![]() |
|
|
Vol. 9, Issue 7, 1757-1771, July 1998
-Tubulin and Nonessential
2-Tubulin Genes as
Fission Yeast Polarity Mutants
Laboratory of Cell Regulation, Imperial Cancer Research Fund, London WC2A 3PX, United Kingdom
Submitted February 10, 1998; Accepted April 21, 1998| |
ABSTRACT |
|---|
|
|
|---|
We have screened for temperature-sensitive (ts) fission yeast
mutants with altered polarity (alp1-15). Genetic
analysis indicates that alp2 is allelic to
atb2 (one of two
-tubulin genes) and alp12 to nda3 (the single
-tubulin
gene). atb2+ is nonessential, and the ts
atb2 mutations we have isolated are dominant as
expected. We sequenced two alleles of ts atb2 and one
allele of ts nda3. In the ts atb2
mutants, the mutated residues (G246D and C356Y) are found at the
longitudinal interface between
/
-heterodimers, whereas in ts
nda3 the mutated residue (Y422H) is situated in the
domain located on the outer surface of the microtubule. The ts
nda3 mutant is highly sensitive to altered gene dosage
of atb2+; overexpression of
atb2+ lowers the restrictive temperature,
and, conversely, deletion rescues ts. Phenotypic analysis shows that
contrary to undergoing mitotic arrest with high viability via the
spindle assembly checkpoint as expected, ts nda3 mutants
execute cytokinesis and septation and lose viability. Therefore, it
appears that the ts nda3 mutant becomes temperature
lethal because of irreversible progression through the cell cycle in
the absence of activating the spindle assembly checkpoint pathway.
| |
INTRODUCTION |
|---|
|
|
|---|
Microtubules are important and ubiquitous structures that play
essential roles in various cellular processes, including motility, mitosis, transport of proteins and mRNAs, and cell morphogenesis (reviewed in Mitchison and Kirschner, 1986
; Lehmann, 1995
; Hyman and
Karsenti, 1996
). They assemble from heterodimers composed of
- and
-tubulin subunits, which are both evolutionarily highly conserved.
Additional members of tubulin subfamilies including
-tubulin exist
in various species (Oakley, 1992
; Burns, 1995
). The crystallographic
structure of the
/
-heterodimer has been solved recently (Nogales
et al., 1998
); however, many fundamental aspects of
microtubule function and dynamics are still not fully understood.
Genetically amenable organisms such as yeasts and fungi have proven to
be ideal systems with which to investigate the cellular function of
microtubules (Oakley and Morris, 1981
; Neff et al., 1983
;
Hiraoka et al., 1984
; Toda et al., 1984
; Schatz
et al., 1986a
). Saccharomyces cerevisiae (budding
yeast) and Schizosaccharomyces pombe (fission yeast),
although very divergent in evolution, have analogous genomic
organization of tubulin-encoding genes (i.e., two
-tubulin genes and
one
-tubulin gene) and show similar genetic properties in those
genes (Neff et al., 1983
; Hiraoka et al., 1984
;
Toda et al., 1984
; Adachi et al., 1986
; Schatz
et al., 1986a
,b
). In both yeasts, a single
-tubulin-encoding gene is essential for cell viability
(nda3+ in fission yeast and TUB2 in
budding yeast) (Neff et al., 1983
; Hiraoka et
al., 1984
). In contrast, two homologous
-tubulin-encoding genes (nda2+ and atb2+ in
fission yeast, and TUB1 and TUB3 in budding
yeast) show different genetic behavior. One of the two homologues is
essential for cell viability (nda2+ and
TUB1), whereas the other (atb2+ and
TUB3) is not; however, the nonessential
-tubulin can
compensate for loss of the essential
-tubulin gene when
overexpressed, indicating that these two pairs of
-tubulin molecules
are functionally interchangeable (Adachi et al., 1986
;
Schatz et al., 1986b
).
Determining the molecular basis for the temporal and spatial definition
of cell polarity is a fundamental problem in cell biology. The shape of
every eukaryotic cell is believed to be maintained by the cytoskeleton,
which consists of three filamentous systems: actin-based
microfilaments, tubulin-based microtubules, and intermediate filaments.
The cytoskeleton does not act as a static structural scaffold of the
cell. Instead, in virtually every system characterized to date, the
cytoskeleton is highly dynamic, frequently changing its structure
during cell cycle progression and developmental differentiation. This
dynamic behavior is intimately related to growth control (Drubin and
Nelson, 1996
; Gönczy and Hyman, 1996
).
Fission yeast cells are rod shaped and have defined growth polarity
during both the vegetative cycle and developmental states (Mitchison
and Nurse, 1985
; Snell and Nurse, 1993
). Previous work from our
laboratory and other laboratories has clearly shown the importance of
microtubule integrity in determining growth polarity. Mutations in the
tubulin genes (Toda et al., 1983
; Umesono et al.,
1983b
) or their regulators (Mata and Nurse, 1997
; Hirata et
al., 1998
) result in altered cell shapes such as bent or branched cells. The cortical actin-dependent pathway is also important for the
maintenance of growth polarity as well as cytokinesis (Gould and
Simanis, 1997
). As in other organisms, the localization of these
cytoskeletal molecules changes dramatically during cell cycle
progression (Marks and Hyams, 1985
; Marks et al., 1986
; Tanaka and Kanbe, 1986
; Hagan and Hyams, 1988
), and these molecules play key roles in specific cell cycle events, as demonstrated by the
fact that genes encoding cytoskeletal components and regulators were
first identified as cell division cycle (cdc) mutants (Nurse et al., 1976
; Gould and Simanis, 1997
).
