008) and
the ZK1307.6 (C. elegans). Among these proteins, Ste9 has
the highest homology with the Hct1/Cdh1 (Figure 1B) and Fizzy-related
(our unpublished results). As described below, mutants of these three
genes exhibit similar phenotype.
The chromosomal ste9+ gene was disrupted (Figure
1A). Diploid cells harboring one wild-type and one disrupted
ste9 allele were subjected to tetrad analysis. Although a
slight reduction in the ste9
spore's
viability was observed, the ste9-disrupted cells grew normally with a generation time comparable to that of wild-type cultures under a standard culture condition. They exhibited neither temperature- nor cold-sensitive growth. However, the ste9
disruptant failed to conjugate in nitrogen-free sporulation medium.
Furthermore, diploid cells harboring the ste9 null allele
homozygously scarcely sporulated, and sporulation was also defective in
the heteroallelic diploid cells harboring
ste9 and
ste9-B36. Thus, disrupted ste9 allele lacked its
function, and ste9+ was dispensable for
proliferation but essential for cell differentiation, i.e., mating and
subsequent sporulation. We used both nonsense (ste9-B36) and
disrupted alleles for the experiments described below.
The ste9+ Gene Is Essential for G1 Arrest upon Starvation
To understand the physiological role of Ste9, cell division in a
nitrogen-free medium was monitored because ste9 mutant was sterile. Exponentially proliferating cells were transferred to a
nitrogen-free medium. At each time indicated, a portion of the culture
was taken and inspected microscopically. Profile of changes in
percentage of septated cells was similar between wild-type and the
ste9 mutant strains (Figure
2A). The total cell number increased 3.8 times for the wild-type strain and 4.4 times for the ste9
mutant, indicating that both strains passed through mitosis twice
before they ceased to proliferate. We and others previously isolated
several sterile mutants that rapidly lost viability after nutritional
starvation (Kitamura et al., 1990
; Devoti et al., 1991
; Warbrick and Fantes, 1991
; Takeda et al., 1995
). To
test whether the ste9 mutants normally responded to
starvation, viability in long-term culture was monitored. Viability of
wild-type and ste9 cells cultured in nitrogen-free medium
for 9 d was 82.7% and 68.2%, respectively. Viable cells were
somewhat decreased in prolonged culture in the ste9 mutant,
but viability was still fairly high. Microscopic observation revealed
that both wild-type and ste9 cells were small and spherical
under the starved condition, indicating that both strains successfully
entered into the stationary phase. Many fission yeast genes responsible
for sexual development are transcriptionally induced in response to
nitrogen starvation depending on the Ste11 transcription factor
(Sugimoto et al., 1991
). mei2 is one such gene,
and its transcription occurs in a mating-type or pheromone
signaling-independent manner (Shimoda et al., 1987
).
Northern analysis revealed that transcription of mei2 was
strongly induced by nitrogen starvation in ste9 cells as
well as in wild-type cells (our unpublished results).
|
The above data indicate that the ste9 mutant is competent to
respond to nitrogen starvation. Nevertheless, ste9 mutants
are completely sterile. In wild-type cells, starvation of nitrogen induces cell cycle arrest in the G1-phase (Costello
et al., 1986
). This is one of the prerequisites for fission
yeast cells to commit to the developmental pathway and initiate
conjugation (Nurse and Bissett, 1981
). We next examined whether the
ste9 mutant arrested in the G1-phase in response
to nitrogen limitation. DNA content of cells cultured in nitrogen-free
medium was analyzed by flow cytometry (Figure 2B). In S. pombe, most of the actively proliferating cells are in the
G2-phase, and a newborn cell has already completed DNA
synthesis after cytokinesis. Consistently, the majority of cells in the
exponential culture had a 2C DNA content in both wild-type and
ste9 strains. Upon nitrogen starvation, cells with a 1C DNA
content gradually accumulated in the wild-type strain, indicating that
most cells arrested in the G1-phase as they ceased to
proliferate. In contrast, ste9 strain showed only a minor
G1 peak and remained as cells with the 2C DNA content after
8 h (Figure 2B), or even after 24 h (our unpublished
results). Consistent with the previous report (Moreno and Nurse, 1994
),
the control rum1 strain was also defective in the starvation
induced-G1 arrest. We conclude that the ste9
mutant is defective in cell cycle arrest in the G1-phase in
response to nitrogen starvation, while they are competent to enter the
stationary phase from the G2-phase. Therefore, the primary
cause of the sterility in the ste9 mutant is its failure to
arrest in G1.
It was demonstrated that the Cig2 cyclin was a major partner of the
Cdc2 kinase in the G1/S-phase in fission yeast (Fisher and
Nurse, 1996
; Martín-Castellanos et al., 1996
;
Mondesert et al., 1996
). Cells harboring the deleted
cig2 allele are viable but exhibit a delay in progression
through G1 to the S-phase in some situations, e.g., small
cells generated by the wee mutations or nitrogen starvation.
