![]() |
|
|
Vol. 9, Issue 6, 1309-1321, June 1998
Department of Physiology, University of California, San Francisco, San Francisco, California, 94143-0444
Submitted October 8, 1997; Accepted March 10, 1998| |
ABSTRACT |
|---|
|
|
|---|
The blocking of G1 progression by fission yeast pheromones requires inhibition of the cyclin-dependent kinase cdc2p associated with the B-cyclins cdc13p and cig2p. We show that cyclosome-mediated degradation of cdc13p and cig2p is necessary for down-regulation of B-cyclin-associated cdc2p kinase activity and for phermone-induced G1 arrest. The cyclin-dependent kinase inhibitor rum1p is also required to maintain this G1 arrest; it binds both cdc13p and cig2p and is specifically required for cdc13p proteolysis. We propose that rum1p acts as an adaptor targeting cdc13p for degradation by the cyclosome. In contrast, the cig2p-cdc2p kinase can be down-regulated, and the cyclin cig2p can be proteolyzed independently of rum1p. We suggest that pheromone signaling inhibits the cig2p-cdc2p kinase, bringing about a transient G1 arrest. As a consequence, rum1p levels increase, thus inhibiting and inducing proteolysis of the cdc13p-cdc2p kinase; this is necessary to maintain G1 arrest. We have also shown that pheromone-induced transcription occurs only in G1 and is independent of rum1p.
| |
INTRODUCTION |
|---|
|
|
|---|
Entry into S-phase and mitosis in the eukaryotic cell cycle is
controlled by the activation of cyclin-dependent kinases (CDKs). In the
yeasts, both processes are initiated by a single CDK core enzyme
encoded by cdc2 in fission yeast and CDC28 in
budding yeast. Cdc2p and Cdc28p associate with mitotic B-type cyclins
to initiate mitosis, cdc13p in fission yeast (Booher and Beach, 1988
;
Hagan et al., 1988
; Booher et al., 1989
; Moreno
et al., 1989
), and Clb1-4p in budding yeast (Ghiara
et al., 1991
; Surana et al., 1991
; Fitch et
al., 1992
; Richardson et al., 1992
) and with S-phase
B-cyclins to trigger S-phase, usually cig2p in fission yeast (Fisher
and Nurse, 1996
; Martin-Castellanos et al., 1996
; Mondesert
et al., 1996
) and Clb5-6p in budding yeast (Epstein and
Cross, 1992
; Kühne and Linder, 1993
; Schwob and Nasmyth, 1993
;
Schwob et al., 1994
). There is considerable overlap between
mitotic and S-phase B-cyclins (Schwob et al., 1994
; Fisher
and Nurse, 1996
; Mondesert et al., 1996
), and in fission
yeast a single cyclin cdc13p can bring about both S-phase and mitosis
(Fisher and Nurse, 1996
; Mondesert et al., 1996
). In budding
yeast, activation of S-phase Clbp-Cdc28p protein kinase depends on the
prior activation of Cdc28p associated with another class of
G1 cyclins, Cln1-3p.
The mechanisms ensuring the timely inactivation and activation of
cyclin B-CDK in G1 have been studied mainly in budding
yeast. S-phase Clbp-Cdc28p protein kinase is up-regulated by three
independent mechanisms, all of which involve Clnp-Cdc28p kinase
activity. Clnp-Cdc28p protein kinase 1) activates transcription of
CLB genes (Epstein and Cross, 1992
; Schwob and Nasmyth,
1993
) and 2) inactivates Clbp proteolysis (Amon et al.,
1994
). The latter involves ubiquitin-mediated degradation of B-type
cyclins, which requires the cyclosome (Sudakin et al., 1995
)
or anaphase-promoting complex consisting of eight subunits, including
Apc1p/bimEp/cut4p (Peters et al., 1996
; Yamashita et
al., 1996
; Zachariae et al., 1996
), Cdc16p, Cdc23p, and
Cdc27p (Irniger et al., 1995
; King et al., 1995
;
Tugendreich et al., 1995
). Cyclosome-mediated proteolysis is
activated at the metaphase-anaphase transition, and its activity is
maintained during early G1 where it contributes to the
prevention of a premature rise of Clbp-Cdc28p kinase activity (Irniger
et al., 1995
). 3) Clnp-Cdc28p protein kinase phosphorylates
the cyclin-dependent kinase inhibitor (CKI) Sic1p, targeting it for
ubiquitin-mediated degradation via the ubiquitin-conjugating enzyme
Cdc34p (Schwob et al., 1994
; Schneider et al.,
1996
). Sic1p is present in early G1 (Donovan et
al., 1994
; Schwob et al., 1994
) and specifically
inhibits Clbp-Cdc28p protein kinase activity (Mendenhall, 1993
; Schwob
et al., 1994
). Thus in budding yeast, down-regulation of
Clbp-associated kinase is brought about by transcriptional,
proteolytic, and CKI mechanisms that are relieved in late
G1 by Clnp-Cdc28p protein kinase activity. A second CKI in
budding yeast, Far1p, directly inhibits the Clnp-Cdc28p protein kinase
activity in response to pheromone and causes G1 arrest
(Chang and Herskowitz, 1990
). Far1p is activated by the pheromone-dependent MAP kinase Fus3p, allowing Far1p to bind and inhibit the Clnp-Cdc28p protein kinase (Peter et al., 1993
;
Peter and Herskowitz, 1994
).
