![]() |
|
|
Vol. 9, Issue 6, 1565-1576, June 1998

Department of Molecular and Cell Biology, Howard Hughes Medical Institute, University of California, Berkeley, Berkeley, California 94720
Submitted January 26, 1998; Accepted March 23, 1998| |
ABSTRACT |
|---|
|
|
|---|
Chitin synthase III (CSIII), an enzyme required to form a chitin
ring in the nascent division septum of Saccharomyces
cerevisiae, may be transported to the cell surface in a
regulated manner. Chs3p, the catalytic subunit of CSIII, requires the
product of CHS6 to be transported to or activated at the
cell surface. We find that chs6
strains have
morphological abnormalities similar to those of chs3
mutants. Subcellular fractionation and indirect immunofluorescence
indicate that Chs3p distribution is altered in chs6
mutant cells. Order-of-function experiments using
end4-1 (endocytosis-defective) and chs6
mutants indicate that Chs6p is required for anterograde transport of
Chs3p from an internal endosome-like membrane compartment, the
chitosome, to the plasma membrane. As a result, chs6
strains accumulate Chs3p in chitosomes. Chs1p, a distinct chitin
synthase that acts during or after cell separation, is transported
normally in chs6 mutants, suggesting that Chs1p and
Chs3p are independently packaged during protein transport through the
late secretory pathway.
| |
INTRODUCTION |
|---|
|
|
|---|
Three temporally and spatially regulated chitin synthesis events
occur during the Saccharomyces cerevisiae cell cycle (Shaw et al., 1991
; Bulawa, 1993
; Cid et al., 1995
).
Chitin synthase III activity (CSIII) is required early in the cell
cycle for chitin ring formation and later in the cell cycle for lateral
cell wall chitin synthesis (Shaw et al., 1991
). Late in
mitosis, chitin synthase II activity (CSII) is required for primary
septum formation (Sburlati and Cabib, 1986
; Silverman et
al., 1988
). After cell separation, chitin synthase I (CSI)
activity is required for cell wall repair in the birth scar (Cabib
et al., 1989
). The catalytic subunits of CSI, CSII, and
CSIII are Chs1p, Chs2p, and Chs3p, respectively. These proteins are
integral membrane proteins that are transported to the plasma membrane
via the secretory pathway.
Chs2p is synthesized late in the cell cycle, delivered apparently
directly to the septum plasma membrane, and rapidly internalized into
the vacuole where it is degraded (Choi et al., 1994
; Chuang and Schekman, 1996
). In contrast, Chs3p and Chs1p are synthesized continuously and remain metabolically stable (Choi et al.,
1994
; Chuang and Schekman, 1996
; Ziman et al., 1996
). Unlike
constitutively secreted proteins in yeast, Chs1p and Chs3p are
distributed between an intracellular membrane compartment, called the
chitosome, and the plasma membrane (Flores Martinez and Schwencke,
1988
; Leal-Morales et al., 1988
; Chuang and Schekman, 1996
;
Ziman et al., 1996
). The chitosome may serve as a cell
cycle-regulated reservoir of these enzymes, ready to be mobilized when
their function is required. Transport of Chs3p to the site of incipient
chitin ring formation may be mediated by a branch of the secretory
pathway involving vesicular traffic from the endosome to the plasma
membrane (Chuang and Schekman, 1996
; Ziman et al., 1996
).
Several genes are required for CSIII activity or localization (Bulawa,
1993
). CHS4 encodes a posttranslational activator of CSIII
(Trilla et al., 1997
). CHS5 is required for the
localization of Chs3p to polarized rings on the cell surface (Santos
and Snyder, 1997
). CHS4, CHS5, and
CHS6 are each required for CSIII activity in vivo; however,
extracts of chs6 mutant cells display CSIII activity,
whereas membranes isolated from chs4 or chs5
cells do not (Bulawa, 1992
). This discrepancy suggested that Chs6p
might be required to transport CSIII to a site on the cell surface
where its activity could be optimally expressed. We report here that chs6 mutants are specifically defective in transport of
Chs3p, but not of Chs1p, from the chitosome to the plasma membrane.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Strains and Plasmids
CHS6 was amplified by PCR of genomic DNA from strain
YPH499 (Sikorski and Hieter, 1989
) using oligonucleotide primers
homologous to the upstream (5'-cgcggatccgcgggacaaggtgccaggtaatag) and
downstream (5'-gtccgctcgagcgggcgtacctttcccaaatacac) untranslated
regions of the gene. The amplified DNA was cloned into pBluescript II SK+ (Stratagene, La Jolla, CA) using the BamHI
and XhoI sites incorporated into the ends of the upstream
and downstream primers, respectively, and in the polylinker. The
360-base pair (bp) EcoRI fragment that is internal to the
coding region of the gene was replaced with a 950-bp EcoRI
fragment containing the TRP1 gene that was isolated from
plasmid pJJ246 (Jones and Prakash, 1990
). Strain Z128 (Z106-2B × Z107-11A; see Table 1) was transformed with a linear
DNA fragment containing the chs6::TRP1 gene, and a
transformant was sporulated for tetrad analysis. Tryptophan prototrophy
segregated 2:2 and cosegregated with resistance to 100 µg/ml
Calcofluor (Sigma Chemical, St. Louis, MO), yielding strains Z130-1A
and Z130-1D. DNA-DNA blot hybridization experiments confirmed
homologous recombination only in the two Trp+ meiotic
products (our unpublished observations).
|
To create an end4-1 chs6::TRP1 double mutant strain, Z125 was sporulated and an end4-1 trp1 segregant, Z125-6C, was transformed with the linear DNA fragment containing chs6::TRP1, yielding strain Z131. Homologous recombination in this strain was confirmed by DNA-DNA blot hybridization experiments (our unpublished data). Z131 was crossed to Z106-2B yielding Z132, which was sporulated yielding strains Z132-2A, 2B, 2C, and 2D (a tetratype with respect to the end4-1 and chs6::TRP1 alleles).