We tested the possibility of whether a decrease in the G1/S
cdk activity by inactivation of Cig2 restored mating ability in the
ste9 mutant. This was indeed the case; mating defect was
suppressed by the mutation in cig2. Efficiency of the suppression varied depending on the allele of ste9 mutation
(Table 2): 6% in the double disruptant
of
ste9
cig2, 17% in the ste9-B36 cig2-S18, and ~50% in the ste9-59
cig2. The
ste9-59 allele encodes a partially functional protein
because mating is blocked but sporulation is hardly affected by this
mutation (Kitamura and Tsujimoto, unpublished). We also investigated
the effect of inactivation of other cyclin genes including
puc1 (Forsburg and Nurse, 1994
), cig1 (Bueno
et al., 1991
) or pas1 (Tanaka and Okayama,
personal communication). However, the sterility of the ste9
strain was not rescued by the disruption of these cyclin genes,
indicating that the relationship between cig2 and
ste9 was specific. These data strongly support the previous
conclusion that the cause of the sterility in the ste9
mutant is its G1-arrest defect. We noticed that about 10% of cells formed azygotic asci in the
ste9 and
ste9-B36 strains in combination with the cig2
mutation. Unexpectedly, these azygotic asci were produced from haploid
cells without diploidization by the preceding mating. This haploid
meiosis was also observed in the rum1 cig2 strain (Kitamura,
unpublished). The reason for this aberrant meiosis is currently under
investigation.
|
ste9 and wee1 Mutations Cause Synthetic Lethality
Cell cycle regulation in the G1-phase is obviously
defective in the ste9 mutants, although cells completely
lacking the Ste9 function still grow in a healthy manner in the rapidly
proliferating phase. In rapidly proliferating wild-type cells, the size
of two daughter cells born in the previous cell cycle is already beyond the critical size required for passing the Start restraint.
Consequently, the length of the G1-phase is very short and
the pre-Start G1 period is virtually lacking in actively
proliferating cells (Nurse, 1975
; Nurse and Thuriaux, 1977
; Nasmyth,
1979
). A protein kinase encoded by wee1+
negatively regulates G2/M-phase transition by
phosphorylating Cdc2 (McGowan and Russell, 1993
). Cells harboring the
deleted wee1 allele are viable, but timing of the initiation
of mitosis is advanced. As a result, half-size cells are generated
after cell division (Russell and Nurse, 1987
). In these small cells, the G1 period must be lengthened until the minimum size
required for overriding the Start-restraint is attained. We next
examined the role of Ste9 in such small cells. For this purpose, a
temperature-sensitive wee1-50 allele (Nurse, 1975
) was
used. Both parental ste9 and the wee1-50 single
mutant could grow at 35°C. In contrast, growth of the ste9
wee1-50 double mutant was temperature-sensitive (see below). This
indicates that ste9+ was dispensable in an
otherwise wild-type background but indispensable in the absence of the
wee1-function. The mik1+ gene encodes
a protein kinase whose function overlaps with Wee1, but disruption of
the mik1 gene does not confer any significant phenotype
(Lundgren et al., 1991
). Accordingly, the
ste9
mik1 double disruptant was viable, and the phenotype of this
double disruptant was identical with that of the parental
ste9 cells.
Because the sterility of the ste9 mutant was suppressed by the cig2 mutation, we examined whether the lethality of ste9 wee1 strain was also suppressed by simultaneous inactivation of cig2. However, temperature-sensitive lethality was not suppressed by the cig2 mutation, and the triple mutant also exhibited a growth defect at 35°C (Figures 3A and 7C). The growth profile of this triple mutant at the restrictive temperature was investigated in detail. Figure 3A shows the change in viability at the restrictive temperature. Control wee1-50 cells continued to proliferate and the number of viable cells exponentially increased. In marked contrast, wee1-50 cells lacking the Ste9 function began to die after 2 h. These cells did not cease cell division; the total cell number increased (our unpublished results). The DNA contents of these cells were analyzed by flow cytometry (Figure 3B). As the heat-labile Wee1 protein was inactivated, the length of the G1 period elongated. Consistently, the 1C peak corresponding to the G1 population was clearly seen in the control wee1-50 cig2 cells. In contrast, no apparent 1C peak was observed in the triple mutant of ste9 wee1-50 cig2. To emphasize 1C peak clearly, we used the cig2-disrupted strain for the experiment shown in Figure 3, but the ste9 wee1-50 double mutants also gave similar results. DAPI staining of these cells revealed that cells became small and executed aberrant septation, which led to the asymmetric nuclear segregation. These data are interpreted as follows: the wee1 ste9 double mutant could not delay DNA synthesis until the restraint of size control was cleared and could enter the S-phase immediately after previous mitosis even in the cells too small to initiate DNA synthesis. Repeats of this uncontrolled cell cycle progression led to cell death. Consistent with this hypothesis, the addition of hydroxyurea (HU), an inhibitor of DNA synthesis, at 2 h after a temperature increase, completely prevented subsequent cell death (Figure 3A).