In fission yeast, the CKI encoded by the rum1 gene plays a
crucial role in regulating the cyclin B-CDK activity in G1
(Moreno and Nurse, 1994
). rum1p is a potent in vitro inhibitor of cdc2p associated with the mitotic B-type cyclin cdc13p (Correa-Bordes and
Nurse, 1995
; Jallepalli and Kelly, 1996
) and also partly inhibits the
in vitro kinase activity associated with the G1 B-cyclin
cig2p (Correa-Bordes and Nurse, 1995
; Martin-Castellanos et
al., 1996
). A rum1
mutant initiates mitosis from
G1 when S-phase is blocked (Moreno and Nurse, 1994
). In
these cells, the mitotic cdc13p-cdc2p kinase is activated prematurely
(Correa-Bordes and Nurse, 1995
), suggesting that one function of rum1p
is to provide a safeguard that prevents mitosis from taking place in
G1 cells. rum1p is also required to extend G1
during nitrogen starvation or in a wee1 mutant background
(Moreno and Nurse, 1994
).
To better understand the mechanisms that control the activation of the
G1 cyclin B-cdc2p kinases in fission yeast, we have investigated the cell cycle controls that bring about pheromone-induced G1 arrest (Davey and Nielsen, 1994
; Imai and Yamamoto,
1994
). We have shown previously that the fission yeast-mating pheromone P-factor blocks entry into S-phase by inhibiting both the cig2p- and
cdc13p-associated cdc2p kinase activity in G1 (Stern and
Nurse, 1997
). Here we show that rum1+ is
required for this pheromone-induced G1 arrest. Our data
establish that the cdc13p-cdc2p kinase is the main target for rum1p,
whereas down-regulation of the cig2p-associated kinase activity can
occur by another mechanism. Mutants in the cyclin B degradation
machinery accumulate both cig2p and cdc13p and fail to arrest in
G1 in response to pheromones. Turnover of cdc13p requires
rum1p, whereas cig2p turnover can occur in the absence of rum1p,
suggesting that rum1p may act as an adaptor specifically targeting
cdc13p for cyclosome-dependent degradation.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Fission Yeast Strains and Methods
The following strains were constructed:
h
cdc22-M45cyr1
::LEU2
sxa2
::ura4+leu1-32ura4-D18;
h
rum1-HAcyr1
::LEU2sxa2
::ura4+ leu1-32ura4-D18ade6-704his3-D1;
h
cyr1
::LEU2sxa2
::ura4+:: REP6Xrum1leu1-32ura4-D18ade6-704;
h
rum1
::his3+cyr1
:: LEU2sxa2
::ura4+leu1-32ura4-D18his3-D1ade6-704;
h
cdc10- 129rum1
::his3+cyr1
::LEU2sxa2
::ura4+leu1-32ura4-D18his3D1ade6-704;
h
rum1
::his3+cig2
::ura4+cyr1
::LEU2sxa2
:: ura4+leu1-32ura4-D18his3-D1ade6-704;
h
nuc2-663
cyr1
::ura4+ sxa2
::ura4+leu1-32ura4-D18ade6-704.
Strains were constructed using random spore analysis. Candidate
colonies with the appropriate selectable markers and mutations were
tested for formation of conjugation tubes on agar plates containing 3 µg/ml P-factor. Only
h
cyr1
sxa2
mutant
cells will respond to P-factor and grow conjugation tubes.
rum1
:his3+ and
nuc2ts mutants were crossed into the
h
cyr1
sxa2
background in the presence of a nuc2 plasmid or
rum1 plasmid, respectively. The plasmids were lost after
selection of the
h
rum1
cyr1
sxa2
and
h
nuc2-663cyr1
sxa2
triple mutants using marker selection or temperature-sensitive phenotype and response to P-factor on agar plates or both. For the
construction of the
cig2
rum1
cyr1
sxa2
,
quadruple mutant colonies were tested by PCR for the absence of
cig2+. A pheromone-responsive strain carrying an
N-terminal hemagglutinin peptide (HA)-tagged rum1 at the
rum1 locus (Correa-Bordes and Nurse, 1995
) was selected on
the basis of an increased size of a rum1-HA PCR product
compared with the rum1 wild-type allele.
Media and growth conditions were as described by Moreno et
al. (1991)
. Physiological experiments with P-factor, flow
cytometric analysis (FACS), cell number, and cell size measurements
were as described by Stern and Nurse (1997)
.
Construction of a rum1
::his3+ Mutant
Strain
A 1.9-kb SpeI fragment containing the whole
rum1+ open reading frame was removed from a
6.1-kb genomic rum1+ clone in pTZ18R and
replaced by blunt-end ligation with a 1.8-kb EcoRV-DraI fragment of the
his3+ gene. The linearized 6.1-kb
rum1
::his3+ deletion
construct was transformed into a his3-D1 strain, and a
stable his prototroph colony was isolated. Southern blotting established that the integration had taken place at the
rum1+ locus. The
rum1
::his3+ mutant was
sterile and synthetically lethal with a cdc10.129 allele
like the previously described
rum1::ura4+ strain (Moreno and Nurse,
1994
). Both phenotypes were rescued in the presence of a
rum1+-containing plasmid. A single copy of the
EcoRV-DraI his3+ fragment
does not fully rescue the his3-D1 deletion in liquid culture. We
therefore supplemented the medium with histidine for physiological
experiments.