Z130-1D MATa chs6::TRP1 was crossed
to YPH500, yielding strain Z134-5A. The full-length CHS6
gene on a BamHI-XhoI fragment was subcloned into
pRS316 (Sikorski and Hieter, 1989
), resulting in plasmid
pRS316(CHS6), and introduced into Z134-5A. Analysis of
transformants indicated the full-length CHS6 gene
complemented the Calcofluor-resistant phenotype of the
chs6::TRP1 mutant.
MYC-CHS6 was created by adding the myc epitope
(Kolodziej and Young, 1991
) to pRS316(CHS6) using the primer
5'-gcaaaaaaggattacatctattgcccttatggaagaacaaaagcttatttctgaagaagatttgttgagaaagggatccttttggccatcggaaaccaaaaagcaaaatgaaatacc and an oligonucleotide-directed mutagenesis protocol (Kunkel, 1985
)
yielding plasmid pRS316(MYC-CHS6). A
SpeI-EcoRI fragment containing the
myc epitope-tagged CHS6 gene was inserted into pRS306 (Sikorski and Hieter, 1989
) yielding plasmid
pRS306(MYC-CHS6). MYC-CHS6 on a BglII
fragment was isolated from pRS316(CHS6) and inserted into
the BamHI site of plasmid pRS313 (Sikorski and Hieter, 1989
)
resulting in pRS313(MYC-CHS6). This CHS6 DNA had
less 5'-untranslated sequence but retained complementing activity. To
improve the detection of Myc-Chs6p, 6 myc epitope containing DNA was
amplified by PCR from plasmid pJR1265 (Ziman et al., 1996
)
using the primers 5'-cgggatccccccctcgaggtcgacggtatcg and
5'-cgggatccccgctctagaactagtggttcccccgggctgcagga. This PCR product has
BamHI sites at its termini allowing insertion into pRS313(MYC-CHS6), yielding pRS313(7MYC-CHS6). A
HindIII fragment containing the N-terminal portion of
7MYC-CHS6 was used to replace the
HindIII fragment of pRS306(MYC-CHS6) resulting in
pRS306(7MYC-CHS6). This integration plasmid was linearized
with NruI and used to transform Z106-2C to uracil
prototrophy resulting in strain Z136, which has 7MYC-CHS6 as
the sole copy of CHS6 in the genome.
JCY478, JCY479, JCY480, and JCY481 were spores from a tetratype tetrad with respect to CHS3-3XHA and chs6::TRP1 derived from a cross between KFC1-4C and Y1307.
Cell Fractionation and Gradient Analysis
Methods for converting cells to spheroplasts, Con A-coating, and
lysis were essentially as described previously (Con A fractionation; Chuang and Schekman, 1996
; Ziman et al., 1996
). Briefly,
cell growth was terminated with 10 mM NaN3 and 10 mM KF on
ice, treated with 100 mM Tris, pH 9.4, 10 mM DTT at room temperature
for 10 min, and converted to spheroplasts using 60 U lyticase per
OD600 cell equivalents (Shen et al., 1991
) for
15-40 min at 30°C. For Con A fractionation experiments, cells were
incubated in 1 mg/ml Con A for 10 min at room temperature. Cells were
osmotically lysed using 20 mM triethanolamine, pH 7.2, 1 mM EDTA, 5 or
12.5% (wt/wt) sucrose (lysis buffer), and protease inhibitors as
described (Ziman et al., 1996
). For the experiments in
Figures 2 and 3, a low-speed (500 × g) supernatant
fraction was applied to either a linear sucrose equilibrium or a linear
Ficoll velocity gradient (Rexach et al., 1994
) in the same
buffer. Gradients (5.2 ml) were constructed in 13 × 51 mm Beckman
Ultraclear tubes (Beckman, Fullerton, CA) and centrifuged in a Beckman
SW55 rotor. Equilibrium gradients were centrifuged for 20 h at
250,000 × g, and velocity gradients were centrifuged
for 2 h at 100,000 × g. Fractions (0.2 ml, Figure 2; 0.4 ml, Figure 3) were collected from the top using an Isco gradient
fractionator (Isco, Lincoln, NE). Samples were evaluated by SDS-PAGE
and immunoblot using ECL (Amersham, Arlington Heights, IL).
Fluorograms were scanned using a Microtek ScanMaker III flatbed scanner
(Microtek Lab, Redondo Beach, CA), and pixel density was determined
using ImageQuant software (Molecular Dynamics, Sunnyvale, CA). For the
experiment in Figure 8, 100 OD600 cell equivalents were
lysed in 1 ml lysis buffer. An aliquot (750 µl) of the 10,000 × g supernatant fraction was adjusted to 40% (wt/vol)
Nycodenz using an equal volume of 80% (wt/vol) Nycodenz. This mixture
was transfered to the bottom of a Beckman Ultraclear tube, overlaid with 700 µl of 35% (wt/vol) Nycodenz, followed by 200 µl of lysis buffer. Gradients were centrifuged at 55,000 rpm in a TLS55 rotor for
3 h. Four 0.1-ml fractions were collected from the top by hand.
Cell Surface Labeling with 2,4,6-Trinitrobenezenesulfonic Acid (TNBS)
Metabolic labeling with 35S-ProMix (Amersham) cell
lysis using glass beads, and immunoprecipitation were performed
essentially as described (Chuang and Schekman, 1996
). Radiolabeled
cells (2.5 to 5 OD600 units) were treated with 0.7 M
sorbitol, 100 mM Tris, pH 9.4, 10 mM DTT, 10 mM NaN3 for 15 min at 25°C. All subsequent steps were performed on ice in
siliconized Eppendorf tubes. Cells were washed with pre-TNBS buffer
(0.7 M sorbitol, 0.3 M NaCl, 0.25 mM CaCl2, 50 mM sodium
phosphate, pH 7.5), incubated in 0.7 M sorbitol, 10 mM TNBS (Sigma, St.