To understand in more detail the molecular pathways that regulate cell
polarity, we have undertaken a large-scale screen of temperature-sensitive (ts) mutants to identify those with altered growth polarity (alp) (Hirata et al., 1998
). We
have isolated a class of alp mutants that become bent or
branched and lose microtubules after incubation at the restrictive
temperature. Genetic as well as molecular analyses indicate that two of
these alp loci are allelic to atb2 and
nda3, encoding
2-tubulin and
-tubulin, respectively. The identification of mutations in the atb2 gene as ts
polarity mutants is intriguing because previous studies have shown that cells in which atb2+ is deleted are viable, with
few defects (Adachi et al., 1986
), which suggests that the
alp2 mutants we have isolated here must be dominant in
nature. The identification of nda3 as a ts mutant is also
interesting because despite extensive and systematic mutational analysis of the
-tubulin gene in the past, very few ts mutants have
been isolated (Yamamoto, 1980
; Oakley and Morris, 1981
; Umesono et al., 1983a
,b
; Thomas et al., 1985
; Huffaker
et al., 1988
; Matsuzaki et al., 1988
; Stearns and
Botstein, 1988
; Reijo et al., 1994
; Sage et al.,
1995
). We have determined, therefore, the mutation sites of the tubulin
genes in these ts mutants. There is a single point mutation in each
mutant, affecting codons that correspond to amino acids that are highly
conserved through evolution. Furthermore, in contrast to previously
isolated tubulin mutants, detailed phenotypic analyses suggest that the
spindle assembly checkpoint control might not be operational in these
ts tubulin mutants.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Strains, Media, and Chemicals
All mutant strains were derived from HM123
(h
leu1) (Table
1). JY6
(h+leu1his2), and TP108-3D
(h+leu1 ura4his2) were used for
backcrossing mutants. Complete medium, YPD (1% yeast extract, 2%
polypeptone, and 2% dextrose), which contains 10 µg/ml Phloxine B
(Sigma, St. Louis, MO) (called YPDP), YES (0.5% yeast extract, 3%
dextrose, and 75 µg/ml adenine, histidine, leucine, and uracil),
modified synthetic EMM2, and MES (3% malt extract, and 75 µg/ml
adenine, histidine, leucine, and uracil) have been described previously
(Moreno et al., 1991
). Plates contained 1.6% agar.
|
Genetic Techniques and Nomenclatures
Standard procedures for S. pombe genetics were
followed as described (Moreno et al., 1991
). Cell number was
measured using Sysmex F-800 (TOA Medical Electronics, Tokyo, Japan).
S. pombe cells were transformed using the lithium method
(Ito et al., 1983
). A temperature-sensitive phenotype is
abbreviated to the lowercase letters ts, e.g., ts atb2.
Proteins are designated by an uppercase first letter, e.g., Atb2. Gene
disruptions are abbreviated as the gene preceded by
such
as
atb2.
Isolation of ts Mutants with Polarity Defects
Wild-type HM123 cells were mutagenized with
N-methyl-N'-nitro-N-nitrosoguanidine
as described previously (Uemura and Yanagida, 1984
). Approximately 300 viable cells were spread per one YPDP plate. Plates were incubated at
29°C for 4 d, and colonies were then replica plated on YPDP and
incubated at 36°C for 1 d. Strains that did not form colonies or
that formed sick dark-red colonies were picked, and the morphology of
these cells was examined by Calcofluor staining (Streiblová and
Wolf, 1972
). Approximately 1 of 50 colonies showed either no growth or
retarded growth at the restrictive temperature. In total, 200,960 colonies were screened in this way, and 2822 ts mutants were isolated.
Mutants that showed altered cell shape (bent or branched) at 36°C
were selected for further analysis. These mutants were grown in liquid
YPD and shifted to 36°C for 8 h, and the cell morphology was
examined once again by Calcofluor staining. In total, 22 ts mutants
that showed bent, curved, or branched morphologies were isolated and
designated alp (Table
2).
|
Complementation Analysis
h+ mutant strains were isolated after
mating of the mutant strains to JY6
(h+leu1his2). Crisscross mating was
performed, and free spores were plated on two YPDP plates, one of which
was incubated at 29°C, the other at 36°C. If the difference in the
number of colonies formed between these two plates was
>104-fold, the two mutants were assigned as allelic.
Strain 1146 (alp8) (Table 2) contained two mutations: one is
responsible for the morphological defects, which is allelic to
tea1 (Mata and Nurse, 1997
), and the other is responsible
for the ts growth phenotype.
Dominance-Recessive Test
A stable prototrophic diploid heterozygous for the atb2 locus was constructed between the ts mei1-B102atb2-996 strain (TPR19A) (Table 1) and a mater strain (TP71-7C), and temperature sensitivity was examined.
DNA Preparation and Manipulation
Standard molecular biology techniques were followed as described
(Sambrook et al., 1989
). Enzymes were used as recommended by
the suppliers (New England Biolabs, Beverly, MA, and Boehringer Mannheim, Indianapolis, IN). Nucleotide sequencing was performed by the
dideoxy method (Sanger et al., 1977
).
Identification of the alp2 and alp12 Loci as atb2 and nda3, Respectively
S. pombe genomic libraries constructed in the vectors
pDB248 (Beach and Nurse, 1981
; Hirano et al., 1988
) and
pUR19 (Barbet et al., 1992
) were used for the isolation of
plasmids that complemented the ts alp2 or alp12
mutant (DH1-7C: h
leu1alp2
[atb2]-996; DH1-2D:
h
leu1 ura4alp2
[atb2]-996; DH1-2B:
h+leu1ura4his2alp2
[atb2]-996; and PR7:
h
leu1ura4alp12
[nda3]-1828) (Table 1). For the atb2
mutant, 4 of 36,000 colonies transformed with the pDB248-based library
were capable of growing at 36°C, whereas for alp12, 5 of
20,000 colonies transformed with the pUR19-based library grew at
36°C. Segregation analysis indicated that the Ts+
phenotype was plasmid dependent. Plasmid DNAs were recovered from these
transformants. Four different plasmids (pALA200, pALB200, pALC200, and
pALD200) and three different plasmids (pCR8 [isolated three times],
pCR9, and pCR10) were recovered from the alp2 and alp12 transformants, respectively. Restriction mapping
indicated that three (pALA200, pALC200, and pALD200) contained
overlapping inserts and carried the atb2+ gene,
whereas pALB200 contained the nda2+ gene. pCR8,
9, and 10 all contained overlapping inserts and carried the
nda3+ gene.
Identification of the alp2 loci as atb2 has been
described previously (Yaffe et al., 1996
). Furthermore,
tetrad analysis between ts atb2-996 and an atb2
disruptant (
atb2) (Table 1) showed a tight linkage; 23 tetrads were
dissected, and all showed parental ditypes. Allelism between
alp12 and nda3 was determined as follows. pCR10
was transformed into the ts alp12
(nda3)-1828 mutant. At 36°C, a number of
Ts+Ura+ colonies appeared that stained less
intensely on YPDP (at an approximate frequency of 10
2).
Segregation analysis indicated that the Ura+ phenotype was
stable, showing that pCR10 had integrated stably in the genome via
homologous recombination. Free spore analysis between these integrants
and a mater strain (TP108-3D) (Table 1) showed that no ts segregant
appeared from 103 colonies, indicating that
alp12 is allelic to nda3.
Cloning of the ts atb2 and nda3 Genes and Determination of the Mutation Sites
To determine the mutation sites in the ts atb2
mutants, 0.6-kb (corresponding to the first 166 residues of Atb2) and
1.3-kb (residues 167-449) HindIII fragments that comprise
the entire atb2+ gene (Toda et al.,
1984
) were cloned into an integration vector and used to transform ts
atb2-996 and -1212 strains (Yaffe et al., 1996
). Both of the ts mutants were suppressed by the plasmid containing the 1.3-kb fragment but not by that containing the 0.6-kb
fragment, indicating that the mutation sites of atb2-996 and
-1212 are located in the 1.3-kb HindIII fragment.