RNA Preparation and Northern Blot
RNA was prepared by glass bead lysis in the presence of phenol and SDS and was subsequently separated using a formaldehyde gel. Ten micrograms as measured by OD260 were loaded in each track. Probes for blotting were prepared by random oligo priming with [32P]dATP using a Prime-It kit (Stratagene, La Jolla, CA).
Cloning of mat1-Mm and fus1
A 210-bp fragment of the mat1-Mm gene was amplified from genomic DNA by PCR using the following primers: CATATGCATTTGTATAGCAT and AATAATGTCAGCAGAAGACC. The resulting PCR fragment was cloned into the REP5 vector using the NdeI and BamHI sites in the primers. A 1.1-kb fragment of the fus1 gene was amplified in a similar manner using the following primers: CGGGATCCGGGGTACTCAAGTGTTACGTCTGG and CGGGATCCAGCTGCTTTAGCCGTTTAGAAGG. The resulting PCR fragment was cloned into pKS+ using the BamHI sites in the primers.
Protein Kinase Assays and Immunoprecipitations
Kinase assays were performed as described by Stern and Nurse
(1997)
. Cig2p-associated cdc2p kinase activity was immunoprecipitated from 3.8 mg (Figure 3A) and 2.5 mg (Figure 5B) of soluble extract with
10 µl of anti-cig2p polyclonal serum MOC8 (Stern and Nurse, 1997
).
Cdc13p-associated kinase activity was immunoprecipitated with 10 µl
of anti-cdc13p serum SP4 (Moreno et al., 1989
) from 1 mg
(Figure 3A) and 2.5 mg (Figure 5B) of soluble extract.
For cyclin immunoprecipitations (Figure 3B), 6 mg of soluble extract were incubated for 15 min at 4°C with 20 µl of polyclonal rabbit anti-cig2p serum (MOC8), with polyclonal rabbit anti-cdc13p serum (SP4), or with the respective preimmune serum. Rum1-HAp was immunoprecipitated for 30 min at 4°C from 9.5 mg of soluble extract (Figure 3C) with 30 µl of 12CA5 mAbs coupled to AffiGel beads (Bio-Rad, Richmond, CA; 4.3 mg/ml).
The immunoprecipitations were washed three times with 1 ml of HB buffer, boiled in 1× SDS sample buffer, separated on 10% SDS-PAGE, and Western blotted. The filters were probed for rum1HAp (Figure 3B) with the 12CA5 mAb (1:500 dilution), for cig2p (Figure 3C) with affinity-purified rabbit anti-cig2p antibody MOC6 (1:2000), and for cdc13p with affinity-purified rabbit anti-cdc13p SP4 (1:1000) (Figure 3C).
Western Blot
For Western blotting, 1-4 × 108 cells were
harvested by centrifugation, washed once with ice-cold STOP buffer (150 mM NaCl, 50 mM NaF, 10 mM EDTA, 1 mM NaN3, pH 8.0),
resuspended in 50-100 µl of HB buffer, and boiled for 4 min. Glass
beads were added to the meniscus, and cells were broken by vortexing on
an IWAKI TWM 4836 microtube mixer (Iwaki Glass, Ikuta, Japan) for 2-5
min. Extract (50 µg) was separated on 10% SDS-PAGE (Laemmli, 1970
) and transferred to ECL nitrocellulose or an Immobilon-P membrane (Millipore, Bedford, MA), and the protein of interest was detected using ECL (Amersham, Arlington Heights, IL). Dilutions of the antibodies were 1:1000 (Figure 5C) and 1:2000 (Figure 3C) for the
anti-cig2p affinity-purified polyclonal antibody, 1:1000 for rabbit
anti-cdc13p antibodies (SP4), 1:1000 for rabbit anti-rum1p antibodies
(Correa-Bordes and Nurse, 1995
), and 1:50,000 for the anti-
-tubulin
monoclonal antibody (T5168; Sigma, St. Louis, MO).
In Vivo 35S-Methionine Labeling
Cells were grown in minimal medium with glutamate (1 g/l) as a nitrogen source, to an OD595 of 0.5 (6 × 106 cells/ml) in the presence or absence of P-factor. Cells (10 ml) were incubated with 600 µCi of 35S-methionine (Amersham Promix) for 10 min. After labeling, cells were harvested and washed with 10 ml of cold STOP buffer, resuspended in 50 µl of HB buffer, and broken with 1 ml of glass bead for 1 min. After cell breakage, the crude extract was recovered with 1 ml of cold HB buffer. Cell debris was removed by a 5-min spin in a microcentrifuge, and rum1p was isolated by immunoprecipitation with 10 µl of rum1p antiserum.
