![]() |
|
|
Vol. 9, Issue 9, 2423-2437, September 1998


and
*Institute of Molecular and Cell Biology, Singapore 117609, Singapore; and
Centre for Microscopy and Microanalysis
and
Centre for Molecular and Cellular Biology,
Department of Physiology and Pharmacology, University of Queensland, St
Lucia, Queensland 4072, Australia
| |
ABSTRACT |
|---|
|
|
|---|
cDNA clones encoding a novel protein (VAMP5) homologous to synaptobrevins/VAMPs are detected during database searches. The predicted 102-amino acid VAMP5 harbors a 23-residue hydrophobic region near the carboxyl terminus and exhibits an overall amino acid identity of 33% with synaptobrevin/VAMP1 and 2 and cellubrevin. Northern blot analysis reveals that the mRNA for VAMP5 is preferentially expressed in the skeletal muscle and heart, whereas significantly lower levels are detected in several other tissues but not in the brain. During in vitro differentiation (myogenesis) of C2C12 myoblasts into myotubes, the mRNA level for VAMP5 is increased ~8- to 10-fold. Immunoblot analysis using antibodies specific for VAMP5 shows that the protein levels are also elevated ~6-fold during in vitro myogenesis of C2C12 cells. Indirect immunofluorescence microscopy and immunoelectron microscopy reveal that VAMP5 is associated with the plasma membrane as well as intracellular perinuclear and peripheral vesicular structures of myotubes. Epitope-tagged versions of VAMP5 are similarly targeted to the plasma membrane.
| |
INTRODUCTION |
|---|
|
|
|---|
Vesicle-mediated protein transport is the major mechanism for
protein movement along the secretory and endocytotic pathways and for
regulated protein secretion and neurotransmitter release (Palade, 1975
;
Pryer et al., 1992
; Rothman, 1994
; Hong, 1996
; Rothman and
Wieland, 1996
; Schekman and Orci, 1996
). Because of the existence of
diverse intracellular organelles and their resulting vesicles,
understanding the molecular mechanisms that govern the specific docking
and fusion of vesicles with their acceptor compartment represents an
important aspect in our current studies of membrane traffic (Rothman
and Warren, 1994
; Scheller, 1995
; Südhof 1995
; Pfeffer, 1996
).
The SNARE hypothesis suggests that vesicle docking and fusion are
mediated by specific interaction between vesicle-associated proteins
termed v-SNAREs and those (termed t-SNAREs) associated with the target
membrane (Söllner et al., 1993
; Ferro-Novick and Jahn,
1994
; Rothman, 1994
; Rothman and Warren, 1994
; Scheller, 1995
;
Südhof, 1995
; Whiteheart and Kubalek, 1995
; Pfeffer, 1996
; Weber
et al., 1998
). In the neuron, synaptobrevin/VAMP1 functions as the v-SNARE for synaptic vesicles, whereas syntaxin 1 and SNAP-25 associated with the presynaptic membrane function as t-SNAREs (Söllner et al., 1993
). The specific interaction of
synaptobrevin/VAMP1 with a protein complex composed of syntaxin 1 and
SNAP-25 plays a fundamental role in docking and fusion of synaptic
vesicles and for regulated neurotransmitter release (Söllner
et al., 1993
; Scheller, 1995
; Südhof, 1995
).