|
ste9 Mutants Enter the M-Phase from the Pre-Start G1-Phase
As described above, ste9+ is essential for
the proper regulation of cell cycle progression in the
G1-phase. The Cdc10 protein, in combination with Res1 or
Res2, functions as a transcription factor for the genes that are
essential for transition from the G1 to the S-phase
(Lowndes et al., 1992
; Tanaka et al., 1992
; Caligiuri and Beach, 1993
; Miyamoto et al., 1994
). At the
restrictive temperature, cdc10ts mutants arrest
in the pre-Start period of the G1-phase (Nurse et
al., 1976
; Nurse and Bissett, 1981
). We found that the ste9 cdc10ts double mutant rapidly lost viability compared
with the cdc10ts single mutant at the
restrictive temperature (36°C). Even at the semipermissive
temperature (32°C), the double mutant was inviable, whereas the
control cdc10ts mutant formed colonies (Figure
4A). The control ste9 strain
grew normally at all temperatures examined, indicating that the
cdc10ts cells were extremely sensitive to the
lack of the Ste9 function. Analysis of the DNA content of the cells at
30°C revealed that the apparent 1C peak corresponding to the
G1 population was seen in the
cdc10ts strain, but no such population was found
in the ste9 cdc10ts strain (Figure 4B). The DNA
profiles of both strains at 32°C were also quite different, in that
appearance of the cells in the G1/early S-phase was
remarkably delayed in the double mutants (Figure 4B). These
observations led to the idea that Start-promoting activity is intense
in the ste9 mutant (see DISCUSSION).
|
The phenotype of the ste9 cdc10ts double mutant at the restrictive temperature was examined in more detail. Asynchronous populations of cdc10 or the double mutant of ste9 cdc10 at the permissive temperature were shifted to 36°C. At the indicated time, a portion of the culture was taken for microscopic observation and flow cytometry. In both cultures, septated cells decreased after 1 h and then increased at the restrictive temperature (Figure 4C). In the cdc10 strain, septated cells decreased again by 4 h. On the contrary, 10-20% of the population still had septa in the ste9 cdc10 strain, indicating that cell division might continue even at the restrictive temperature. Figure 4D shows the DNA profile of these cells at 36°C. Both cdc10 and ste9 cdc10 cells arrested with a 1C DNA content by 4 h. After 6 h, the major peak shifted to the right, but these shifted peaks did not correspond to the 2C population. These shifts may be an artifact due to cell elongation, and the DNA profile did not alter by preventing DNA synthesis using HU (Figure 4D). We concluded that both single and double mutants arrested in the G1-phase at restrictive temperatures. DAPI staining of the ste9 cdc10 strain revealed that the nucleus was bisected by the septum at the restrictive temperature (Figure 4E). The appearance of these cells exhibiting a so-called "cut" phenotype indicated that septum formation was uncoupled with completion of DNA replication or nuclear separation. In the DNA profile of the double mutant, a small peak with less than a 1C DNA content was observed at 6 h after a temperature increase (Figure 4D, indicated by a downward arrow). This minor peak was seen even in the presence of HU but was never seen in the cdc10 single mutant. This peak might represent dead cells produced by the aberrant mitosis in the double mutant.
These observations strongly suggest that the ste9 cdc10
mutant is defective in some checkpoint process. To date, two related, but distinct, DNA structure checkpoint mechanisms that prevent premature mitosis were discovered in fission yeast (Carr, 1995
; Stewart
and Enoch, 1996
). One is the S-phase-mitosis (S/M) checkpoint, which
responds to changes in the state of DNA replication. Another is the DNA
damage checkpoint, which monitors the state of DNA damage and searches
for lesions in the newly replicated DNA, such as incomplete ligation.
We tested whether the ste9 mutant was defective in these
checkpoint mechanisms. However, ste9 cells survived in the
presence of HU or methylmethane sulfonate as did wild-type cells (our
unpublished results). In addition, wild-type and ste9
strains have the same sensitivity to UV light, indicating that Ste9 is
apparently dispensable for the replication- and the damage-checkpoint
functions.
It is possible that lethal mitosis in the cdc10 ste9 strain is caused by incomplete cdc10 arrest and premature entry into mitosis. As described, HU effectively blocks cell cycle progression in the ste9 cells because the replication checkpoint is operating. If G1 arrest by the cdc10 mutation is incomplete, it is expected that lethal mitosis is prevented in the presence of HU because of its inhibition of S-phase progression. As shown in Figure 4F, addition of HU to the ste9 cdc10 double mutant did not prevent cell death at the restrictive temperature, indicating that lethal mitosis in the cdc10 ste9 cells was not due to leakiness of cell cycle arrest. Therefore in the ste9 cdc10 strain, DNA synthesis was bypassed, and the cells entered mitosis from the pre-Start G1 period.