Louis, MO), 0.25 mM CaCl2, 100 mM sodium bicarbonate, pH
9.2, for 30 min, washed with post-TNBS buffer (0.7 M sorbitol, 0.3 M
NaCl, 20 mM sodium phosphate, pH 7.5), before lysis with glass beads
(Chuang and Schekman, 1996
). Antisera to Chs3p (Chuang and Schekman,
1996
), Cell Wall Protein (CWP; Sanz et al., 1987
), and
Sec61p (Stirling et al., 1992
) were used in the first
immunoprecipitation. The resulting immunoprecipitates were heated at
65°C in 100 µl 2% SDS; one half was reprecipitated with the same
antibody and the other half was precipitated with rabbit anti-DNP
antiserum (Sigma). Immunoprecipitates were analyzed by SDS-PAGE
followed by quantification on a PhosphorImager (Molecular Dynamics).
Electron Microscopy (EM)
Yeast cells were fixed for EM by rapid freezing with a Bal-Tec
high pressure freezer (Kiss and Staehelin, 1995
), followed by freeze
substitution in anhydrous acetone containing 1% OsO4 and
0.1% uranyl acetate (McDonald, 1994
). Samples were dehydrated and
embedded in Epon-araldite. Thin sections were stained with 2% uranyl
acetate and lead citrate and examined in a Jeol 1200 electron
microscope (Jeol, Tokyo, Japan).
Indirect Immunofluorescence Microscopy
Cells were grown in YPD to midlog (OD600 = 0.5-1.0)
and fixed by addition of 37% (vol/vol) formaldehyde to 5% (vol/vol).
The cultures were gently shaken at 25°C for 15 min before
centrifugation, cells were resuspended in 4% paraformaldehyde
(dissolved in 0.045 N NaOH and then buffered with 100 mM
KH2PO4, final pH is 6.5) and incubated at
25°C for 2 h, or overnight at 4°C. The fixed cells were washed
twice with PBS, incubated in SK
ME (1.2 M sorbitol, 100 mM potassium
phospate, pH 7.5, 25 mM
-mercaptoethanol) for 5 min at 25°C,
centrifuged, and resuspended to 5 OD600/ml in SK
ME. Zymolyase-20T (ICN Pharmaceuticals, Costa Mesa, CA) was added at 100 µg/ml and spheroplasts were formed during an incubation at 30°C for
30 min. All subsequent centrifugations were done in a microcentrifuge
at 7000 rpm. Spheroplasts were washed once in 1.2 M sorbitol and
resuspended in 750 µl 1.2 M sorbitol. An aliquot (250 µl) of 8%
SDS in 1.2 M sorbitol was added, and the tubes were inverted several
times, immediately centrifuged, and washed three times with 1.2 M
sorbitol.
Fixed spheroplasts were attached to slides that had been pretreated with 2% polyethyleneamine. Cells were blocked in BB (PBS with 10 mg/ml BSA and 0.05% Tx-100). Mouse HA.11 anti-HA mAb (BAbCo, Berkeley, CA) was used at a 1:1500 dilution (in BB) for 45 min at 25°C. Cy3 (indocarbocyanine)-conjugated donkey anti-mouse secondary Ab (Jackson ImmunoResearch Laboratories, West Grove, PA) was used at a 1:500 dilution (in BB) for 30 min at 25°C. The slides were washed with PBS after each antibody incubation. Samples on slides were stained with 30 ng/ml DAPI (in water) for 5 min, dipped into water, mounted in Citifluor (Ted Pella, Redding, CA), and examined with a Zeiss Axioskop fluorescence microscope (Carl Zeiss, Thornwood, NY). Images were captured with a 200-E CCD camera (Sony Electronics, San Jose, CA).
| |
RESULTS |
|---|
|
|
|---|
Morphological Abnormality of chs6 Null Strains
CSIII accounts for 90% of the cell wall chitin; thus, a defect in
synthase activation or transport could have morphological consequences
(Shaw et al., 1991
). To examine the ultrastructural phenotype of a chs6 null strain, the CHS6 gene
was replaced with the chs6::TRP1 gene (see
MATERIALS AND METHODS). Meiotic segregants from a
chs6::TRP1 heterozygote were analyzed by growth
under several conditions. Trp+ prototrophy segregated 2:2
and cosegregated with slow growth at 37°C and resistance to the
chitin-binding cellular poison, Calcofluor. Cells grown in complex
liquid medium to midlog phase and viewed by light microscopy displayed
substantial abnormalities, including 25% exhibiting cell surface
bumps, 17% exhibiting bent necks, and 8% exhibiting other abnormal
morphologies (Figure 1A). These
phenotypes were not seen in the isogenic CHS strain (our unpublished data). Examination of mutant cells by electron microscopy revealed the cell surface bumps to be protrusions from the cell and not
normal buds (Figure 1B). These protrusions may represent aborted buds,
destabilized regions of the cell wall, or simply new buds on cells with
incomplete cell separation. Septa appeared thicker than normal.