A DNA fragment corresponding to amino acids 167-449 was amplified from
ts atb2-996 and -1212 strains by PCR using the
following oligonucleotides as primers: Alp2-N1,
AAAAAAGCTTCAATTTTCTATGTATCC; and Alp2-C1, AAAAGGATCCTTAGTACTCTTCTTCCA (underlined are
HindIII and BamHI sites, respectively). The
858-bp amplified fragment was subcloned into pUC19 (Vieira and Messing,
1982
). In each case, two independent PCRs were performed, amplified
fragments were cloned separately, and the nucleotide sequences were
determined. The same sequence was obtained from the independent clones
and contained a single point mutation (see RESULTS), indicating that
the base changes were not due to errors during PCR.
To determine the mutation site of the ts nda3 mutant, the
entire ORF was cloned into pUC19 from the ts nda3-1828
mutant by PCR using the following two oligonucleotides: Nda3-N3P,
TATGCTGCAGCTAACGAAACTCACCTAC; and Nda3-C1B,
TATGGATCCAACGTAGATAAACACT (underlined are PstI
and BamHI sites, respectively). Sequencing of the two clones
derived from independent PCRs showed nine putative deviations (leading to amino acid substitutions at six places) in the ts
nda3-1828 strain from the published nucleotide sequence of
the wild-type nda3+ gene (Hiraoka et
al., 1984
). To determine which site is mutated in ts
nda3-1828, the wild-type nda3+ gene
was cloned in a similar manner, and its nucleotide sequence was
determined. Comparison of the nucleotide sequences of ts
nda3-1828 and wild-type nda3+
revealed that the published data contain sequencing errors in eight
positions. In ts nda3-1828, nucleotide 1566 (A of initiator methionine is denoted as +1) is mutated from T to C, which results in
substitution of Tyr by His at residue 422 (see RESULTS). These sequence
data are available from EMBL/GenBank/DDBJ under accession numbers
AF042827 (nda3+) and AF042828
(nda3-1828).
Immunochemical Assays
For indirect immunofluorescence microscopy, the methanol
fixation method was used (Alfa et al., 1993
). TAT-1 antibody
(provided by Dr. Keith Gull, University of Manchester, Manchester,
United Kingdom) and Cy3-conjugated sheep anti-mouse immunoglobulin G (Sigma) were used to visualize microtubules, and DAPI was used for
chromosomal DNA.
Cell extracts were prepared as described (Matsusaka et al.,
1995
), except that HB buffer (Moreno et al., 1991
) was used
in the disruption of cells. Standard procedures for
immunoblotting were followed (Harlow and Lane, 1988
).
Monoclonal anti-
-tubulin antibody (Sigma), anti-
-tubulin (TAT-1,
gift from Dr. Keith Gull), and anti-Cdc2 (Y100, gift from Dr. Hiroyuki
Yamano, ICRF) were used as primary antibodies. Horseradish
peroxidase-conjugated goat anti-mouse immunoglobulin G (Bio-Rad,
Richmond, CA) and a chemiluminescence system (ECL, Amersham, Arlington
Heights, IL) were used to detect bound antibody.
| |
RESULTS |
|---|
|
|
|---|
Isolation of Mutants That Are Defective in Growth Polarity
We performed a large-scale visual screen for mutants with defects
in growth polarity. We first isolated ts mutants and then examined the
cell morphology of these mutants after incubation at the restrictive
temperature using Calcofluor, which stains septa and growing ends of
the cell (Streiblová and Wolf, 1972
; Mitchison and Nurse, 1985
).
Mutants with bent, curved, or branched morphology were selected. In
total, 22 different mutants were obtained, and complementation tests
indicated that these represent 15 loci, designated alp1-15
(Table 2). Some examples of the cell morphology and DAPI staining of
alp2 and 12 mutants are shown in Figure
1.
|
Classification of Polarity Mutants with Microtubule Staining
It has become clear that microtubules are important for the
determination of cell shape and for growth polarity of fission yeast
(Toda et al., 1983
; Yaffe et al., 1996
; Mata and
Nurse, 1997
; Hirata et al., 1998
). We therefore used
indirect immunofluorescence microscopy by using anti-tubulin antibody
(TAT-1, kindly provided by Dr. Keith Gull) to examine the microtubule
cytoskeleton of the alp mutants. It was clear from these
analyses that at least four (alp1, 2,
11, and 12) of the genes identified in our screen were required for the maintenance of microtubule structures, because the microtubules in these mutants became fragile and disappeared when
the temperature shifted. In this study, we have characterized alp2 and alp12 at the molecular level. Three
alleles of alp2 (-996, -1212,
-1377) (Table 2) and one allele of alp12
(-1828) were identified. Microtubule staining of
alp2 and alp12 mutants is shown in Figure
2. Cytoplasmic microtubules became
unstable and disappeared after 6 h incubation at 35.5°C,
although some short nuclear spindle microtubules still remained (Figure
2, B and C, bottom panels).
|
In addition to the loss of microtubule structures, alp2 and alp12 mutants showed various defective phenotypes in cell cycle and cell shape control. These include displacement of the nucleus (24% for alp2-996 and 17% for alp12-1828 after 8 h at 35.5°C) (Figure 1) and accumulation of septated cells. Also, asymmetrical rather than medial septation was often observed in many cells (~50% of septated cells), resulting in anucleate cells following cytokinesis (8% for alp2-996 and 2% for alp12-1828).
Identification of the alp2 and alp12 Mutations as Novel Alleles in Mutant Tubulin Genes
We cloned the alp2+ and
alp12+ genes by complementation using a fission
yeast genomic library constructed with a multicopy vector. Four
plasmids were isolated that suppressed ts alp2-996, and
three suppressed alp12-1828. Restriction mapping of these
plasmids indicated that the four plasmids suppressing the
alp2 mutation consist of two previously identified genes,
nda2+ and atb2+, which
encode the two
-tubulins (
1- and
2-tubulin, respectively) (Toda et al., 1984
; Adachi et al., 1986
), and all
three alp12-complementing plasmids contained the
nda3+ gene, which encodes
-tubulin (Hiraoka
et al., 1984
). Genetic analysis indicated that
alp2 was allelic to atb2, and alp12
was allelic to nda3 (see MATERIALS AND METHODS). Therefore,
we shall hereafter use atb2 for alp2 and
nda3 for alp12 preceded by ts, such as ts
atb2.