The amount of Cdc13 protein, a major mitotic B-type cyclin in S. pombe, culminates in the late G2/M and is very low in
the G1-phase due to selective degradation by the proteasome
(Hayles et al., 1994
; Yamano et al., 1996
).
Strong activation of the Cdc2/Cdc13 complex in G1-arrested
cells leads to mitosis in the absence of DNA synthesis (Hayles et
al., 1994
; Yamano et al., 1996
). Because similar
premature mitosis occurs in the G1-arrested ste9
cdc10 cells, we quantified the level of the Cdc13 protein at the
restrictive temperature. In the cdc10 single mutant, Cdc13
almost disappeared by 4 h at 36°C as the cells arrested in the
G1-phase (Figure 5). In
contrast, Cdc13 did not decrease in the ste9 cdc10 double
mutant (Figure 5), although the cells largely arrested in
G1 by 4 h at 36°C (Figure 4D). This persistence of
Cdc13 in ste9 cdc10 cells, at least in part, seems relevant
to the premature mitosis. The same premature entry into M-phase from
pre-Start G1 occurs also in the rum1 cdc10
double mutant (Moreno and Nurse, 1994
). These data indicate that both
ste9 and rum1 are essential to prevent mitosis
from the pre-Start G1 period.
|
Overexpression of Ste9 Inhibits Mitosis and Induces an Extra Round of DNA Replication
Our observation that Cdc13 persisted in the G1-arrested ste9 cells (Figure 5) suggests an intriguing possibility that Ste9 down-regulates the amount of Cdc13 protein. To confirm this assumption, the Cdc13 level in Ste9-overexpressing cells was quantified with a strain harboring the integrated nmt-ste9+ gene. In the presence of thiamine, cells exponentially proliferated (Figure 6B), and the Cdc13 protein level did not significantly change throughout the incubation (Figure 6A). In marked contrast, Cdc13 decreased when the expression of Ste9 was induced in the thiamine-free medium. Consistently, activity of total H1-histone kinase was greatly reduced in these cells.
|
In the Ste9-overexpressing culture, increase in cell number stopped
after 12 h of induction (Figure 6B). Ste9 overexpression requires
a 12-h induction because the nmt1 promoter takes that long
to induce (Maundrell, 1990
). Therefore, cessation of proliferation coincided well with the kinetics of induction. Concomitant with the end
of cell number increase, cells became elongated and exhibited a low
septation index (Figure 6C). Less than 1% of cells contained two
nuclei and exhibited mitotic figures after 14 h. In these cells,
onset of the S-phase was slightly delayed, as evidenced by the
appearance of the 1C peak, after which the population with a 4C DNA
content corresponding to diploid cells increased (Figure 6D). The
possibility that overexpression of Ste9 led to asymmetric segregation
of nuclear DNA was excluded because no cells of "cut" phenotype or
missegregation of the nuclei were seen during incubation. We conclude
that Ste9 plays a role in the regulation of Cdc13 cyclin level
during G1. Down-regulation of Cdc13 and the resultant reduction of mitotic cdk activity should lead to prevention of mitosis
and the induction of an extra round of DNA replication, as demonstrated
by Hayles et al. (1994)
. These features are quite similar to
those of the Rum1-overexpressing strain (Moreno and Nurse, 1994
).
In fission yeast, the state of the Cdc2 kinase determines whether cells
are in G1 or G2 (O'Connell and Nurse, 1994
).
When cdc2ts mutants were subjected to heat shock
to destroy the heat-labile Cdc2 protein, haploid cells in the
G2-phase were reset to the pre-Start G1-phase.
If these cells are again shifted back to permissive temperature, they
rereplicate their genome and initiate a new round of cell cycle as
diploid cells (Broek et al., 1991
). We explored the
possibility that cdc2 inactivation caused diploidization in
the ste9 mutant. As shown in Figure 6E,
cdc2ts single mutants indeed gave rise to
diploid cells, whereas the double mutant of ste9
cdc2ts remained as a haploid. Thus, functional
inactivation of ste9 completely prevents this
diploidization, as reported for the rum1 mutant (Labib
et al., 1995
). Interestingly, similar abnormality was
reported in Drosophila. Loss of Fizzy-related, a homolog of Ste9, inhibits endoreduplication in G2 cells, which
normally occurs in the developing embryo (Sigrist and Lehner, 1997
).
Because DNA replication requires G1 cdk activity, Ste9
should be necessary to maintain the Cdc2 kinase in a pre-Start form.
Chk1 was also reported to be involved in some aspect of G1
regulation (Carr et al., 1995
). We tested whether
rereplication was also blocked in the double mutant of the chk1
cdc2ts strain. However, the chk1
cdc2ts strain effectively rereplicated their DNA and
became diploid as well as the control cdc2ts
strain (Figure 6E). If Chk1 functions as a regulator of G1,
its role is quite different from that of Ste9.