| |
RESULTS |
|---|
|
|
|---|
CDK Inhibitor rum1p Is Required for Pheromone-induced G1 Arrest
The mating pheromone P-factor brings about G1 arrest
by inhibiting the cdc2p protein kinase activity (Stern and Nurse,
1997
). Given that the CKI rum1p is present during G1 and is
required for pheromone-induced conjugation (Moreno and Nurse, 1994
), it is possible that rum1p may have an analogous role to budding yeast Far1p in bringing about pheromone-induced G1 arrest (Imai
and Yamamoto, 1994
). To test this possibility, we crossed a
rum1
into a cyr1
sxa2
background. This genetic background is required to observe
P-factor-induced G1 arrest in exponentially growing cells. Elimination of the adenylate cyclase
cyr1+ gene leads to constitutive expression of
nutritionally controlled genes, including components of the pheromone
signal transduction cascade (Maeda et al., 1990
; Kawamukai
et al., 1991
; Sugimoto, 1991
); sxa2+
encodes a P-factor-degrading protease (Imai and Yamamoto, 1992
; Ladds
et al., 1996
). Control
h
rum1+cyr1
sxa2
cells were completely arrested in G1 6 h after
addition of P-factor (Figure 1A). In
contrast, addition of P-factor to h
rum1
cyr1
sxa2
cells failed to arrest them in G1 (Figure 1A), and
the cells continued to divide like untreated cells (Figure 1B). Similar
results were obtained with
h+rum1
cyr1
, which
did not arrest in G1 in response to the mating pheromone
M-factor (our unpublished results). We conclude that rum1 is
required for pheromone-induced G1 arrest.
|
To investigate whether ectopic expression of rum1 rescues
the G1 arrest defect, we integrated a REP6Xrum1 plasmid
with the rum1 cDNA under the control of the
thiamine-repressible nmt promoter (Maundrell, 1993
) into a
rum1
strain. In this strain, pheromone-induced G1 arrest was restored even when the promoter was switched
off in the presence of thiamine (Figure 1C), indicating that low-level ectopic expression of rum1 is sufficient to rescue the
G1 arrest defect.
rum1p is barely detectable in exponentially growing cells. If rum1p has
a physiological role in bringing about G1 arrest in response to pheromone, then rum1p levels need to increase after pheromone addition to cells. As expected, rum1p levels increased rapidly and became maximal within 2-3 h (Figure
2A, left panel) after pheromone addition
to cells. Previous work has shown that rum1p levels increase when cells
are arrested in G1 (Correa-Bordes and Nurse, 1995
).
Therefore, the increase in rum1p levels after pheromone addition could
be an effect of the G1 arrest induced by pheromone. To
investigate this further, P-factor was added to cells arrested in
G2 using a cdc25ts (cdc25-22)
mutant. These G2-arrested cells are capable of responding to pheromone (Stern and Nurse, 1997
) but did not accumulate rum1p (Figure 2A, middle panel), suggesting that cells need to be in G1 for rum1p to be induced. Furthermore, the addition of
P-factor to nitrogen-starved cells already blocked in G1
did not lead to a further increase of rum1p levels (Figure 2B),
indicating that pheromone addition to these G1 cells had no
further direct effect on rum1p induction. This suggests that pheromone
may not directly induce rum1p accumulation but, rather, that rum1p is
induced after pheromone addition as an indirect consequence of cells
arresting in G1. We conclude that the primary role for
rum1p may be in maintaining G1 arrest after pheromone
addition rather than in bringing about the initial G1
arrest.
|
The increase of rum1p levels in cells blocked in G1
by P-factor still occurred in cells expressing a constant low level of rum1 from the nmt promotor (Figure 2A, right
panel). This suggests that rum1p up-regulation involves primarily
posttranscriptional mechanisms. Increased rum1 transcription
might contribute, however, to the increased level of rum1p in
pheromone because rum1 transcript levels increased
~1.6-fold after P-factor addition (Figure 2C). The
posttranscriptional mechanism probably involves changes in rum1p
turnover, as pulse labeling of cells with 35S-methionine
for 10 min showed that the levels of rum1p translation were not
increased in pheromone-treated cells (Figure 2D). This conclusion is
supported by the recent observation that rum1p accumulates in
proteasome mutants that are defective in ubiquitin-mediated proteolysis
(Benito et al., 1998
).
Cdc13p-associated cdc2p Kinase Is Deregulated in a rum1 Mutant
Next we investigated further the effects of rum1p on the
cdc2p kinase during G1 cell cycle arrest in pheromone. In
vitro, rum1p inhibits the cdc13p-associated kinase and to a lesser
extent the cig2p-associated kinase (Correa-Bordes and Nurse, 1995
).
Both cyclins can promote S-phase (Fisher and Nurse, 1996
; Mondesert et al., 1996
), and so the cdc2p kinase activity associated
with both cyclins needs to be inhibited to bring about and maintain G1 arrest. Thus, the failure of rum1
cells to
undergo pheromone-induced G1 arrest could be due to a lack
of inhibition of either the cig2p- or cdc13p-associated cdc2p protein
kinase activity. We monitored both kinase activities in a
rum1
mutant after addition of P-factor. The
cig2p-associated activity still responded to P-factor falling to a low
level within 4 h, whereas the cdc13p-associated activity remained
high (Figure 3A). This indicates that the
rum1p inhibitor is required to inhibit cdc13p-associated kinase
activity but not to inhibit cig2p-associated kinase activity.
|
We confirmed that the inappropriate entry into S-phase in
pheromone-treated rum1
cells does not require
cig2 by using a
cig2
rum1
cyr1
sxa2
quadruple mutant. We found that a cig2
background did not
restore the ability of a rum1
to G1 arrest in
response to P-factor (Figure 3D), indicating that cig2 is
not required in a rum1
mutant to overcome the
G1 block. Because cdc13p is the major B-type cyclin compensating for the loss of cig2, these results indicate
that the premature onset of S-phase observed in pheromone-treated
rum1
cells results from deregulation of the
cdc13p-associated kinase activity rather than the cig2p-associated
kinase activity.