Mutations in tubulin genes, or genes involved in microtubular pathways,
often result in supersensitivity to antimicrotubule drugs such as
members of the benzimidazole family of compounds (Umesono et
al., 1983b
; Adachi et al., 1986
; Hirata et
al., 1998
). Consistent with this, ts atb2 and
nda3 strains were supersensitive to the benzimidazole
compound thiabendazole. They could not form colonies on rich media
plates containing 10 µg/ml at 20°C, whereas wild-type cells could
(Table 3).
|
Genetic Interaction of ts atb2 and nda3 Mutations with Other Tubulin Genes
It was curious that the nonessential atb2 gene was
identified in this study as a ts mutation. The mutant Atb2 proteins
(
2-tubulin) must have a dominantly harmful effect on the maintenance
of microtubules because deletion of atb2+ does
not show a lethal or ts phenotype (Adachi et al., 1986
). In
line with this notion, genetic analysis demonstrated that the ts
atb2 mutant is dominant because a heterozygous diploid
between atb2-996 and atb2+ showed the
ts phenotype, although some weak growth was observed compared with a
haploid ts alp2-996 strain (Figure
3A). If the mutant Atb2 protein were to
inhibit the function of
-tubulin by abortive binding, effectively
taking the
-tubulin out of the pool of available subunits, it might
be expected that an increased dosage of
-tubulin gene would suppress
ts atb2 mutations; however, a multicopy plasmid containing
nda3+ was incapable of suppressing ts
atb2 (Figure 3B, top right plate). This result suggests that
the phenotypic dominance of ts atb2 (
2-tubulin) over
nda2+ (
1-tubulin) is not ascribable to a loss
of
-tubulin function.
|
Crossing ts atb2-996 and cs nda2-KM52 (Umesono
et al., 1983b
) indicates that the double mutants are
synthetically lethal. Among 12 tetrads dissected, no double mutants (14 spores predicted) were obtained, whereas 14 wild-type and 10 of each
single mutant strain formed colonies at 29°C, a temperature
permissive for both mutants. Thus for both ts atb2 and cs
nda2 mutants, functional wild-type proteins of the other
-tubulin homologue are required for viability at the permissive
temperature.
In the case of ts nda3, a different effect from
increased dosage of
-tubulin-encoding genes was observed.
Overexpression of atb2+ led to enhanced
temperature sensitivity in the ts nda3 mutant (Figure 3B,
bottom left plate). Incubation of ts nda3 on minimal plates
at 34.5°C allowed colony formation in the ts nda3 mutant containing an empty vector, whereas mutant cells containing a multicopy
plasmid carrying atb2+ were incapable of forming
colonies at this temperature. This suggested that the ts
nda3 mutant is highly sensitive to altered gene dosage of
atb2+. To examine the effect of
atb2+ gene dosage in more detail, the
atb2+ gene was disrupted in the ts
nda3 strain. In reverse parallel with the toxic effect of
overexpression, the deletion of atb2+ partially
rescued the temperature sensitivity of nda3-1828 (Figure 3C). This result indicates that the defective phenotypes observed in
the ts nda3 mutant can be ascribed, at least in part, to the existence of the Atb2 protein. It is noteworthy that the toxic effect is
2-tubulin specific, because ts nda3 cells
carrying the nda2+ gene encoding
1-tubulin on
an equivalent plasmid were capable of forming colonies, although of a
slightly smaller size compared with those containing vector alone
(Figure 3B, bottom left plate). Multicopy plasmids containing
-tubulin (Horio et al., 1991
) do not suppress either ts
atb2 or nda3, nor do they enhance the lethality conferred by these mutations (Hirata and Toda, unpublished
observations), suggesting that the interactions we report are specific.
Determination of Mutation Sites in the ts atb2 and nda3 Mutants
We determined the mutation sites of the ts atb2 and
nda3 mutants (atb2-996 and -1212 and
nda3-1828; see MATERIALS AND METHODS). In each case, a
single point mutation was found, which resulted in alteration of an
amino acid residue in Atb2 and Nda3. In ts atb2-996,
nucleotide 1065, guanine (A of the initiator methionine is denoted as
+1), was mutated to adenine, which resulted in the substitution of
cysteine 356 (TGT) with tyrosine (TAT; mutated nucleotides are underlined). In the case of ts atb2-1212,
nucleotide 737, guanine, was mutated to adenine, which resulted in the
substitution of glycine 246 (GGC) with aspartate
(GAC). A comparison of amino acid sequences around the
mutated residues is shown in Figure 4A.
Both of the mutated residues have been highly conserved throughout evolution. In particular, glycine 246 is of interest because this residue is invariant not only in fission yeast
1-tubulin (Nda2) and
-tubulins from other species, but also in
- and
-tubulins in
virtually every species (Figure 4A).
|
The mutation site of ts nda3-1828 is located near the C
terminus of the Nda3 protein. Nucleotide 1566 was mutated from thymine to cytosine, which results in the substitution of tyrosine 422 (TAT) with histidine (CAT) (Figure 4B). Like
glycine 246, this tyrosine is also conserved in all members of
tubulins. It is noteworthy that the region around tyrosine 422 is rich
in acidic amino acid residues, which are believed to be important for
interactions with other proteins. Extensive mutational analysis of the
budding yeast
-tubulin gene TUB2 has shown the C terminus
of
-tubulin to be essential for the normal function of microtubules
(Reijo et al., 1994
).
ts atb2 Alters the Cellular Ratio of
1- to
2-Tubulin
Why do the atb2 mutations that we isolated show a
dominant ts growth defect? As shown above, it is not due to the
absorption of
-tubulin. One possible explanation might be an altered
cellular ratio of
1- and
2-tubulins. To examine this possibility,
immunoblotting using anti-
-tubulin antibody was
performed with protein extracts from a ts atb2 mutant. As
described previously (Adachi et al., 1986
), the two closely
migrating bands of 55 and 57 kDa in wild-type extracts correspond to
Atb2 and Nda2, respectively (Figure 5A, lane 1) (note that p57nda2 is more abundant than
p55atb2). In an atb2-deleted strain, the
p55atb2 band is missing (
atb2; Figure 5A, lane 2). In
atb2-1212 cells grown at the permissive temperature (Figure
5A, lane 3), the ratio of Atb2 to Nda2 is similar to that seen in
wild-type extracts, because the level of p57nda2 is much higher
than that of p55atb2. After shifting to the restrictive
temperature of 35.5°C, the relative level of p55atb2
increased (Figure 5A, lanes 4-6). Although the increase was modest, it
was reproducible. Thus it is possible that the dominance of atb2-1212 is ascribable to the higher relative abundance of
mutant Atb2 protein over Nda2. Suppression by high dosage of the
nda2+ gene supports this notion, although how ts
Atb2 protein interferes with microtubule function still remains to be
determined (see DISCUSSION).
|
It should be noted that despite the altered ratio of
1- to
2-tubulin, the total amount of
-tubulin proteins remained almost constant, suggesting that regulatory mechanisms maintain a steady-state level of
-tubulin protein, as has been reported in other organisms (May et al., 1990
; Gonzalez-Garay and Cabral, 1996
). This
supports previous data that were suggestive of this form of regulation (Adachi et al., 1986
). In contrast to the increase of Atb2
protein in the ts atb2 mutant, the level of
-tubulin
remained unchanged in the ts nda3 mutant (Figure 5B). Thus
mutation in the C-terminal amino acid (Y422H, Figure 4B) did not affect
the stability of the
-tubulin molecule.