Functional Relationship between Ste9 and Rum1
As described, various phenotypes of the ste9 mutant are
indistinguishable from those of the rum1 mutant (Moreno and
Nurse, 1994
). The similarity of phenotypes in these mutants suggests that the roles of both proteins may be functionally related, although their primary structures are not homologous. We investigated the functional relationship between ste9 and rum1.
First, the amount of Rum1 protein in the ste9 mutant was
monitored. As reported earlier, Rum1 protein was very low in the
asynchronous, actively proliferating cells. Upon nitrogen starvation,
which induces G1 arrest in wild-type strain, considerable
level of Rum1 protein was detected (Figure
7A). In contrast, such accumulation did
not occur even in the ste9 cig2 cells (Figure 7A). Northern
analysis revealed that the level of rum1 mRNA was induced in
the same extent in both strains upon starvation (our unpublished
results). This might simply reflect the fact that the ste9
mutant cannot arrest in the G1-phase (Figure 2B) and Rum1
protein is unstable except in the G1-phase (Correa-Bordes
and Nurse, 1995
). However, sterility was partially suppressed by the
cig2 mutation (Table 2), and the G1-arrest
defect was partially recovered in the ste9 cig2 cells
(Figure 7B). Therefore, Ste9 might be actively involved in the
production and/or stabilization of Rum1.
|
Next, the effect of the multicopy ste9+ or rum1+ gene on the suppression of the mutant phenotype was investigated. Sterility of both mutants could not be mutually suppressed by the introduction of the other gene. However, the synthetic lethality of ste9 wee1-50 cells at the restrictive temperature was weakly suppressed by the plasmid-borne rum1+ gene (Figure 7C). Conversely, rum1 wee1-50 double mutant was also viable in the presence of the ste9+-plasmid. Furthermore, growth defect in the ste9 cdc10 cells at the semipermissive temperature was effectively suppressed by the rum1+-plasmid (Figure 7D). Inviability of rum1 cdc10 cells was also suppressed by the ste9+-plasmid. These data indicate that the functions of Ste9 and Rum1 are mutually interrelated. However, both proteins do not work in a simple linear pathway, and their functions might be complementary and partly overlapping.
| |
DISCUSSION |
|---|
|
|
|---|
In this study, we demonstrated that the ste9+ gene was essential for proper regulation of cell cycle progression in the G1-phase. First, the ste9 mutant was sterile because of the failure in G1 arrest upon nitrogen starvation. Cell cycle arrest in the pre-Start G1 period is essential to enter the developmental pathway, and the sterility was partially suppressed by the inactivation of cig2, which encoded a major G1/S cyclin in S. pombe. Second, Ste9 was indispensable for the growth of the wee1 cells, which had to lengthen the pre-Start G1 period to restrain DNA synthesis until the critical size to override Start control was attained. Third, Ste9 is essential to prevent premature entry into mitosis from the pre-Start G1 period in the absence of DNA replication. Furthermore, Ste9 might be required for maintenance of the Cdc2 kinase in a pre-Start form, as suggested by the fact that overexpression of Ste9 induced rereplication of the genome due to reduction of the mitotic kinase activity of the Cdc13/Cdc2 complex, and rereplication in the cdc2ts strain was prevented by the ste9 mutation.
The ste9 gene is identical to the recently identified
srw1 (Yamaguchi et al., 1997
). The Ste9 is
evolutionary highly conserved and is a homolog of Hct1/Cdh1 of budding
yeast and Fizzy-related (Fzr) of higher organisms. The
hct1/cdh1 mutant is viable, but mitotic Clb2 cyclin is
highly stabilized and is not efficiently degraded in the mutant (Schwab
et al., 1997
; Visintin et al., 1997
). Similarly,
Drosophila Fzr is required for down-regulation of cyclins A,
B, and B3 during G1 when the embryonic epidermal cell stops
proliferation after mitosis 16 (Sigrist and Lehner, 1997
). In good
agreement with these reports, mitotic Cdc13 cyclin remains in the
ste9 mutant arrested in G1. Therefore, all of
the Ste9, Hct1/Cdt1, and Fzr are supposed to be involved in the
regulation of the amount of mitotic cyclin during G1,
although no biochemical function of these proteins has yet been
demonstrated. Budding yeast Cdc20, a representative protein of this
WD-protein family, is essential for the degradation of Pds1 and for
entry into anaphase but apparently dispensable for Clb2 degradation
(Visintin et al., 1997
). It is proposed that Hct1 and Cdc20
might target distinct, but overlapping, sets of proteins for
degradation, perhaps by recruiting these substrates to
cyclosome/anaphase-promoting complex for ubiquitination (Cohen-Fix and
Koshland, 1997
; Hoyt, 1997
). In fission yeast, Slp1 might be a homolog
of Cdc20. Although the primary structures of WD-repeat domain are
highly conserved between Ste9 and Slp1, the amino-terminal regions
beyond WD-repeat domain are not as homologous. Both proteins exert
their own role through the function of the N-terminal region. It is
noteworthy if the WD-repeat regions of both proteins interact with a
common protein, because the WD-repeat is involved in protein-protein
interaction (Sondek et al., 1996
). Although genetic
interaction is demonstrated between Cdc20 and Hct1, we did not observe
such interaction between Ste9 and Slp1; double mutants of
ste9
slp1-362 did not show synthetic phenotype, and the growth defect
of slp1-362 was not suppressed by the
ste9+-plasmid (our unpublished results). The
roles of Ste9, Slp1, and the uncharacterized WD-repeat proteins of this
family found by the genome-sequencing project must be further
investigated.