Given these results, we used a
rum1-HAcyr1
sxa2
strain to test whether
rum1p physically associated with cdc13p after pheromone addition.
Immunoprecipitations of cdc13p and cig2p before and after addition of
pheromone were analyzed by Western blotting with anti-HA antibodies.
rum1p was found associated with cdc13p, and this association was
increased after 3 h in P-factor (Figure 3B). rum1p was also found
associated with cig2p, although the amount detected was lower (Figure
3B). In a reciprocal experiment, rum1HAp immunoprecipitation was found
to coprecipitate 2 pmol of cig2p and 6 pmol of cdc13p (Figure 3C).
Similar results were obtained by immunoprecipitations of rum1p from a
cig2-HAcyr1
sxa2
strain (our unpublished
results). The different amounts of cig2p and cdc13p in rum1p
precipitations are similar to the different cyclin B concentrations in
the cell, because the level of cdc13p is about three times that of
cig2p (Figure 3C and our unpublished results). The increased amount of
cdc13p associated with rum1p is consistent with rum1p having an effect
on the cdc13p-associated cdc2p protein kinase.
rum1p Is Required for Cyclosome-dependent Proteolysis of cdc13p during Pheromone-induced G1 Arrest
We also found that rum1p is required for cdc13p proteolysis during
the response to pheromone. We monitored cdc13p levels after P-factor
addition in rum1+ cells and found that they
became reduced within 2 h of P-factor addition and were very low
by 6 h after addition (Figure 4).
This drop in level contributed to the observed inhibition of
cdc13p-associated kinase activity. In rum1
cells, cdc13p
levels remained completely constant (Figure 4). Cdc13
transcript levels were unchanged after addition of P-factor to
rum1+ and rum1
cells, indicating
that transcriptional control does not contribute to regulation of
cdc13p in pheromone (our unpublished observations). These results
establish that rum1p is required for the reduction in cdc13p levels
observed after pheromone addition.
|
Given this result, we investigated whether cyclosome-mediated cyclin B
degradation was required for pheromone-induced G1 arrest. The nuc2+ gene encodes a component of the
cyclosome and is homologous to the budding yeast CDC27 gene
(Hirano et al., 1990
; Goebl and Yanagida, 1991
). When
pheromone was added to the temperature-sensitive nuc2-663 mutant at the permissive temperature of 25°C, only 10% of cells arrested in G1, demonstrating that complete
nuc2+ activity is required to bring about
G1 arrest (Figure 5A). This effect was completely reversed by nuc2+
expression from a plasmid (Figure 5A). Cdc13p level and associated kinase activities remained high (Figure 5, B and C, bottom panels), indicating that the nuc2 gene product and thus the cyclosome
are required for pheromone-induced proteolysis of cdc13p. We have shown
previously that nondegradable cdc13p prevents pheromone-induced G1 arrest (Stern and Nurse, 1997
). Together these data
suggest that in pheromone-treated cells cdc13p undergoes proteolysis by a mechanism that requires both rum1p and the cyclosome. This
proteolysis keeps cdc13p-associated kinase activity low, allowing
G1 arrest to be maintained in the presence of pheromone.
|
The Cyclosome Mediates cig2p Degradation in the Pheromone-induced G1 Arrest
The B-cyclins cig2p and cdc13p are redundant for promoting entry
into S-phase, and so the cdc2p kinase activity associated with both
cyclins needs to be inhibited to bring about G1 arrest in
pheromone. Therefore we investigated the mechanism by which pheromone
inhibits cig2p-associated kinase activity by monitoring cig2p levels.
Cig2p levels and associated kinase activity decreased in
pheromone-treated nuc2+ cells and reached low
levels 4 h after P-factor addition (Figure 5, B and C, wt). In the
nuc2-663 mutant, cig2p levels and cig2p-associated kinase
activities remained high (Figure 5, B and C, top panels). This
contrasts to the situation in a rum1
, where the
cig2p-associated kinase activity was down-regulated in response to
pheromone (Figure 3A). Cig2p levels were also down-regulated in a
rum1
after addition of P-factor (Figure 5C). This was not
due to reduced cig2 transcription, which was maintained at a
constant level after addition of P-factor to rum1
cells
(our unpublished observations). Thus, rum1
and nuc2-663 mutants are similar in that they fail to arrest in
G1 in response to pheromone but differ in cig2p turnover,
which can occur in a rum1
but not a nuc2-663
mutant. We conclude that cig2p-associated kinase activity is
down-regulated in pheromone by cyclosome-induced cig2p proteolysis, but
unlike the situation with cdc13p, this proteolysis does not require
rum1p.