The Spindle Assembly Checkpoint Is Not Operational in ts Tubulin Mutants
The temporal order within the cell cycle is maintained by
surveillance mechanisms called checkpoints (Hartwell and Weinert, 1989
). The spindle assembly checkpoint prevents cells from proceeding into mitosis when the bipolar spindle function is compromised (Murray,
1995
; Wells, 1996
). In fission yeast, it has been shown that a cs
nda3 mutation (nda3-KM311) activates the spindle
assembly checkpoint at the restrictive temperature so that cells arrest in midmitosis with condensed chromosomes and maintain high viability (Hiraoka et al., 1984
; Moreno et al., 1989
). Upon
release from the mitotic block, nda3-KM311 cells reinitiate
anaphase in a highly synchronized manner (Hiraoka et al.,
1984
). We therefore were interested in determining whether the spindle
assembly checkpoint is also intact in the newly isolated ts
nda3 mutant.
Contrary to our initial expectations, the spindle assembly checkpoint
appeared not to be operational in the ts nda3 mutant cells.
As shown in Figure 6, A and B, the
septation index increased 3 h after temperature shift-up and was
accompanied by a sharp drop in viability. More than 60% of the
septated cells had mislocalized septa (Figure 6B). Also, nuclear
displacement was evident, and in some cells partial chromosome
segregation occurred (Figure 1B). Polarity defects such as bent or
branched cell morphology were apparent at 2 h. Consistent with
continued cell cycle progression in these mutants, interphase-like
hemispherical chromosomes, rather than condensed chromosomes, were seen
after 6 h at 35.5°C (Figure 1B). This contrasts with the cs
allele of nda3 (-KM311), which results in
accumulation of increasing numbers of cells with condensed chromosomes
with prolonged incubation at the restrictive temperature (Umesono
et al., 1983a
; Hiraoka et al., 1984
).
|
To examine the reversibility of the ts nda3 mutant incubated at the restrictive temperature, the mutant cells were incubated for various periods (2, 4, and 6 h) at 35.5°C before being returned to 26°C, and the percentage of mitotic or septated cells was measured. No synchronous anaphase or septation was observed (Figure 6C). These results show that contrary to the cell cycle arrest phenotype of cs nda3 mutants, in the ts nda3 mutant the spindle assembly checkpoint is not functional, and mutant cells proceed into mitosis and subsequent events such as septation and cytokinesis at the restrictive temperature. A similar result was obtained with a ts atb2 mutant, namely mitosis, and septation occurred at the restrictive temperature, although viability remained high (Figure 1A) (Radcliffe and Toda, unpublished observations).
If the ts nda3 mutant becomes lethal because of cell cycle
progression in the absence of activation of the spindle checkpoint, it
would be expected that the lethality of the mutant would be rescued by
blockage of the cell cycle before entry into mitosis. That is indeed
the case. The ts nda3 mutant arrested in early S phase by
hydroxyurea (HU) treatment did not lose viability for up to 4 h
incubation at the restrictive temperature, whereas the control culture
in the absence of the drug lost viability sharply (Figure 6D). Further
incubation at the restrictive temperature in the presence of HU (>4 h)
led to a loss of viability of the ts nda3 mutant, probably
because of progression of the cell cycle by prolonged exposure to HU
(21% after 6 h) (Sazer and Nurse, 1994
). We therefore conclude
that the loss of viability in the ts nda3 mutant is
ascribable to irreversible progression of the cell cycle without normal
function of spindles, in which the spindle assembly checkpoint is not
activated.
| |
DISCUSSION |
|---|
|
|
|---|
Cell Polarity and Microtubules
Microtubules have been shown to be indispensable in the execution
of diverse cellular processes in many systems, including motility,
mitosis, protein and mRNA transport, and cell morphogenesis. In fission
yeast, microtubules also execute several distinct functions, including
chromosome segregation (Umesono et al., 1983a
,b
),
distribution of organelles, in particular mitochondria and Golgi
(Ayscough et al., 1993
; Yaffe et al., 1996
), and
cell polarity and morphogenesis (Toda et al., 1983
; Mata and
Nurse, 1997
; Hirata et al., 1998
). Fission yeast tubulin
mutants were originally isolated on the basis of cell cycle defective
phenotypes in mitosis (nuclear division arrest [nda])
(Toda et al., 1983
). In this study we have screened for ts
mutants with altered polarity of cell growth (alp mutant) and have identified new mutant alleles in tubulin genes. This clearly
demonstrates that, as in other eukaryotes, microtubules are crucial
elements in the determination of cell polarity in fission yeast. How do
microtubules regulate cell polarity? A recent study has identified a
"marker" molecule that translocates into the cell tips via
microtubules and determines the orientation of cell tip growth (Mata
and Nurse, 1997
). There may be several molecules that mark the growing
tips in a microtubule-dependent manner, and other
alp+ genes may encode such molecules.
Work from budding yeast, on the other hand, suggests that in this
organism the main role of microtubules is in mitosis and meiosis,
namely nuclear migration and chromosome segregation (Huffaker et
al., 1988
; Jacobs et al., 1988
). This suggests that
despite the similarity in genomic organization and genetic properties of tubulin genes in these two yeasts (Neff et al., 1983
;
Hiraoka et al., 1984
; Toda et al., 1984
; Adachi
et al., 1986
; Schatz et al., 1986a
,b
), their
biological roles have diverged considerably during evolution. This may
be reflected in the different distribution of cytoplasmic microtubules.
Fission yeast has long cytoplasmic arrays that run along the cell axis,
whereas budding yeast lacks this kind of network structure; instead,
cytoplasmic microtubules emanate from the spindle pole body and form
bundles (Adams and Pringle, 1984
; Kilmartin and Adams, 1984
; Hagan and
Hyams, 1988
).
Why Do the atb2 Mutants That Are Isolated Become Temperature Sensitive?