The phenotype of the ste9 mutant is indistinguishable from
that of the rum1 mutant (Moreno and Nurse, 1994
). Rum1 is a
potent cdk inhibitor but it is noteworthy that the Rum1 promotes
proteolysis of the Cdc13 cyclin during G1-phase
(Correa-Bordes et al., 1997
). We also showed that both
functional inactivation and overexpression of Ste9 significantly
affected the level of Cdc13 protein. Therefore, Ste9 would also be
involved in proteolysis of some important cell cycle regulators, one of
the candidates being Cdc13 cyclin. Because sterility of ste9
mutants was suppressed by the cig2 mutation, this cyclin
might be also a possible target. Inactivation of all three known
B-cyclins in fission yeast (Cig1, Cig2, and Cdc13) results in
lethality, and such cells arrest before DNA replication (Fisher and
Nurse, 1996
). Because overexpression of Ste9 induces rereplication, at
least one B-cyclin functioning at the onset of DNA replication should
be resistant to the effect of Ste9. High level expression of budding
yeast Hct1 induces the rapid and selective disappearance of the mitotic
Clb2 cyclin, probably by proteolysis, but the level of Clb5, an S-phase
cyclin, does not change (Schwab et al., 1997
).
In general, proteolysis of mitotic B-cyclin persists throughout
G1 (Amon et al., 1994
; Brandeis and Hunt, 1996
).
Both Ste9 and Rum1 have pivotal roles in decreasing levels and
activities of the Cdc2/Cdc13 complex during G1. In the
absence of this control, fission yeast cells in G1 can
initiate mitosis without having undergone DNA replication. Proteolysis
is indispensable for normal cell cycle progression (King et
al., 1996
), and expression of undegradable Cdc13 resulted in the
cell cycle arrest at anaphase (Yamano et al., 1996
). The
fact that ste9+ and rum1+
are dispensable for normal growth is curious because Cdc13 protein remains in the ste9 or rum1 mutant arrested in
G1 (Moreno and Nurse, 1994
; this study). In budding yeast,
HCT1 is a nonessential gene, but viability of the
hct1 mutant depends on Sic1, a Clb-specific cdk inhibitor.
Therefore, defects of cyclin degradation in hct1 cells is
compensated by the activity of Sic1. Obviously, cdk activity must be
inactivated upon exit from mitosis to G1; therefore, exit from mitosis is guaranteed either by degradation of mitotic cyclin or
by the activity of cdk inhibitor. Like Hct1/Cdt1 and Sic1 in budding
yeast, Ste9 and Rum1 execute an essential and overlapping function
during G1. Surprisingly, a double disruptant of ste9 rum1 is still viable (Kitamura, unpublished). There are several possible explanations for the viability of the ste9 rum1
cells. 1) Both proteins have an effect on the Cdc13 proteolysis only in
the G1-phase and not during mitotic exit. 2) Function of
Ste9 overlaps that of other WD-repeat protein(s) belonging to the same Cdc20 subfamily. 3) cdk activity is inactivated by a mechanism other
than cyclin degradation and inhibition by Rum1. Phosphorylation of Cdc2
at tyrosine 15 might be responsible for this inhibition of cdk activity
because both ste9 and rum1 are synthetically
lethal with the wee1 mutation. However, it is demonstrated
that this inhibitory tyrosine residue is dephosphorylated in pre-Start
G1 and becomes phosphorylated only after cells enter late
G1 (Hayles and Nurse, 1995
). In Drosophila, the
roughex (rux) protein plays an analogous role to those of Ste9 and
Rum1. Rux is required to establish G1-phase in the
developing eye (Thomas et al., 1994
). In the rux
mutant, cells accumulate Cyclin A in early G1 and enter S-phase prematurely. This phenotype is suppressed by the
down-regulation of Cyclin A. Furthermore, overexpression of Rux protein
induces degradation of Cyclin A and inhibits S-phase entry caused by
Cyclin A accumulation (Sprenger et al., 1997
; Thomas
et al., 1997
). Thus rux shares several features
with ste9 and rum1; all proteins function as a
negative regulator of G1 progression. Also in fission
yeast, such unidentified protein might be operating to inhibit mitotic cdk activity upon exit from mitosis. The important question of how
fission yeast cells inhibit cdk activity during G1 remains to be answered.