Effects of rum1 on Pheromone-induced Transcription
The experiments described above identify a role for rum1p in
maintaining G1 arrest after pheromone addition. We next
investigated whether lack of rum1 also affects the
pheromone-induced transcription using the mating type gene
mat1-Mm, which is specifically induced by P-factor (Willer
et al., 1995
). Figure 6A shows
that mat1-Mm transcript was induced in a
cyr1
sxa2
after addition of P-factor. In a
rum1
cyr1
sxa2
triple mutant,
mat1-Mm transcripts were still induced by P-factor, but to a
much lower level (Figure 6A).
|
This reduction could have been either because rum1 was
directly required for activation of pheromone-dependent transcription or because full induction of pheromone-dependent genes required G1 arrest, which was defective in the rum1
mutant. To distinguish between these two explanations, we assessed the
expression of P-factor-induced transcription at various stages in the
cell cycle. A cyr1
sxa2
strain was arrested
in G1 using the temperature-sensitive cdc10-129 and cdc2-M26 mutants or in early
S-phase using hydroxyurea and the temperature-sensitive
cdc22-M46 mutant. The cultures were shifted to 25°C after
cell cycle arrest and incubated in P-factor for 90 min. Samples for RNA
preparation were taken at the beginning and the end of the P-factor
treatment, and the transcript levels of two P-factor-dependent genes,
mat1-Mm (Willer et al., 1995
) and fus1
(Petersen et al., 1995
), were assessed. Both genes were induced by P-factor in G1-arrested cdc10-129
and cdc2-M26 mutant cells, but little induction was
observed in cells released from the S-phase blocks (Figure 6B). To test
pheromone-dependent transcription in G2 cells, a
cdc25-22cyr1
sxa2
strain was arrested in
G2 for 4 h at 36°C and kept at the restrictive
temperature during the subsequent 90 min exposure to P-factor. Although
fus1 and mat1-Mm transcripts were induced in a
cdc25+ control strain, induction was severely
reduced in cdc25-22 mutant cells. These results indicate
that P-factor can induce expression of pheromone-dependent genes in the
G1 phase of the cell cycle, but expression is much reduced
at later stages of the cell cycle. Therefore the low level of
mat1-Mm expression in rum1
cells is likely to
be caused by the failure of this strain to arrest in G1.
To test this conclusion, a
cdc10-129rum1
cyr1
sxa2
quadruple mutant was exposed to P-factor after a 2 h incubation at
36°C. P-factor induced a higher level of mat1-Mm
transcript in cells that were prearrested in G1 than in
cells without the 36°C preincubation (Figure 6C). This result
indicates that the level of mat1-Mm transcript in a
rum1
is reduced because of the shortened G1
and can be elevated by prearresting rum1
cells in
G1. We conclude that pheromone can induce transcription
only in G1-arrested cells and that the effects of
rum1 on pheromone-induced transcription are because rum1p is
required to maintain cells in G1 for that induction to take
place.
| |
DISCUSSION |
|---|
|
|
|---|
In this article we have investigated the effects of the CKI rum1p and cyclosome-dependent cyclin B degradation on pheromone-induced inhibition of the CDK cdc2p. Our major observations are as follows: 1) cyclosome-mediated degradation of cig2p and cdc13p is essential for down-regulation of cyclin B-cdc2p kinase activity during pheromone-induced G1 arrest; 2) rum1p is required to maintain this G1 arrest and specifically inhibits the cdc13p-cdc2p kinase; 3) rum1p mediates cdc13p turnover, whereas cig2p turnover can occur in a rum1-independent manner, indicating that rum1p is specifically required for cdc13p degradation by the cyclosome; and 4) pheromone-induced transcription requires cells to be in G1 and is independent of rum1p.
Proteolysis of both cig2p and cdc13p B-cyclins in pheromone was shown
to require the cyclosome by the lack of proteolysis in cells defective
for the nuc2p cyclosome subunit (Figure 5). Thus cyclosome-mediated
degradation of these B-cyclins is an important mechanism for
pheromone-induced G1 arrest. The maintenance of cyclosome
activity during pheromone-induced G1 arrest may involve cAMP. The cyclosome is stabilized by low cAMP levels, and mutants in
cut4, the fission yeast Apc1/BimE cyclosome subunit, are
sensitive to high levels of cAMP (Yamashita et al., 1996
).
Pheromone response requires low levels of cAMP, and this could act in
part by maintaining the cyclosome activity required to bring about
cig2p and cdc13p proteolysis.
The CKI rum1p is also required for cdc13p cyclin B proteolysis and for
down-regulation of cdc13p-cdc2p CDK activity. Levels of cdc13p and
cdc13p-cdc2p CDK activity remain high in pheromone-treated rum1
cells, and rum1p physically interacts with cdc13p
(Figure 3). This effect on proteolysis is specific because cig2p cyclin degradation does not require rum1p, even though rum1p can associate with cig2p (Figure 3). The fact that cig2p proteolysis still occurs in
rum1
cells in a cyclosome-dependent manner indicates that the failure to turn over cdc13p is not simply due to the
rum1
cells proceeding to a later stage in the cell cycle
when the cyclosome is inactive. These data corroborate recent results
that suggest that rum1p is required for cdc13p degradation in
G1 cells arrested at the cdc10 block point (Correa-Bordes
et al., 1997
). We propose that rum1p in pheromone-treated
cells acts as an adaptor protein specifically targeting cdc13p for
degradation by the cyclosome during G1 and thus maintaining
G1 arrest. rum1p is not required for the cdc13p proteolysis
occurring at mitotic exit but may be necessary for inhibiting and
degrading the cdc13p kinase during G1. In contrast, rum1p
is not required for cig2p proteolysis, suggesting either that no
adapter protein is necessary or that one still has to be identified.