The identification of novel proteins homologous to
synaptobrevins/VAMPs, syntaxin 1 and SNAP-25, establishes that they
each represent members of distinct protein families. Currently, the synaptobrevin family contains three members. Synaptobrevin 1 and 2 are
highly homologous (~80% amino acid identities) proteins associated
with synaptic vesicles and secretory granules and are involved in
regulated protein secretion and neurotransmitter release (Söllner
et al., 1993
; Scheller, 1995
; Südhof, 1995
), whereas cellubrevin is ubiquitously expressed and is associated with the endocytotic pathway (McMahon et al., 1993
). Mammalian
proteins distantly related to synaptobrevins have also been
characterized, and these include rbet1, sec22a, sec22b/ERS-24, sec22c,
and hYKT6 (Hay et al., 1996
, 1997
; McNew et al.,
1997
; Paek et al., 1997
; Zhang et al., 1997
; Tang
et al., 1998a
). Ten distinct syntaxin-like proteins
(syntaxin 1, 2, 3, 4, 5, 6, 7, 10, 12, and 16) and three SNAP-25-like
proteins (SNAP-25a, SNAP-25b, and SNAP-23) have been characterized
(Oyler et al., 1989
; Bennett et al., 1992
, 1993
; Bock et al., 1996
, 1997
; Ravichandran et al.,
1996
; Wang et al., 1997
; Tang et al., 1998b
-d
;
Wong et al., 1998
). The existence of other potential members
of the syntaptobrevin/VAMP, syntaxin, and SNAP-25 protein families have
been suggested, and their molecular and biochemical characterizations
remain to be conducted (Bock and Scheller, 1997
; our unpublished
observations).
Myogenesis represents one of the few well-studied models of cellular
differentiation, and several types of myoblasts have been used for in
vitro myogenesis. Genetically, the muscle-specific basic
helix-loop-helix (bHLH) transcription factors MyoD, myogenin, Myf5,
and MRF4 play a determining role in the commitment to and in the actual
process of myogenesis (Lassar et al., 1994
; Tam et
al., 1995
; Molkentin and Olson, 1996
; Rawls and Olson, 1997
; Walsh
and Perlman, 1997
). These myogenic basic HLH proteins interact with
ubiquitously expressed HLH proteins such as E12 and E47 to form
functional heterodimers, which bind to the E box consensus sequence
(CANNTG). Another family of transcriptional factors that participate in
myogenesis are myocyte enhancer factors (MEF2), which are encoded by a
family of four genes whose products share sequence homology within a
56-amino acid MADS domain. MEF2 factors bind DNA either as homodimers
or heterodimers between various MEF2 members. Both the E box site and
MEF2 binding site have been identified in promoters and/or enhancers of
many muscle-specific genes. Another important discovery is that the
expression of the cyclin-dependent kinase inhibitor p21/Cip1/WAF1 is
greatly enhanced during myogenesis, and this plays a critical role in
withdrawal of differentiating myoblasts from the cell cycle (Walsh and
Perlman, 1997
). During in vitro myogenesis, p21 induction and cell
cycle withdrawal are downstream of enhanced expression of myogenin. Several other nuclear proteins, including an alternatively spliced muscle-specific form of
-nascent polypeptide--associated
complex, p300/CBP, and RB have also been shown to participate in
myogenesis (Missero et al., 1995
; Novitch et al.,
1996
; Yotov and St-Arnaud, 1996
; Puri et al., 1997
;
Sartorelli et al., 1997
). Expression of the muscle-specific
intermediate filament protein desmin is necessary for myogenesis (Li
et al., 1994
). ERK6, a muscle-specific mitogen-activated
protein kinase, also regulates myogenesis (Lechner et al.,
1996
). Furthermore, cell surface proteins such as N-CAM, N- and
M-cadherin, VLA-4, VCAM-1, and meltrin-
have also been implicated in
myogenesis (Menko and Boettiger, 1987
; Donalies et al.,
1991
; Rosen et al., 1992
; Peck and Walsh, 1993
;
Yagami-Hiromasa et al., 1995
). Despite this progress, more
molecular aspects of myogenesis remain to be investigated.