Uncontrolled Start-promoting activity would lead to disturbance of cell
cycle regulation, as in the case of cancer cells. As demonstrated in
cell cycle arrest by mating pheromone (Stern and Nurse, 1997
), proper
regulation of the G1 cdk activity should also be important
in the G1 arrest upon nutritional starvation. The following
observations lead to the idea that Start-promoting activity is
deregulated in the ste9 mutant. First, both wild-type and
ste9 strains divide twice under nutritional starvation but only the ste9 mutant cannot arrest in the pre-Start period
and initiates an additional round of DNA synthesis. Second, cells lacking ste9+ might initiate a new round of DNA
replication as soon as the previous mitosis is completed, regardless of
whether the cells attain the critical size. This leads to cell death in
the wee1
background because cell mass is lost
in every cell division as occurs in the rum1 wee1 strain
(Moreno and Nurse, 1994
; Sveiczer et al., 1996
). Third, the
population in G1 at the semipermissive temperature is
considerably less in the ste9 cdc10 double mutant than in
the control cdc10 strain. Because inhibition of the
ubiquitin-dependent proteolytic activity overcomes Start arrest and
induces DNA synthesis in fission yeast (Yamano et al.,
1996
), it is possible that deregulation of the Start-promoting activity
is related to the proteolytic defect. In this aspect, it is intriguing
that the G1 arrest induced by mating pheromone exposure is
overridden in the budding yeast hct1 mutant (Schwab et
al., 1997
). This defect is suppressed by the deletion of the
CLB2 gene. In the epidermis of Drosophila Fzr-deficient embryos, extra division preceded by DNA replication occurs after mitosis 16 instead of arresting in G1 (Sigrist
and Lehner, 1997
). This also might be due to the defect of cyclin degradation. Even the mitotic B-cyclin can induce DNA replication (Amon
et al., 1994
; Irniger et al., 1995
; Fisher and
Nurse, 1996
); therefore, these cyclins escaping from degradation would
be responsible for the promotion of the progression from G1
to S-phase.
| |
ACKNOWLEDGMENTS |
|---|
We thank Drs. U. Leupold, P. Nurse, A.M. Carr, S. Moreno, T. Matsumoto, H. Okayama, K. Tanaka, T. Ishihara, K. Maundrell, K. Okazaki, and Y. Nagai for providing S. pombe strains and plasmids; and M. Yanagida and M. Yamashita for antibodies. We also thank many participants of third UK-Japan cell cycle workshop for valuable discussion. Part of this work was supported by Grants-in-Aid for Scientific Research by the Ministry of Education, Science, Sports and Culture of Japan to C.S.
| |
FOOTNOTES |
|---|
§ Present address: Gene Regulation Laboratory, Imperial Cancer Research Fund, Lincoln's Inn Fields, London WC2A 3PX, United Kingdom.
| |
REFERENCES |
|---|
|
|
|---|
-transducin homolog, is required for a subset of microtuble-dependent cellular process.
Mol. Cell Biol.
11, 5592-5602
dimer at 2.1Å resolution.
Nature
379, 369-374[Medline].This article has been cited by other articles:
![]() |
M. Sczaniecka, A. Feoktistova, K. M. May, J.-S. Chen, J. Blyth, K. L. Gould, and K. G. Hardwick The Spindle Checkpoint Functions of Mad3 and Mad2 Depend on a Mad3 KEN Box-mediated Interaction with Cdc20-Anaphase-promoting Complex (APC/C) J. Biol. Chem., August 22, 2008; 283(34): 23039 - 23047. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Yamamoto, K. Kitamura, D. Hihara, Y. Hirose, S. Katsuyama, and Y. Hiraoka Spindle checkpoint activation at meiosis I advances anaphase II onset via meiosis-specific APC/C regulation J. Cell Biol., July 28, 2008; 182(2): 277 - 288. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Trickey, M. Grimaldi, and H. Yamano The Anaphase-Promoting Complex/Cyclosome Controls Repair and Recombination by Ubiquitylating Rhp54 in Fission Yeast Mol. Cell. Biol., June 15, 2008; 28(12): 3905 - 3916. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kimata, A. Matsuyama, K. Nagao, K. Furuya, C. Obuse, M. Yoshida, and M. Yanagida Diminishing HDACs by drugs or mutations promotes normal or abnormal sister chromatid separation by affecting APC/C and adherin J. Cell Sci., April 1, 2008; 121(7): 1107 - 1118. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Almeida, J. P. Bolanos, and S. Moreno Cdh1/Hct1-APC Is Essential for the Survival of Postmitotic Neurons J. Neurosci., September 7, 2005; 25(36): 8115 - 8121. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Castillo-Lluva, T. Garcia-Muse, and J. Perez-Martin A member of the Fizzy-related family of APC activators is regulated by cAMP and is required at different stages of plant infection by Ustilago maydis J. Cell Sci., August 15, 2004; 117(18): 4143 - 4156. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Seino, T. Kishi, H. Nishitani, and F. Yamao Two Ubiquitin-Conjugating Enzymes, UbcP1/Ubc4 and UbcP4/Ubc11, Have Distinct Functions for Ubiquitination of Mitotic Cyclin Mol. Cell. Biol., May 15, 2003; 23(10): 3497 - 3505. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Synnes, E. A. Nilssen, E. Boye, and B. Grallert A novel chk1-dependent G1/M checkpoint in fission yeast J. Cell Sci., September 15, 2002; 115(18): 3609 - 3618. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Cueille, E. Salimova, V. Esteban, M. Blanco, S. Moreno, A. Bueno, and V. Simanis Flp1, a fission yeast orthologue of the S. cerevisiae CDC14 gene, is not required for cyclin degradation or rum1p stabilisation at the end of mitosis J. Cell Sci., March 9, 2002; 114(14): 2649 - 2664. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Bartholomew, S. H. Woo, Y. S. Chung, C. Jones, and C. F. J. Hardy Cdc5 Interacts with the Wee1 Kinase in Budding Yeast Mol. Cell. Biol., August 1, 2001; 21(15): 4949 - 4959. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Blanco, L. Pelloquin, and S. Moreno Fission yeast mfr1 activates APC and coordinates meiotic nuclear division with sporulation J. Cell Sci., January 6, 2001; 114(11): 2135 - 2143. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tournier and J. B.A. Millar A Role for the START Gene-specific Transcription Factor Complex in the Inactivation of Cyclin B and Cut2 Destruction Mol. Biol. Cell, October 1, 2000; 11(10): 3411 - 3424. [Abstract] [Full Text] |
||||
![]() |
A. Sveiczer, A. Csikasz-Nagy, B. Gyorffy, J. J. Tyson, and B. Novak Modeling the fission yeast cell cycle: Quantized cycle times in wee1- cdc25Delta mutant cells PNAS, July 5, 2000; 97(14): 7865 - 7870. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-X. Wang, B. C. Fisk, M. Wadehra, H. Su, and J. Braun Overexpression of murine fizzy-related (fzr) increases natural killer cell-mediated cell death and suppresses tumor growth Blood, July 1, 2000; 96(1): 259 - 263. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Rudner, K. G. Hardwick, and A. W. Murray Cdc28 Activates Exit from Mitosis in Budding Yeast J. Cell Biol., June 26, 2000; 149(7): 1361 - 1376. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Rudner and A. W. Murray Phosphorylation by Cdc28 Activates the Cdc20-dependent Activity of the Anaphase-promoting Complex J. Cell Biol., June 26, 2000; 149(7): 1377 - 1390. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Matsuyama, N. Yabana, Y. Watanabe, and M. Yamamoto Schizosaccharomyces pombe Ste7p Is Required for Both Promotion and Withholding of the Entry to Meiosis Genetics, June 1, 2000; 155(2): 539 - 549. [Abstract] [Full Text] |
||||
![]() |
C. Martín-Castellanos, M. A. Blanco, J. M. de Prada, and S. Moreno The puc1 Cyclin Regulates the G1 Phase of the Fission Yeast Cell Cycle in Response to Cell Size Mol. Biol. Cell, February 1, 2000; 11(2): 543 - 554. [Abstract] [Full Text] |
||||
![]() |
H. Yamada, S Matsumoto, and T Matsumoto High dosage expression of a zinc finger protein, Grt1, suppresses a mutant of fission yeast slp1(+), a homolog of CDC20/p55CDC/Fizzy J. Cell Sci., January 11, 2000; 113(22): 3989 - 3999. [Abstract] [PDF] |
||||
![]() |
W. Zachariae and K. Nasmyth Whose end is destruction: cell division and the anaphase-promoting complex Genes & Dev., August 15, 1999; 13(16): 2039 - 2058. [Full Text] |
||||
![]() |
D. C. Farruggio, F. M. Townsley, and J. V. Ruderman Cdc20 associates with the kinase aurora2/Aik PNAS, June 22, 1999; 96(13): 7306 - 7311. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Fraschini, E. Formenti, G. Lucchini, and S. Piatti Budding Yeast Bub2 Is Localized at Spindle Pole Bodies and Activates the Mitotic Checkpoint via a Different Pathway from Mad2 J. Cell Biol., May 31, 1999; 145(5): 979 - 991. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Lindner, J. Gregan, S. Montgomery, and S. E. Kearsey Essential Role of MCM Proteins in Premeiotic DNA Replication Mol. Biol. Cell, February 1, 2002; 13(2): 435 - 444. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||