Membrane transport defects, if any, were not apparent. Occasionally,
some ~50 nm vesicles were observed to accumulate near the septum
(Figure 1B, arrow).
|
Subcellular Distribution of Chs1p and Chs3p in chs6 Strains
On the basis of the observation that chs6 cells are
defective for CSIII activity in vivo, Chs6p was suggested to function in the transport of Chs3p to its site of activation (Bulawa, 1993
). To
examine the distribution of Chs3p in these cells, we fractionated total
membranes either by equilibrium bouyant density or by velocity sedimentation (see MATERIALS AND METHODS). In wild-type cells, both
Chs3p (Figure 2A) and the plasma membrane
ATPase, Pma1p (our unpublished data), were broadly distributed. In
contrast, Chs3p shifted to a bimodal distribution in membranes from the
chs6 strain, with most of the Chs3p fractionating at a lower
density characteristic of chitosomes (fraction 10, Figure 2B). The high
density peak of Chs3p (fraction 15) cofractionated with a peak of
membranes containing Pma1p (our unpublished data: see DISCUSSION).
|
A velocity sedimentation comparison of chs6 and wild-type
membranes revealed an increase in slowly sedimenting Chs3p (Figure 3B), characteristic either of chitosomes
or mature secretory vesicles. Chitosomes rather than secretory vesicles
are indicated because Chs3p accumulated in a late sec mutant
(e.g., sec1) fractionates at a higher density than Chs3p
detected in chitosomes (Chuang and Schekman, 1996
).
|
Surprisingly, equilibrium and velocity sedimentation demonstrated little effect of chs6 on the distribution of Chs1p (Figures 2A and 3A). In equilibrium density gradients from wild-type cells, Chs1p and Chs3p exhibited distinct fractionation patterns. Therefore, we suggest that Chs6p is required selectively for the transport of Chs3p from the chitosome.
Chs3p Is Redistributed from Cell Surface Rings to Internal Patches in chs6 Mutants
To corroborate our observation of an altered Chs3p distribution in
subcellular fractionation experiments, we analyzed the localization of
Chs3p in chs6 null mutant cells by indirect
immunofluorescence. For these experiments, we used an epitope-tagged
(HA) version of Chs3p in cells whose chromosomal locus was replaced
with CHS3-3XHA (Santos and Snyder, 1997
). The localization
pattern of Chs3p determined with affinity-purified anti-Chs3p
antibodies and of the epitope-tagged version determined with an anti-HA
antibody were indistinguishable (Chuang and Schekman, 1996
; Santos and
Snyder, 1997
).
CHS3-3XHA-tagged chs6 and wild-type strains were
prepared and stained in parallel with untagged control strains. In
wild-type cells, Chs3p-3XHA localized primarily to cell surface rings
at the incipient bud site in large unbudded cells and at the mother-bud neck in small budded cells and some large budded cells (Figure 4, A and B). As previously noted (Chuang
and Schekman, 1996
; Santos and Snyder, 1997
), Chs3p-3XHA did not
display ring localization in medium budded cells. Many cells also had a
few larger internal patches that were more easily observed in longer
exposures.
|
The localization of Chs3p-3XHA in the chs6 mutant was dramatically altered. Chs3p-3XHA was not found in the cell surface ring characteristic of wild-type at any cell cycle stage (Figure 4, A and C). Instead, Chs3p-3XHA was restricted to large internal patches, clearly more abundant than in wild-type cells (Figure 4). In addition, the patches in chs6 were more intensely stained; immunoblot analysis did not indicate differences in Chs3p levels (our unpublished data). Patches sometimes appeared to be peripheral to the plasma membrane (Figure 4C). For both strains, the staining observed was specific, because no labeling was detected in control strains lacking the epitope tag (our unpublished data). Thus, the loss of CHS6 results in a redistribution of Chs3p to internal patches, at the expense of localization to its normal position in cell-surface rings.
Chs6p Is Required for Transport of Newly Synthesized Chs3p to the Plasma Membrane
The altered subcellular distribution of Chs3p in
chs6 mutants prompted us to investigate the transport
dependence of newly synthesized Chs3p on Chs6p function. We adapted a
procedure (Novick and Schekman, 1983
) to tag cell surface-exposed
proteins using the membrane-impermeant reagent TNBS. Reaction of TNBS
with primary amines results in covalent addition of trinitrophenyl
(TNP) groups, which can be detected using cross-reactive antibodies
against dinitrophenyl (DNP). In a typical TNBS-tagging experiment (see MATERIALS AND METHODS), cells were radiolabeled briefly with
35S-Promix, chased for various times, treated with TNBS,
and lysed. Extracts were subjected to immunoprecipitation using
antibodies directed against a protein of interest. The resulting
immunoprecipitate was split and either reprecipitated with the same
antibody (representing a total fraction) or precipitated with anti-DNP
antibodies (representing the cell surface-exposed fraction). The amount
of the protein localized to the cell surface was measured by dividing
the anti-DNP-reactive signal by the total signal after SDS-PAGE and
quantification with a PhosphorImager.
Initially, we analyzed the specificity of the TNBS-tagging procedure
for cell surface-localized Chs3p. The ER integral membrane protein
Sec61p (Stirling et al., 1992
) and an abundant 33-kDa cell
wall protein (CWP) (Sanz et al., 1987
) were used as negative and positive controls, respectively. These experiments established that
a fraction of Chs3p (varying from 20 to 40%) and a larger fraction of
CWP (80-100%), could be precipitated with the anti-DNP antibody, but
only if the cells had been treated with TNBS (our unpublished data).
Importantly, if cells were harvested immediately after a radiolabeling
pulse of 3 min (0 min chase), the level of TNBS tagging was
significantly reduced when compared with chase points longer than 10 min (Figure 5). At the 0-min chase point, a majority of newly synthesized Chs3p and CWP is expected to be in
transit, and thus inaccessible by TNBS. In all experiments, Sec61p was
not tagged above background levels, since the amount of tagged Sec61p
in the 0 min and in later chase points remained at a constant, low
level (~5%) (see Figure 7). Other experiments demonstrated the
Sec61p could be tagged if the permeability of the cells was compromised
(our unpublished data). We concluded that our adaptation of the TNBS
procedure detected only cell surface-exposed proteins, consistent with
the results of Novick and Schekman (1983)
.
|
To determine whether loss of Chs6p affects the transport of newly synthesized Chs3p, we radiolabeled chs6 and wild-type cells at 25°C for 3 min, chased samples for various times, and subjected cells to TNBS tagging for analysis of Chs3p. Tagging of Chs3p in wild-type cells increased over time, with efficiencies of 20-30% after 90 min of chase (Figure 5, A and B). In contrast, tagging of Chs3p in chs6 was reduced (5-10%), and the lower level of tagging did not increase during the chase (Figure 5, A and B). Notably, tagging of CWP did not differ between chs6 and wild-type (Figure 5C), and a comparison of the most abundant anti-DNP precipitable proteins in TNBS-tagged chs6 versus wild-type cells showed no major differences. Additionally, the secretory pathway-dependent maturation of carboxypeptidase Y was not significantly altered in chs6 mutant cells (our unpublished data). These results suggest that Chs6p is specifically involved in the transport of newly synthesized Chs3p to the cell surface.