Using the amino acid sequence of synaptobrevin/VAMP2 to search the database of the expressed sequence tags (ESTs), we have identified a novel member (VAMP5) of the synaptobrevin/VAMP protein family. Interestingly, the expression of VAMP5 is greatly increased during in vitro myogenesis of C2C12 cells. The molecular, biochemical, and cell biological characterizations of VAMP5 are described.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Materials
Madin-Darby canine kidney strain II (MDCK II) was a generous gift from Dr. Kai Simons (European Molecular Biology Laboratory, Heidelberg, Germany). All other cell lines were obtained from American Type Culture Collection (Rockville, MD). The mouse mRNA multiple tissues Northern filter was obtained from Clontech (Palo Alto, CA). The oligolabeling kit and glutathione-Sepharose 4B beads were purchased from Pharmacia (Upsala, Sweden). Fluorescein isothiocyanate-conjugated goat anti-mouse immunoglobulin G (IgG) and rhodamine-conjugated goat anti-rabbit IgG were purchased from Boehringer Mannheim (Mannheim, Germany). Brefeldin A (BFA) was from Epicentre Technologies (Madison, WI).
cDNA cloning and Sequencing
Mouse EST clones (accession numbers AA050010, AA030509, and AA222692) were generated by the Washington University-Merck EST project and were obtained from the IMAGE consortium via Research Genetics (Huntsville, AL). Clone AA030509 was sequenced completely using the dideoxy chain termination method with the Sequenase II kit (United States Biochemical, Cleveland, OH).
Northern Blot Analysis
A mouse multiple tissue blot of poly(A)+ mRNA
(Clontech) was probed with the VAMP5 probe using the procedure as
described (Lowe et al., 1996
). Total RNA was isolated from
myoblasts and myotubes as described previously (Zeng et al.,
1994
). Total RNA was resolved by 1% agarose gel, transferred to a
Hybond-N filter (Amersham, Arlington Heights, IL), and processed
for Northern blot as described (Zeng et al., 1994
; Lowe
et al., 1996
).
Expression of Recombinant Proteins in Bacteria
GST-VAMP5 was produced using the pGEX-KG vector (Guan and Dixon,
1991
). Briefly, the coding region for residues 1-70 of VAMP5 was
retrieved by the PCR using pfu DNA polymerase with
oligonucleotides 1 (5'-CTGGATCCATGGCAGGGAAAGAACTGAAG) and 2 (5'-CGTCTAGATTAGTAGACCCGGCACCGGAT). The PCR product was gel purified,
digested with restriction enzymes BamHI and XbaI,
and then ligated with similarly digested pGEX-KG vector. The ligation
reaction was used to transform a competent Escherichia coli
M15 strain, and transformants were screened for isopropyl-1-thio-
-D-galactopyranoside-inducible
expression of recombinant protein. Two transformants (1 and 2) were
expanded for large-scale purification of GST-VAMP5 using a protocol
described previously (Lowe et al., 1996
).
Preparation of Polyclonal Antibodies
Rabbits were each injected with 500 µg of GST-VAMP5 emulsified
in complete Freund's adjuvant. Booster injections containing a similar
amount of antigen emulsified in incomplete Freund's adjuvant were
administered every 2 wk. Rabbits were bled 10 d after the second
and subsequent booster injections. Serum was diluted twice with PBS and
incubated first with cyanogen bromide-activated Sepharose beads
coupled with GST to absorb antibodies against GST. Antibodies against
VAMP5 were then affinity purified by incubating with beads immobilized
with GST-VAMP5. After extensive washing, specific antibodies were
eluted, neutralized, concentrated, and stored at
20°C in 10%
glycerol (Lowe et al., 1996
; Zhang et al., 1997
).
In Vitro Myogenesis
C2C12 cells were grown in DMEM with 20% FBS (growth medium) as myoblasts. When cells reached 50-70% confluency, cell differentiation was initiated by shifting the culture medium to DMEM containing 1-2% horse serum (DM) to trigger myogenesis. Myoblast fusion began 2-3 d after incubation in DM, and maximal myoblast fusion occurred 5 d after incubation in DM. Approximately 40-60% of the cells were in the form of myotubes of varying sizes and morphologies.