How does ts
2-tubulin (Atb2) protein act in a dominant manner
over
1-tubulin (Nda2) at the restrictive temperature? There are
several possibilities. The first is that ts Atb2 protein forms an
abortive complex with some other protein(s), which usually execute a
function that is essential for microtubule biogenesis and cell
viability (Figure 7A). This scenario is
not unique: a similar mutant has been reported and analyzed previously.
Fission yeast contains two genes encoding type I protein phosphatases, dis2+ and sds21+ (Ohkura
et al., 1989
). Unlike nda2+ and
atb2+, neither dis2+ nor
sds21+ is essential by itself, but simultaneous
disruption leads to lethality. The dis2-11 mutation,
however, shows a dominant cs phenotype. In this case, the reason that
dis2-11 shows cs appears to be due to the absorption, by cs
Dis2, of a protein called Sds22, which is a regulatory subunit of both
type I protein phosphatases and is essential for cell viability (Ohkura
and Yanagida, 1991
; Stone et al., 1993
). Multicopy
plasmids containing dis2+,
sds21+, or sds22+ genes
are capable of suppressing cs dis2-11. These interactions are strikingly similar to the interactions between the tubulin genes
that we present here. The observation that in the ts atb2 mutant the relative ratio of Nda2 and ts Atb2 protein alters in a way
that ts atb2 cells appear to contain more ts Atb2 protein is
intriguing. It has been reported that free
-tubulin molecules become
highly unstable (Tian et al., 1997
). It is possible that in
the ts atb2 mutant interaction between Nda2 and other
essential proteins is compromised, which may lead to an apparent
reduction of the relative ratio of Nda2 and ts Atb2 protein. The rescue of ts atb2 by high-dosage nda2+ gene
supports this assumption.
|
-Tubulin is a strong candidate for a protein that is absorbed by the
ts Atb2 protein. The data, however, show that this is probably not the
case, because an increased dosage of the
-tubulin gene did not
suppress the ts atb2 mutant. Other candidates for interacting proteins are the cofactors that are required for the correct folding of tubulin molecules (Tian et al., 1996
).
Cofactors B, D, and E are proposed to interact with
-tubulin to
produce assembly-competent
/
-tubulin heterodimers (Tian et
al., 1997
). All of these molecules are essential for cell
viability in fission yeast (cofactor D/Alp1 [Hirata et al.,
1998
; Radcliffe and Toda, unpublished observations]). Preliminary
analysis from our laboratory, however, makes this possibility also
unlikely because none of the fission yeast homologues of these
cofactors suppress the ts atb2 mutant when introduced on
multicopy plasmids (Radcliffe and Toda, unpublished observations).
There may, of course, be other
-tubulin binding proteins, such as
microtubule-associated proteins (MAPs), that await identification.
The Implications of the Mutation Sites in ts Atb2 Protein
The second possibility is that ts Atb2 protein dominantly
interferes with the assembly of newly synthesized
/
-tubulin
heterodimers (Figure 7A). The electron crystallographic structure of
the
/
heterodimer was recently solved (Nogales et al.,
1998
). The tubulin molecule is divided into three functional domains,
namely the N-terminal domain (1-205), which is responsible for GTP
binding, the intermediate domain (206-381), which is required for
heterodimer and/or intradimer formation, and the remaining C-terminal
domain, which is thought to be important for interactions with various MAPs and motors. Assignment of the mutation sites of ts atb2
(-996 and -1212), which reside in the central
domain, to the three-dimensional structure of
/
-heterodimers has
proved illuminating. Cysteine 356 (mutated to tyrosine in
atb2-996) is located at the longitudinal interface between
the
- and
-tubulin monomers (Nogales et al., 1998
). It
is also the residue whose analogous position in
-tubulin is the
binding site for the tubulin-depolymerizing drug colchicine (Bai
et al., 1996
). Interestingly, glycine 246 (mutated to
aspartate in atb2-1212) is spatially adjacent to the
-sheet in which cysteine 356 is included, and furthermore, both of
these amino acid residues are in close contact with the GTP/GDP
exchangeable site of
-tubulin (Nogales et al., 1998
). It
is also noteworthy that the region adjacent to glycine 246 (242LRFEG246) shows homology to regions that possess ribose-binding
activity within various ATPases (Burns and Farrell, 1996
). All of these
facts raise the interesting possibility that the ts atb2
mutation alters the physical interaction between
- and
-tubulin,
or between
/
-heterodimers, and is accompanied by an alteration in
the level of GTP/GDP exchange or hydrolysis of
-tubulin.
In the worm Caenorhabditis elegans, the mutation analogous
to G246D was isolated in
-tubulin-encoding mec-7 (G244S,
called u129) (Savage et al., 1994
). Consistent
with the fission yeast atb2-1212 mutant, the u129
mutant exhibits a dominant phenotype. Thus it appears that for either
- or
- tubulin, this conserved glycine has an essential role in
microtubule biogenesis and/or assembly, and that mutation of this
residue results in a dominant phenotype. Given the high degree of
conservation in both sequence (invariant glycine) and function
(dominant mutations) in higher eukaryotic systems in which mutants are
not readily available, inducible expression of this mutant form of
tubulin might be a useful approach for conditionally disrupting
microtubules. This hypothesis is currently being tested.
ts Mutation in the
-Tubulin-encoding nda3+ Gene
The toxicity of the high-dosage atb2+ gene
and suppression by its deletion in the ts nda3 mutant
suggest an altered affinity of ts Nda3 toward the Atb2 protein. It is
possible that heterodimers of Atb2/ts Nda3 might specifically interfere
with microtubule assembly and/or maintenance in this mutant. However,
because nda2+ is an essential gene, we are
unable to similarly test whether its deletion rescues ts of
nda3-1828. Further analysis will be required to establish
any distinction between the two
-tubulin molecules in terms of their
specific interaction with ts Nda3.
The mutation site in nda3-1828 resides in the C-terminal
region of the molecule Y422H. In animal cells, the C-terminal region is
responsible for interactions with MAPs (MAP-1 and MAP-2) (Rivas et al., 1988
; Cross et al., 1991
), and the
crystallographic analysis shows that the C-terminal region resides on
the outer surface of the microtubule (Nogales et al., 1998
).
Systematic mutational analysis of budding yeast
-tubulin also
suggests that regions near the C terminus are essential for
microtubular function (Reijo et al., 1994
), and a truncation
from glutamate 431 results in a ts growth defective phenotype
(Matsuzaki et al., 1988
). Recently an essential protein that
shows properties similar to mammalian MAPs has been identified in
budding yeast (Irminger-Finger et al., 1996
). It is
therefore possible that the C-terminal region is also required for an
interaction with MAPs in fission yeast and that this interaction is
perturbed in the ts nda3 mutant.