CHS6 Acts before END4 in the Transport of Newly Synthesized Chs3p
Accumulation of Chs3p in chitosomes of chs6 strains
provided the opportunity to analyze the route of transport of this
protein in the late secretory pathway. In previous experiments with
end4-1, a mutant defective in the internalization step of
endocytosis (Raths et al., 1993
), Chs1p and Chs3p
accumulated in the plasma membrane, suggesting that END4
function was required for Chs3p and Chs1p transport to or retention in
chitosomes. These results were consistent with the vesicle-mediated
transport of newly synthesized Chs3p either directly from the Golgi to
the plasma membrane or indirectly via the chitosome (Chuang and
Schekman, 1996
; Ziman et al., 1996
).
To distinguish between these possibilities, we used either differential
centrifugation of lysates from metabolically labeled cells (Con A
fractionation; Chuang and Schekman, 1996
; Ziman et al.,
1996
) or cell-surface labeling (see MATERIALS AND METHODS) to analyze
chs6 end4-1 double mutants and the respective single mutants. The Con A fractionation procedure generates a plasma membrane-free 10,000 × g supernatant fraction
containing chitosomes (Chuang and Schekman, 1996
; Ziman et
al., 1996
). Consistent with gradient fractionation data (Figures 2
and 3), we detected more Chs3p, but not Chs1p, in the 10,000 × g supernatant fraction from chs6 strains compared
with wild-type (our unpublished data). As before (Chuang and Schekman,
1996
; Ziman et al., 1996
), end4-1 strains were
impaired for transport of Chs1p and Chs3p to chitosomes recovered in
the 10,000 × g supernatant fraction (Figure
6). A low level of Pma1p was found in the
10,000 × g supernatant fraction of the
end4-1 strain, but not of the other two strains, indicating some plasma membrane contamination during the fractionation of this
mutant. This may account for the small amount of contaminating Chs1p in
the supernatant fractions of end4-1 that was not seen in
previous experiments (Ziman et al., 1996
). Cell lysis, as
judged by the release of radiolabeled proteins into the 10,000 × g supernatant fraction, was similar for all strains (our
unpublished data). A significant level of Chs3p, but not of Chs1p, was
recovered in the supernatant fraction of the chs6
end4-1 double mutant strain (Figure 6). These data indicate
that in regard to the recovery of Chs3p in chitosomes, the phenotype of
chs6 is epistatic to that of end4 and specific to
Chs3p, but not Chs1p.
|
The end4-1, end4-1 chs6, and chs6 strains were also analyzed by the TNBS cell surface-labeling procedure. Cells were shifted to 37°C for 10 min, radiolabeled for 2 min, and chased for 0 or 60 min. Each sample was treated with TNBS, and the amount of anti-DNP-precipitable Chs3p, CWP, and Sec61p was determined by the double-immunoprecipitation method described earlier. Tagging of CWP indicated normal transport in all strains (Figure 7), and Sec61p remained untagged, as expected (Figure 7). Chs3p tagging was consistently higher in end4-1 than in wild-type (compare Figure 7 with Figure 5), and tagging in chs6 was impaired (Figure 7), consistent with results described earlier (Figure 5). In the chs6 end4-1 double mutant, we observed that the amount of "tagged" Chs3p in the 0-min chase point was consistently higher than in the other strains. We consider this to be background labeling, because it is unlikely that Chs3p transits the entire secretory pathway during a 2-min pulse labeling, and also because the amount of anti-DNP precipitable Chs3p and CWP was almost zero in end4-1 chs6 cells that had not been treated with TNBS. Importantly, the amount of tagged Chs3p in the end4-1 chs6 double mutant did not increase during the chase, just as was observed in the chs6 single mutant. These results provide independent verification of the epistasis observed by cell fractionation of lysed spheroplasts. We conclude that the absence of Chs6p results in a pre-endocytic defect in the transport of newly synthesized Chs3p.
|
Chs6p Is Mostly Soluble in Cell Extracts and Does Not Associate with Chitosomes
To determine the subcellular localization of Chs6p, we constructed myc-tagged CHS6 alleles (see MATERIALS AND METHODS). Both 1MYC-CHS6 and 7MYC-CHS6 were found to complement the Calcofluor-resistant phenotype of chs6 strains (our unpublished data). A 7MYC-CHS6 strain was lysed with glass beads and the lysate was subjected to high-speed centrifugation. Most of the Chs6p was in the soluble fraction (our unpublished data). This strain was also processed by Con A fractionation, and once again the majority (~80-90%) of the Chs6p remained in the 10,000 × g supernatant (Figure 8). The membranes in the 10,000 × g supernatant fraction were subjected to bouyant density flotation on a Nycodenz step gradient. Whereas chitosome-associated Chs3p floated, Chs6p did not (Figure 8). These data indicate that most of the Chs6p is soluble and does not associate with membranes in cell extracts.
|
| |
DISCUSSION |
|---|
|
|
|---|
We have analyzed the effects of a null allele of chs6,
a gene required for CSIII function. chs6 strains exhibit
morphological phenotypes similar to that of chs3 strains,
and like chs3 strains, are resistant to the chitin-binding
cellular poison, Calcofluor. Additionally, both chs2 chs3
(Shaw et al., 1991
) and chs2 chs6 (Baggott and
Schekman, unpublished data) double-mutant combinations are inviable.