Immunoblot Analysis
This was performed as described previously (Lowe et
al., 1996
; Zhang et al., 1997
), except that antibodies
against VAMP5 were used at concentrations of 2-5 µg/ml.
Immunofluorescence Microscopy
Immunofluorescence microscopy was performed as described
previously (Lowe et al., 1996
; Zhang et al.,
1997
). For the treatment of cells with BFA or nocodazole, myotubes were
incubated with BFA (10 µg/ml) or nocodazole (10 µg/ml) for the
indicated times, washed twice in PBS with 1 mM CaCl2 and 1 mM MgCl2, and then fixed in 3% paraformaldehyde. Fixed
cells were then permeabilized and processed for indirect
immunofluorescence microscopy. Confocal microscopy was performed as
described previously (Zhang et al., 1997
; Tang et
al., 1998c
) with a Zeiss (Thornwood, NY) Axioplan II microscope
equipped with a Bio-Rad (Hercules, CA) MRC1024 confocal scanning laser.
Typically, images shown are combinations of 10 optical sections of 0.3 µm apart unless indicated.
Electron Microscopy
C2C12 myotubes were cultured for 8 d and then fixed in 8%
paraformaldehyde in 0.1 M phosphate buffer (pH 7.35) for 1 h at room temperature. They were washed with 0.2 M phosphate buffer, scraped
from the culture dish, and pelleted at 10,000 rpm in a microfuge. The
cells were then resuspended in warm gelatin (10% in phosphate buffer)
and repelleted at maximum speed in the microfuge. After cooling, the
gelatin-embedded cells were infiltrated with polyvinyl
pyrrolidone-sucrose overnight at 4°C and then processed for frozen
sectioning as described previously (Parton et al., 1997
).
Ultrathin frozen sections (60-80 nm) were labeled, viewed (Jeol 1010, Centre for Microscopy and Microanalysis, University of Queensland)
according to published techniques (Parton et al., 1997
),
except that to increase the signal the first antibody
(affinity-purified anti-VAMP5) was followed by a swine anti-rabbit
second antibody before incubation with 10 nm protein A-gold (University
of Utrecht, Utrecht, The Netherlands)
Differential Extraction of Total Membranes
The total membrane of myotube was prepared as described (Lowe
et al., 1996
). Briefly, cells were sonicated in PBS and then centrifuged at 2000 × g to remove the unbroken cells
and the nuclei. The supernatant was centrifuged at 10,000 × g for 1 h at 4°C to yield a total membrane pellet.
The membrane was extracted on ice for 1 h in 100 µl of PBS, 1 M
KCl, 0.15 M sodium bicarbonate (pH 11.5), 2.5 M urea, 1% Triton X-100,
or 1% deoxycholate (DOC) and then centrifuged at 100,000 × g for 1 h at 4°C. The supernatants were transferred
to another tube, and the pellets were resuspended in 100 µl of 1×
SDS sample buffer. Aliquots (20 µl) from both the supernatants as
well as the pellets were analyzed by immunoblot analysis to
detect VAMP5.
Epitope Tagging and Transfection
PCR reactions with oligos 3 (5'-GCGAATTCACCATGGAGCAGAAGCTGATCTCCGAGGAGGACCTCGCAGGGAAAGAACTGAAGCAATG)
and 4 (5'-CTGGATCCTCTAGACTATGGTTTACTACTGTCCC) or with
oligos 5 (5'-GCGAATTCACCATGGCTTACCCATACGATGTTCCAGATTACGCTGCAGGGAAAGAACTGAAGCAATG) and 4 were performed to introduce myc and hemagglutinin (HA) epitope at
the N terminus of VAMP5. The PCR fragments were cut with
EcoRI and BamHI, inserted into the expression
vector pCI-neo (Promega, Madison, WI), and then stably transfected into
C2C12 cells as described (Lowe et al., 1997
).