Similar to rum1
, mutants in the srw1+ gene specifically stabilize cdc13p but not
cig2p (Yamaguchi et al., 1998
). rum1+
and srw1+ might act together to target cdc13p
for degradation.
The initial G1 arrest brought about by pheromone is likely
to involve inhibition of the cig2p-cdc2p protein kinase by a mechanism that is independent of rum1p, although the molecular mechanism underlying pheromone signaling and the inhibition and proteolysis of
the cig2p-cdc2p protein kinase remain to be elucidated. We imagine
that these mechanisms bring about a transient G1 arrest but
that this cannot be maintained without further inhibition of the
cdc13p-cdc2p protein kinase, because the latter can substitute for
cig2p-cdc2p in bringing about S-phase (Fisher and Nurse 1996
; Stern
and Nurse, 1996
). The transient G1 arrest leads to a rise in rum1p levels that in turn prevents cdc13p-cdc2p protein kinase activity from increasing.
rum1p may also be able to inhibit cig2p-cdc2p activity at least
temporarily, as suggested previously (Martin-Castellanos et al., 1996
), given that cig2p and rum1p physically interact;
however, cig2p is unlikely to be an important long-term target of rum1p given that a cig2
does not rescue the G1
arrest defect of a rum1
. The fact that a
cig2
can rescue the sterility of a rum1
may be because conjugation and sporulation require both a pheromone and a
starvation signal, and starvation-induced G1 arrest is
partially restored in a cig2
(Martin-Castellanos et
al., 1996
).
The rum1
phenotype in pheromone is superficially
reminiscent of the pheromone response of far1 mutants in
budding yeast. Although both rum1 and FAR1 encode
CKIs that are essential for pheromone-induced G1 arrest,
there are important differences between their activities. Far1p
inhibits the Cdc28p activity associated with the G1 Clnp
cyclins (Peter and Herskowitz, 1994
), whereas rum1p specifically
inhibits cdc2p associated with the mitotic B-cyclin cdc13p
(Correa-Bordes and Nurse, 1995
). Far1p is required exclusively for the
pheromone response and is only active as a CDK inhibitor after
phosphorylation by the pheromone-dependent MAP kinase Fus3p (Peter
et al., 1993
). In contrast, the rum1 function is
not confined to pheromone response, being required in other situations
with a prolonged G1 phase, such as the extended
G1 in a wee1-50 mutant or after nitrogen
starvation (Moreno and Nurse, 1994
), and in cells arrested in
G1 by a cdc10.129 block (Correa-Bordes and
Nurse, 1995
). Also there is no evidence that rum1p needs an MAP
kinase-dependent phosphorylation event for activation. Bacterially produced rum1p is fully active as an inhibitor of cdc13p-cdc2p kinase
(Correa-Bordes and Nurse, 1995
), and a truncated rum1
lacking all putative MAP kinase phosphorylation sites is able to rescue the sterility of a rum1
(Stern and Nurse, unpublished
observations). rum1p has more in common with the second budding yeast
CKI, Sic1p. Both are induced in G1 and inhibit cyclin
B-associated CDK to prevent premature onset of S-phase. However,
despite these similarities, there is only very limited sequence
homology between Sic1p and rum1p. The phenotypic consequences of loss
of rum1 and SIC1 are also different, because
SIC1 is not required for sexual differentiation.
In this study we also found that pheromone induces transcription
of the pheromone-dependent genes mat1-Mm and fus1
only in G1 cells (Figure 6). The cell cycle regulation of
pheromone-dependent transcription might help restrict conjugation to
the G1 phase of the cell cycle. Yeast cells cannot
conjugate when arrested in G2, and mutants such as
rum1
and nuc2-663 that fail to arrest in
G1 under mating conditions are sterile (Moreno and Nurse,
1994
; Kumada et al., 1995
). The failure to express
pheromone-dependent genes later in the cell cycle could be due to
reduced pheromone signaling or because a component of the
transcriptional apparatus can only be activated in G1. A
possible candidate is the transcription factor ste11p (Sugimoto
et al., 1991
), which is required for both nitrogen
starvation and pheromone-induced transcription (Aono et al.,
1994
; Petersen et al., 1995
). Pheromone-dependent
transcription is also cell cycle regulated in budding yeast (Oehlen and
Cross, 1994
). The expression profile of pheromone-dependent transcripts is controlled by the activity of the G1 CDK activity,
Clnp-Cdc28p (Oehlen and Cross, 1994
). Transcript levels are high in
early G1 and in S and G2 when Clnp-Cdc28p
protein kinase activity is low, and they dip in late G1
when Clnp-Cdc28p protein kinase activity is high. Fission yeast may
use a similar mechanism with cyclin B-cdc2p kinase activity, which is
present from late G1 until the end of mitosis, to restrict
pheromone-induced transcription to G1.