These data suggest that Chs6p is required for CSIII function in vivo.
However, unlike other mutants required for CSIII function,
chs6 strains have normal levels of CSIII activity in vitro
(Bulawa, 1992
). It was previously suggested that Chs6p might be
required for the transport of Chs3p (Bulawa, 1992
, 1993
).
Active CSIII in cell lysates of chs6 cells could
represent an artificial situation in which a latent form of the enzyme
in the chitosome becomes active because of an osmotic or chemical effect of the isolation medium or by an unregulated interaction with an
activator in some other membrane, such as the plasma membrane. One
attractive candidate for such an activator is Chs4p, which localizes to
the nascent chitin ring similar to Chs3p (DeMarini et al.,
1997
). In addition, chs4 mutants are defective for CSIII in
vivo and in vitro (Bulawa, 1992
), resulting from a reduced Vmax of the enzyme (Trilla et al., 1997
).
Whatever the explanation, it is clear that CSIII has catalytic
potential in the chs6 mutant but not in the chs5
mutant. Chs3p in chs5 mutants accumulates intracellularly as
an inactive enzyme, possibly in the late-Golgi, based on equilbrium
density gradient fractionation of Chs3p in wild-type and
chs5 mutant membranes and the cofractionation of Chs5p with
Golgi markers (Santos and Snyder, 1997
). Chs3p may need to interact
with a factor in the chitosome before transport to the plasma membrane.
In chs5, Chs3p may not be exposed to this factor, whereas
Chs3p accumulated in chitosomes of chs6 would. Thus, the
distinct behavior of CSIII activity in chs5 and
chs6 membrane preparations.
The altered distribution of Chs3p in chs6 mutants (Figures 2 and 3) suggests that transport of Chs3p to the plasma membrane requires Chs6p. Membrane fractionation revealed the majority of Chs3p in the low-density, slowly sedimenting chitosome membrane in lysates of chs6 mutant cells. A portion of Chs3p coincided with the denser plasma membrane fraction in chs6 (Figure 2B). However, this may represent a distinct membrane, or chitosomes trapped in plasma membrane vesicles, because cell surface tagging indicated little or no Chs3p exposed at the surface of chs6 or chs6 end4 mutant cells (Figures 5 and 7).
Chitosomes are distinct from mature secretory vesicles.
Chs3p-containing membranes from wild-type and chs6 mutant
cells fractionate at a lower bouyant density than secretory vesicles,
and they lack other markers, such as Pma1p, which are transported to
the cell surface (Chuang and Schekman, 1996
). In addition, the
chs6 mutant, unlike sec mutants that block late
in the secretory pathway, has no effect on secretion of the periplasmic
CWP (Figure 5). Furthermore, morphological inspection by thin-section
EM (Figure 1) and by immunofluorescence localization of Chs3p (Figure
4) document quite distinct behaviors of chs6 and
sec mutants (Novick et al., 1980
).
We considered the possibility that the elevated level of Chs3p in
chitosomes from the chs6 mutant resulted from enhanced
internalization from the cell surface rather than defective transport
to the cell surface. Previously, we showed that Chs3p is retained in
the plasma membrane when an endocytosis-defective mutant,
end4, is incubated at a restrictive temperature (Chuang and
Schekman, 1996
). Were enhanced internalization the explanation for the
chs6 phenotype, a double mutant, end4 chs6, would
be expected to block accumulation of Chs3p in the chitosome. However,
cell fractionation and surface-tagging experiments show that the
chs6 mutation overrides the effect of end4 and
Chs3p continues to accumulate in the chitosome at the expense of cell
surface expression (Figures 6 and 7).
The effect of chs6 is quite selective for Chs3p; Chs1p
distributes between the chitosome and plasma membrane similarly in wild-type and mutant cells. Although Chs3p and Chs1p cofractionate in
chitosomes isolated from wild-type cells (Ziman et al.,
1996
), they could be packaged independently into separate transport
vesicles that target to different locations on the septal region of the plasma membrane. Alternatively, Chs6p may be required to recruit Chs3p
into a common tranport vesicle that buds from the chitosome to deliver
both Chs1p and Chs3p to the septum. The cytosolic localization of Chs6p
(Figure 8) is consistent with a mechanism in which the protein binds to
and dissociates from a membrane transport intermediate serving, for
example, as a coat protein subunit or a coat adaptor molecule.
Our current hypothesis regarding the regulation of chitin synthesis is
that both newly synthesized and endocytically derived Chs1p and
Chs3p undergo a vesicle-mediated transport event that targets these
proteins to a spatially restricted location of the plasma membrane.
Chs3p is delivered to the incipient bud site in a Chs6p-dependent
manner; transport of Chs1p to the birth scar in new daughters may
depend on Chs6p homologs present in the yeast genome. Sorting of Chs3p
and Chs1p to a chitosome compartment may have similarities with the
sorting of the facilitative glucose transporter, GLUT4, into an
endocytically derived intracellular storage pool in muscle cells and
adipocytes (reviewed by James et al., 1994
). Whereas the
GLUT4 compartment confers insulin regulation to vesicle fusion,
chitosomes may confer temporal or spatial regulation to vesicle fusion,
at a time in the yeast-budding cycle when general secretion is not yet
polarized.
| |
ACKNOWLEDGMENTS |
|---|
We thank Edina Harsay, Anne Spang, and Daniel Baggott for comments on the manuscript, and members of the Schekman laboratory for helpful discussion. Rapid freezing with the Bal-Tec high-pressure freezer and subsequent processing were performed in the Electron Microscope Laboratory at the University of California (Berkeley, CA). J.S.C. was supported by a fellowship from the Howard Hughes Medical Institute, and M.Z. was supported by a fellowship from the National Institutes of Health. Work in the laboratory is supported by a grant from the National Institutes of Health (GM-26755) and the Howard Hughes Medical Institute.