Despite extensive mutational analysis of
-tubulin genes, only a few
ts mutants have been successfully isolated to date. In contrast, many
cs mutations have been isolated (Oakley and Morris, 1981
; Thomas
et al., 1985
; Huffaker et al., 1988
; Matsuzaki
et al., 1988
; Stearns and Botstein, 1988
; Davis et
al., 1994
; Reijo et al., 1994
; Savage et
al., 1994
; Sage et al., 1995
). In view of this, the
nda3-1828 mutant is of interest and may be a useful tool
with which to obtain further insight into the structure and function of
microtubules.
Mitotic Spindle Assembly Checkpoint and ts Tubulin Mutants
A surprising observation arising from this study is that in both
ts atb2 and nda3 mutants, it appears that the
spindle assembly checkpoint is not operational (Figure 7B). In these
mutants, cell cycle events such as septation, which usually occur after
bipolar spindle function, continue to take place at the restrictive
temperature despite defects in mitosis. In contrast, previously
identified cs nda3-KM311 mutant cells arrested uniformly in
midmitosis with condensed chromosomes and no septa (Umesono et
al., 1983b
; Hiraoka et al., 1984
). This is the typical
terminal phenotype when the spindle assembly checkpoint is functional.
One possible explanation of this phenotypic difference is that in the
ts nda3 mutant, microtubular function, especially spindle
function, is insufficiently defective to activate the spindle assembly
checkpoint. As shown in Figure 2, we sometimes observe short residual
spindle microtubules in ts nda3 cells incubated at the
restrictive temperature. A similar phenotype has been observed in ts
atb2 and cs nda2 mutants (Umesono et
al., 1983b
; this study). Because fission yeast has two
-tubulin-encoding genes, a single mutation may be unable to
completely abrogate the function of the other gene, and as a result
partial microtubular function remains. It is therefore possible that
the temperature lethality of nda3-1828 mutant cells arises
from abortive cell cycle progression attributable to residual spindle
function, preventing activation of the checkpoint machinery rather than
cell cycle arrest caused by the loss of microtubules.
It is worth pointing out that the phenotype of the ts nda3
mutant, which loses viability at the restrictive temperature, is similar to that of spindle assembly checkpoint mutants such as cs
nda3-KM311 mad2, nda3-KM311cdc16, and
nda3-KM311dma1 double mutants in which components of the
spindle assembly checkpoints are missing (Fankhauser et al.,
1993
; Murone and Simanis, 1996
; He et al., 1997
). The
nda3-1828 mutant could prove useful in the genetic
dissection of the transduction mechanisms that monitor spindle defects
via the checkpoint machinery.
| |
ACKNOWLEDGMENTS |
|---|
We thank Drs. Keith Gull for the TAT-1 antibody, Hiroyuki Yamano for anti-Cdc2 antibody, Anthony Carr for the pUR19-based fission yeast genomic library, Yasuhisa Adachi for strains, Mikiko Fukui and Mark Eddison for help with characterization of the alp mutants, and Juan Mata for help with allelism tests between alp8 and tea1. We thank Drs. Mitsuhiro Yanagida for stimulative discussion and Paul Nurse and Iain Hagan for critical reading of this manuscript and useful suggestions. The initial part of this work is supported by a research grant from Kyowa Hakko.
| |
FOOTNOTES |
|---|
* Present address: Department of Molecular Biotechnology, Graduate School of Engineering, Hiroshima University, Higashi-Hiroshima, 739, Japan.
Corresponding author. E-mail address:
toda{at}europa.lif.icnet.uk.
| |
REFERENCES |
|---|
|
|
|---|
-tubulin genes in Schizosaccharomyces pombe.
Mol. Cell. Biol.
6, 2168-2178
-tubulin as part of the binding site for the A ring of colchicine.
J. Biol. Chem.
271, 12639-12645
-tubulin.
Trends Cell Biol.
6, 297-303.
-tubulin. Studies with synthetic tubulin peptides.
Biochemistry
30, 5372-5376.
-tubulin.
Science
264, 839-842
-tubulin: a cold-sensitive nda3 mutation reversibly blocks spindle formation and chromosome movement in mitosis.
Cell
39, 349-358[Medline].
-tubulin is essential for mitosis and is localized at microtubule organizing centers.
J. Cell Sci.
99, 693-700[Abstract].
-tubulin mutations on microtubule formation and function.
J. Cell Biol.
106, 1997-2010
-tubulin causes temperature-sensitive growth and hypersensitivity to antimitotic drugs.
J. Cell Biol.
107, 1427-1435
-tubulin gene from yeast and demonstration of its essential function in vivo.
Cell
33, 211-219[Medline].
tubulin dimer by electron crystallography.
Nature
391, 199-203[Medline].
-tubulin mutation in Aspergillus nidulans that blocks microtubule function without blocking assembly.
Cell
24, 837-845[Medline].
-tubulin gene.
Mol. Biol. Cell
5, 29-43[Abstract].
-tubulin: evidence that
-,
-, and
-tubulins are atypical GTPases.
Biochemistry
34, 7409-7419[Medline].
-tubulin genes of the yeast Saccharomyces cerevisiae encode divergent proteins.
Mol. Cell. Biol.
6, 3711-3721
-tubulin genes specify functionally interchangeable proteins.
Mol. Cell. Biol.
6, 3722-2733
-tubulin gene of Saccharomyces cerevisiae.
Genetics
112, 715-734.
-tubulin.
Cell
86, 287-296[Medline].
-tubulin genes in Schizosaccharomyces pombe.