Fission yeast appears to use quick and reversible CKI action with
irreversible cyclin turnover to inhibit B-cyclin kinases and maintain
pheromone-induced G1 arrest. A combination of CKI-mediated inhibition and proteolysis also controls the Clbp-associated kinase in budding yeast. Overexpression of nondegradable mitotic
Clb2p can overcome pheromone-induced G1 arrest (Amon
et al., 1994
), and mutants in the cyclin B- and CDK-specific
CKI Sic1p undergo premature S-phase after expression of nondegradable
Clb5p in early G1 cells (Schwob et al., 1994
). A
recent study shows that cyclosome mutants in budding yeast are
defective in pheromone-induced G1 arrest similar to fission
yeast nuc2 mutants (Irniger and Nasmyth, 1997
). Precocious
S-phase in cyclosome mutants can be rescued by ectopic expression of
Sic1p (Irniger and Nasmyth, 1997
), indicating that CKI and cyclin
proteolysis cooperate in G1 regulation as in fission yeast.
A major difference with fission yeast is that budding yeast secures a
low cyclin B-associated kinase in early G1 by both
transcriptional and posttranscriptional mechanisms. In fission yeast
cdc13+ and cig2+
transcription are not down-regulated in G1 (Correa-Bordes
and Nurse, 1995
; Stern and Nurse, 1997
), leaving the
posttranscriptional mechanisms of cyclin B degradation and the CKI
rum1p as the sole control of cyclin B-associated kinase in
G1. Posttranscriptional control using CKIs and regulation
of cyclin B turnover may be the more generally used mechanism to
control cyclin B-CDKs in G1, with a transcriptional
control providing a more robust control system.
It will be important to determine whether both CKIs and
cyclosome-mediated proteolysis are involved in down-regulating cyclin B-CDKs or the related cyclin A-CDK in G1 in higher
eukaryotes. Cyclin A-associated CDKs have been implicated in the
control of both S-phase (Girard et al., 1991
; Pagano
et al., 1992
) and mitosis (Lehner and O'Farrell, 1989
;
Minshull et al., 1989
) in the Metazoa, and it may be crucial
to tightly control its activity during G1. Loss of the
Drosophila gene fizzy-related, which is involved
in degradation of A and B cyclins, results in cells failing to exit the
cell cycle in G1, suggesting that down-regulation of
mitotic cyclins in G1 might be equally important in higher
eukaryotes as in yeast (Sigrist and Lehner, 1997
). The Drosophila
roughex (rux) gene also controls cyclin A kinase
activity in G1 (Gönczy et al., 1994
;
Thomas et al., 1994
; Dong et al., 1997
). Like the rum1
mutant, rux mutant cells fail to arrest
in G1, and they enter S-phase prematurely, with elevated
cyclin A-associated kinase activity (Thomas et al., 1994
;
Sprenger et al., 1997
; Thomas et al., 1997
).
rux may have a task similar to that of rum1 in
fission yeast or SIC1 in budding yeast by preventing cyclin
A from activating S-phase in early G1.
| |
ACKNOWLEDGMENTS |
|---|
We thank Jacky Hayles, Benjamin Baum, Patrick Zarzov, and Takashi Toda for critical comments and suggestions, J. Correa-Bordes for his assistance concerning kinase assays and rum1p biochemistry, Takashi Toda for providing a nuc2-663 strain, and all members of the ICRF Cell Cycle Laboratory for their help and support. This work was funded by ICRF. B.S. was also supported by a Boehringer Ingelheim Fonds fellowship.
| |
FOOTNOTES |
|---|
* Present address: Cell Cycle Laboratory, Imperial Cancer Research Fund, 44 Lincoln's Inn Fields, London WC2A 3PX, United Kingdom.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. Kjaerulff, N. R. Andersen, M. T. Borup, and O. Nielsen Cdk phosphorylation of the Ste11 transcription factor constrains differentiation-specific transcription to G1 Genes & Dev., February 1, 2007; 21(3): 347 - 359. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Alvarez and S. Moreno Fission yeast Tor2 promotes cell growth and represses cell differentiation J. Cell Sci., November 1, 2006; 119(21): 4475 - 4485. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Ferreira and J. P. Cooper Two modes of DNA double-strand break repair are reciprocally regulated through the fission yeast cell cycle Genes & Dev., September 15, 2004; 18(18): 2249 - 2254. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Carmichael, P. Provost, K. Ekwall, and T. C. Hobman Ago1 and Dcr1, Two Core Components of the RNA Interference Pathway, Functionally Diverge from Rdp1 in Regulating Cell Cycle Events in Schizosaccharomyces pombe Mol. Biol. Cell, March 1, 2004; 15(3): 1425 - 1435. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Niccoli and P. Nurse Different mechanisms of cell polarisation in vegetative and shmooing growth in fission yeast J. Cell Sci., April 15, 2002; 115(8): 1651 - 1662. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Blanco, L. Pelloquin, and S. Moreno Fission yeast mfr1 activates APC and coordinates meiotic nuclear division with sporulation J. Cell Sci., January 6, 2001; 114(11): 2135 - 2143. [Abstract] [Full Text] [PDF] |
||||
![]() |
B Grallert, S. Kearsey, M Lenhard, C. Carlson, P Nurse, E Boye, and K Labib A fission yeast general translation factor reveals links between protein synthesis and cell cycle controls J. Cell Sci., January 4, 2000; 113(8): 1447 - 1458. [Abstract] [PDF] |
||||
![]() |
K. Lindner, J. Gregan, S. Montgomery, and S. E. Kearsey Essential Role of MCM Proteins in Premeiotic DNA Replication Mol. Biol. Cell, February 1, 2002; 13(2): 435 - 444. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||