| |
FOOTNOTES |
|---|
* These authors contributed equally to this work
Present address: Acacia Biosciences, Inc., 4136 Lakeside Drive, Richmond, CA 94806
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K. Fukuda, K. Yamada, K. Deoka, S. Yamashita, A. Ohta, and H. Horiuchi Class III Chitin Synthase ChsB of Aspergillus nidulans Localizes at the Sites of Polarized Cell Wall Synthesis and Is Required for Conidial Development Eukaryot. Cell, July 1, 2009; 8(7): 945 - 956. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Copic, T. L. Starr, and R. Schekman Ent3p and Ent5p Exhibit Cargo-specific Functions in Trafficking Proteins between the Trans-Golgi Network and the Endosomes in Yeast Mol. Biol. Cell, May 1, 2007; 18(5): 1803 - 1815. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sanchatjate and R. Schekman Chs5/6 Complex: A Multiprotein Complex That Interacts with and Conveys Chitin Synthase III from the Trans-Golgi Network to the Cell Surface Mol. Biol. Cell, October 1, 2006; 17(10): 4157 - 4166. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-W. Wang, S. Hamamoto, L. Orci, and R. Schekman Exomer: a coat complex for transport of select membrane proteins from the trans-Golgi network to the plasma membrane in yeast J. Cell Biol., September 25, 2006; 174(7): 973 - 983. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K.Y. Lam, M. Davey, B. Sun, A. F. Roth, N. G. Davis, and E. Conibear Palmitoylation by the DHHC protein Pfa4 regulates the ER exit of Chs3 J. Cell Biol., July 3, 2006; 174(1): 19 - 25. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Smits, L. R. Schenkman, S. Brul, J. R. Pringle, and F. M. Klis Role of Cell Cycle-regulated Expression in the Localized Incorporation of Cell Wall Proteins in Yeast Mol. Biol. Cell, July 1, 2006; 17(7): 3267 - 3280. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Neiman Ascospore Formation in the Yeast Saccharomyces cerevisiae Microbiol. Mol. Biol. Rev., December 1, 2005; 69(4): 565 - 584. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Iwamoto, S. R. Fairclough, S. A. Rudge, and J. Engebrecht Saccharomyces cerevisiae Sps1p Regulates Trafficking of Enzymes Required for Spore Wall Synthesis Eukaryot. Cell, March 1, 2005; 4(3): 536 - 544. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Kipnis, N. Thomas, R. Ovalle, and P. N. Lipke The ER-Golgi v-SNARE Bet1p is required for cross-linking {alpha}-agglutinin to the cell wall in yeast Microbiology, October 1, 2004; 150(10): 3219 - 3228. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Rowbottom, C. A. Munro, and N. A. R. Gow Candida albicans mutants in the BNI4 gene have reduced cell-wall chitin and alterations in morphogenesis Microbiology, October 1, 2004; 150(10): 3243 - 3252. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Sipos, J. H. Brickner, E.J. Brace, L. Chen, A. Rambourg, F. Kepes, and R. S. Fuller Soi3p/Rav1p Functions at the Early Endosome to Regulate Endocytic Trafficking to the Vacuole and Localization of Trans-Golgi Network Transmembrane Proteins Mol. Biol. Cell, July 1, 2004; 15(7): 3196 - 3209. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lafourcade, J.-M. Galan, Y. Gloor, R. Haguenauer-Tsapis, and M. Peter The GTPase-Activating Enzyme Gyp1p Is Required for Recycling of Internalized Membrane Material by Inactivation of the Rab/Ypt GTPase Ypt1p Mol. Cell. Biol., May 1, 2004; 24(9): 3815 - 3826. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Borkovich, L. A. Alex, O. Yarden, M. Freitag, G. E. Turner, N. D. Read, S. Seiler, D. Bell-Pedersen, J. Paietta, N. Plesofsky, et al. Lessons from the Genome Sequence of Neurospora crassa: Tracing the Path from Genomic Blueprint to Multicellular Organism Microbiol. Mol. Biol. Rev., March 1, 2004; 68(1): 1 - 108. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Karylowski, A. Zeigerer, A. Cohen, and T. E. McGraw GLUT4 Is Retained by an Intracellular Cycle of Vesicle Formation and Fusion with Endosomes Mol. Biol. Cell, February 1, 2004; 15(2): 870 - 882. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Nelson, A. B. Parsons, M. Evangelista, K. Schaefer, K. Kennedy, S. Ritchie, T. L. Petryshen, and C. Boone Fus1p Interacts With Components of the Hog1p Mitogen-Activated Protein Kinase and Cdc42p Morphogenesis Signaling Pathways to Control Cell Fusion During Yeast Mating Genetics, January 1, 2004; 166(1): 67 - 77. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Merzendorfer and L. Zimoch Chitin metabolism in insects: structure, function and regulation of chitin synthases and chitinases J. Exp. Biol., December 15, 2003; 206(24): 4393 - 4412. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Bulik, M. Olczak, H. A. Lucero, B. C. Osmond, P. W. Robbins, and C. A. Specht Chitin Synthesis in Saccharomyces cerevisiae in Response to Supplementation of Growth Medium with Glucosamine and Cell Wall Stress Eukaryot. Cell, October 1, 2003; 2(5): 886 - 900. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. H. Valdivia and R. Schekman The yeasts Rho1p and Pkc1p regulate the transport of chitin synthase III (Chs3p) from internal stores to the plasma membrane PNAS, September 2, 2003; 100(18): 10287 - 10292. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Santos and M. Snyder Specific Protein Targeting during Cell Differentiation: Polarized Localization of Fus1p during Mating Depends on Chs5p in Saccharomyces cerevisiae Eukaryot. Cell, August 1, 2003; 2(4): 821 - 825. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lafourcade, J.-M. Galan, and M. Peter Opposite Roles of the F-Box Protein Rcy1p and the GTPase-Activating Protein Gyp2p During Recycling of Internalized Proteins in Yeast Genetics, June 1, 2003; 164(2): 469 - 477. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Misu, K. Fujimura-Kamada, T. Ueda, A. Nakano, H. Katoh, and K. Tanaka Cdc50p, a Conserved Endosomal Membrane Protein, Controls Polarized Growth in Saccharomyces cerevisiae Mol. Biol. Cell, February 1, 2003; 14(2): 730 - 747. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Kozubowski, H. Panek, A. Rosenthal, A. Bloecher, D. J. DeMarini, and K. Tatchell A Bni4-Glc7 Phosphatase Complex That Recruits Chitin Synthase to the Site of Bud Emergence Mol. Biol. Cell, January 1, 2003; 14(1): 26 - 39. [Abstract] [Full Text] |
||||
![]() |
J. M. Rodriguez-Pena, C. Rodriguez, A. Alvarez, C. Nombela, and J. Arroyo Mechanisms for targeting of the Saccharomyces cerevisiae GPI-anchored cell wall protein Crh2p to polarised growth sites J. Cell Sci., June 15, 2002; 115(12): 2549 - 2558. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Liu, X. Tang, H. Wang, S. Oliferenko, and M. K. Balasubramanian The Localization of the Integral Membrane Protein Cps1p to the Cell Division Site is Dependent on the Actomyosin Ring and the Septation-Inducing Network in Schizosaccharomyces pombe Mol. Biol. Cell, March 1, 2002; 13(3): 989 - 1000. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Galan, A. Wiederkehr, J. H. Seol, R. Haguenauer-Tsapis, R. J. Deshaies, H. Riezman, and M. Peter Skp1p and the F-Box Protein Rcy1p Form a Non-SCF Complex Involved in Recycling of the SNARE Snc1p in Yeast Mol. Cell. Biol., May 1, 2001; 21(9): 3105 - 3117. [Abstract] [Full Text] |
||||
![]() |
G. J. Smits, H. van den Ende, and F. M. Klis Differential regulation of cell wall biogenesis during growth and development in yeast Microbiology, April 1, 2001; 147(4): 781 - 794. [Full Text] |
||||
![]() |
S. K. Roy, Y. Chiba, M. Takeuchi, and Y. Jigami Characterization of Yeast Yea4p, a Uridine Diphosphate-N-acetylglucosamine Transporter Localized in the Endoplasmic Reticulum and Required for Chitin Synthesis J. Biol. Chem., April 28, 2000; 275(18): 13580 - 13587. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ono, T. Yabe, M. Sudoh, T. Nakajima, T. Yamada-Okabe, M. Arisawa, and H. Yamada-Okabe The yeast Chs4 protein stimulates the trypsin-sensitive activity of chitin synthase 3 through an apparent protein-protein interaction Microbiology, February 1, 2000; 146(2): 385 - 391. [Abstract] [Full Text] |
||||
![]() |
B. Santos and M. Snyder Sbe2p and Sbe22p, Two Homologous Golgi Proteins Involved in Yeast Cell Wall Formation Mol. Biol. Cell, February 1, 2000; 11(2): 435 - 452. [Abstract] [Full Text] |
||||
![]() |
W.-j. Luo and A. Chang An Endosome-to-Plasma Membrane Pathway Involved in Trafficking of a Mutant Plasma Membrane ATPase in Yeast Mol. Biol. Cell, February 1, 2000; 11(2): 579 - 592. [Abstract] [Full Text] |
||||
![]() |
M. J. Lewis, B. J. Nichols, C. Prescianotto-Baschong, H. Riezman, and H. R. B. Pelham Specific Retrieval of the Exocytic SNARE Snc1p from Early Yeast Endosomes Mol. Biol. Cell, January 1, 2000; 11(1): 23 - 38. [Abstract] [Full Text] |
||||
![]() |
B. C. Osmond, C. A. Specht, and P. W. Robbins Chitin synthase III: Synthetic lethal mutants and "stress related" chitin synthesis that bypasses the CSD3/CHS6 localization pathway PNAS, September 28, 1999; 96(20): 11206 - 11210. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Trilla, A. Duran, and C. Roncero Chs7p, a New Protein Involved in the Control of Protein Export from the Endoplasmic Reticulum that Is Specifically Engaged in the Regulation of Chitin Synthesis in Saccharomyces cerevisiae J. Cell Biol., June 14, 1999; 145(6): 1153 - 1163. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. M. Holthuis, B. J. Nichols, and H. R. B. Pelham The Syntaxin Tlg1p Mediates Trafficking of Chitin Synthase III to Polarized Growth Sites in Yeast Mol. Biol. Cell, December 1, 1998; 9(12): 3383 - 3397. [Abstract] [Full Text] |
||||
![]() |
E. Cabib, D.-H. Roh, M. Schmidt, L. B. Crotti, and A. Varma The Yeast Cell Wall and Septum as Paradigms of Cell Growth and Morphogenesis J. Biol. Chem., June 1, 2001; 276(23): 19679 - 19682. [Full Text] [PDF] |
||||
![]() |
H. Tachikawa, A. Bloecher, K. Tatchell, and A. M. Neiman A Gip1p-Glc7p phosphatase complex regulates septin organization and spore wall formation J. Cell Biol., November 26, 2001; 155(5): 797 - 808. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Stefan, A. Audhya, and S. D. Emr The Yeast Synaptojanin-like Proteins Control the Cellular Distribution of Phosphatidylinositol (4,5)-Bisphosphate Mol. Biol. Cell, February 1, 2002; 13(2): 542 - 557. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||