Cell
37, 233-242[Medline].This article has been cited by other articles:
![]() |
F. Chang and S. G. Martin Shaping fission yeast with microtubules. Cold Spring Harb Perspect Biol, July 1, 2009; 1(1): a001347 - a001347. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ma, J. Tran, C. Li, L. Ganesan, D. Wood, and N. Morrissette Secondary Mutations Correct Fitness Defects in Toxoplasma gondii With Dinitroaniline Resistance Mutations Genetics, October 1, 2008; 180(2): 845 - 856. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zheng, C. Schwartz, L. Wee, and S. Oliferenko The Fission Yeast Transforming Acidic Coiled Coil-related Protein Mia1p/Alp7p Is Required for Formation and Maintenance of Persistent Microtubule-organizing Centers at the Nuclear Envelope Mol. Biol. Cell, May 1, 2006; 17(5): 2212 - 2222. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Masuda, R. Miyamoto, T. Haraguchi, and Y. Hiraoka The carboxy-terminus of Alp4 alters microtubule dynamics to induce oscillatory nuclear movement led by the spindle pole body in Schizosaccharomyces pombe Genes Cells, April 1, 2006; 11(4): 337 - 352. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Asakawa, K. Kume, M. Kanai, T. Goshima, K. Miyahara, S. Dhut, W. W. Tee, D. Hirata, and T. Toda The V260I Mutation in Fission Yeast {alpha}-Tubulin Atb2 Affects Microtubule Dynamics and EB1-Mal3 Localization and Activates the Bub1 Branch of the Spindle Checkpoint Mol. Biol. Cell, March 1, 2006; 17(3): 1421 - 1435. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Ge, T. G. Chew, V. Wachtler, S. N. Naqvi, and M. K. Balasubramanian The Novel Fission Yeast Protein Pal1p Interacts with Hip1-related Sla2p/End4p and Is Involved in Cellular Morphogenesis Mol. Biol. Cell, September 1, 2005; 16(9): 4124 - 4138. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tominaga, B. Kirtane, J. G. Jackson, Y. Ikeno, T. Ikeda, C. Hawks, J. R. Smith, M. M. Matzuk, and O. M. Pereira-Smith MRG15 Regulates Embryonic Development and Cell Proliferation Mol. Cell. Biol., April 15, 2005; 25(8): 2924 - 2937. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-W. Wang, K. Asakawa, T. Z. Win, T. Toda, and C. J. Norbury Inactivation of the Pre-mRNA Cleavage and Polyadenylation Factor Pfs2 in Fission Yeast Causes Lethal Cell Cycle Defects Mol. Cell. Biol., March 15, 2005; 25(6): 2288 - 2296. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Leonhard and P. Nurse Ste20/GCK kinase Nak1/Orb3 polarizes the actin cytoskeleton in fission yeast during the cell cycle J. Cell Sci., March 1, 2005; 118(5): 1033 - 1044. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Yamashita, M. Sato, A. Fujita, M. Yamamoto, and T. Toda The Roles of Fission Yeast Ase1 in Mitotic Cell Division, Meiotic Nuclear Oscillation, and Cytokinesis Checkpoint Signaling Mol. Biol. Cell, March 1, 2005; 16(3): 1378 - 1395. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Minoda, S. Saitoh, K. Takahashi, and T. Toda BAF53/Arp4 Homolog Alp5 in Fission Yeast Is Required for Histone H4 Acetylation, Kinetochore-Spindle Attachment, and Gene Silencing at Centromere Mol. Biol. Cell, January 1, 2005; 16(1): 316 - 327. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Celton-Morizur, N. Bordes, V. Fraisier, P. T. Tran, and A. Paoletti C-Terminal Anchoring of mid1p to Membranes Stabilizes Cytokinetic Ring Position in Early Mitosis in Fission Yeast Mol. Cell. Biol., December 15, 2004; 24(24): 10621 - 10635. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sato, L. Vardy, M. Angel Garcia, N. Koonrugsa, and T. Toda Interdependency of Fission Yeast Alp14/TOG and Coiled Coil Protein Alp7 in Microtubule Localization and Bipolar Spindle Formation Mol. Biol. Cell, April 1, 2004; 15(4): 1609 - 1622. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Sawin and H. A. Snaith Role of microtubules and tea1p in establishment and maintenance of fission yeast cell polarity J. Cell Sci., February 15, 2004; 117(5): 689 - 700. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Reid, Z. Moqtaderi, and K. Struhl Eaf3 Regulates the Global Pattern of Histone Acetylation in Saccharomyces cerevisiae Mol. Cell. Biol., January 15, 2004; 24(2): 757 - 764. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Wright and C. P. Hunter Mutations in a {beta}-Tubulin Disrupt Spindle Orientation and Microtubule Dynamics in the Early Caenorhabditis elegans Embryo Mol. Biol. Cell, November 1, 2003; 14(11): 4512 - 4525. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fujita, L. Vardy, M. A. Garcia, and T. Toda A Fourth Component of the Fission Yeast gamma -Tubulin Complex, Alp16, Is Required for Cytoplasmic Microtubule Integrity and Becomes Indispensable When gamma -Tubulin Function Is Compromised Mol. Biol. Cell, July 1, 2002; 13(7): 2360 - 2373. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Heitz, J. Petersen, S. Valovin, and I. M. Hagan MTOC formation during mitotic exit in fission yeast J. Cell Sci., March 14, 2002; 114(24): 4521 - 4532. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Motegi, R. Arai, and I. Mabuchi Identification of Two Type V Myosins in Fission Yeast, One of Which Functions in Polarized Cell Growth and Moves Rapidly in the Cell Mol. Biol. Cell, May 1, 2001; 12(5): 1367 - 1380. [Abstract] [Full Text] |
||||
![]() |
P.T. Tran, L. Marsh, V. Doye, S. Inoue, and F. Chang A Mechanism for Nuclear Positioning in Fission Yeast Based on Microtubule Pushing J. Cell Biol., April 16, 2001; 153(2): 397 - 412. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ohkura, M. A. Garcia, and T. Toda Dis1/TOG universal microtubule adaptors - one MAP for all? J. Cell Sci., January 11, 2001; 114(21): 3805 - 3812. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Browning, J. Hayles, J. Mata, L. Aveline, P. Nurse, and J. R. McIntosh Tea2p Is a Kinesin-like Protein Required to Generate Polarized Growth in Fission Yeast J. Cell Biol., October 2, 2000; 151(1): 15 - 28. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Radcliffe, M. A. Garcia, and T. Toda The Cofactor-Dependent Pathways for {alpha}- and {beta}-Tubulins in Microtubule Biogenesis Are Functionally Different in Fission Yeast Genetics, September 1, 2000; 156(1): 93 - 103. [Abstract] [Full Text] |
||||
![]() |
A. Paoletti and F. Chang Analysis of mid1p, a Protein Required for Placement of the Cell Division Site, Reveals a Link between the Nucleus and the Cell Surface in Fission Yeast Mol. Biol. Cell, August 1, 2000; 11(8): 2757 - 2773. [Abstract] [Full Text] |
||||
![]() |
P. A. Radcliffe, D. Hirata, L. Vardy, and T. Toda Functional Dissection and Hierarchy of Tubulin-folding Cofactor Homologues in Fission Yeast Mol. Biol. Cell, September 1, 1999; 10(9): 2987 - 3001. [Abstract] [Full Text] |
||||
![]() |
E. Grishchuk and J. McIntosh Sto1p, a fission yeast protein similar to tubulin folding cofactor E, plays an essential role in mitotic microtubule assembly J. Cell Sci., January 6, 1999; 112(12): 1979 - 1988. [Abstract] [PDF] |
||||
![]() |
A. Eisen, R. T. Utley, A. Nourani, S. Allard, P. Schmidt, W. S. Lane, J. C. Lucchesi, and J. Cote The Yeast NuA4 and Drosophila MSL Complexes Contain Homologous Subunits Important for Transcription Regulation J. Biol. Chem., January 26, 2001; 276(5): 3484 - 3491. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||