| |
RESULTS |
|---|
|
|
|---|
VAMP5 as a Novel Member of the Synaptobrevin/VAMP Protein Family
Three homologous mouse EST clones (accession numbers
AA050010, AA030509, and AA222692) were recovered through EST database
searches (Altschul et al., 1990
) with the amino acid sequence of mouse synaptobrevin/VAMP-2. These three EST clones represent the same protein based on the comparison of available EST
sequences and partial sequences obtained by resequencing the cDNA
clones. EST clone AA030509 was sequenced completely. The existence of
EST clone AA222692 was also noticed by Bock and Scheller (1997)
, and
they have referred to the corresponding protein as VAMP5. To avoid
confusion of nomenclature for this protein, we have adopted the name
VAMP5 for this protein. The nucleotide and deduced amino acid sequences
of mouse VAMP5 are shown in Figure 1A.
The 102-amino acid sequence of VAMP5 contains a 23-residue hydrophobic
domain (residues 71-93) near the carboxyl terminus that could function
as a carboxyl-terminal membrane anchor. The N-terminal 70-residue
sequence (residues 1-70) is predicted to be oriented on the
cytoplasmic side of the membrane, whereas the carboxyl-terminal
nine-residue sequence (residues 94-102) is predicted to be oriented in
the lumen of intracellular membrane compartments or exposed to the
extracellular side of the plasma membrane. The putative N-terminal
cytoplasmic domain can potentially form coiled-coil structures, a
prediction based on analysis using the COILS 2.1 program
(http://www.isrec.isb-sib.ch/software/COILS_form.html). The
alignment of amino acid sequences of mouse VAMP5, cellubrevin, and
synaptobrevin/VAMP-2 is shown in Figure 1B. VAMP5 exhibits an overall
33% identity with cellubrevin and synaptobrevin/VAMP2. As shown, the
amino acid sequences of VAMP5, cellubrevin, and synaptobrevin/VAMP2 can
be aligned without introducing any gaps. These results establish that
VAMP5 is indeed a novel member of the synaptobrevin/VAMP protein
family.
|
VAMP5 Transcript Is Preferentially Expressed in the Muscle and Heart
To initiate molecular characterization of VAMP5, we have
examined its mRNA levels in several mouse tissues. A mouse
multiple-tissue mRNA blot (Clontech) was probed with radiolabeled VAMP5
cDNA probe. As shown in Figure 2A, a
major mRNA species of ~700 bp was detected. mRNA for VAMP5 was
present at the highest levels in the skeletal muscle and heart. Much
lower levels were detected in the spleen, lung, liver, kidney, and
testis. VAMP5 mRNA was not detected in the brain. Interestingly, VAMP5
mRNA in the testis has a larger size (~1.4-1.5 kbp) than that in
other tissues. Although the molecular basis for this size difference
remains to be examined, the larger size of the transcript in the testis
could be derived from alternative splicing and/or use of a different
downstream polyadenylation signal. The levels of
-actin mRNA in the
various tissues of the same blot are shown in Figure 2B.
|
VAMP5 mRNA Levels Are Increased during In Vitro Myogenesis of C2C12 Cells
The preferential expression of VAMP5 in the skeletal muscle
and heart indicates that VAMP5 may be associated with a function that
is more prominent in these tissues. To explore this further, we have
examined the levels of VAMP5 mRNA during in vitro myogenesis of mouse
C2C12 cells. C2C12 cells grow as myoblasts in growth medium and can be
induced to differentiate into myotubes in differentiation medium. Total
RNA was isolated from myoblasts and myotubes and analyzed by Northern
blotting (Figure 3). Lanes 1 and 2 show
the loading of the RNA stained with ethidium bromide, whereas lanes 3 and 4 show the results of after hybridization with the VAMP5 cDNA
probe. It is obvious that VAMP5 mRNA is much more abundant in the
myotubes (Figure 3, lanes 2 and 4) compared with myoblasts (Figure 3,
lanes 1 and 3). In marked contrast, the mRNA for mouse Rab10, a small
GTPase implicated in post-Golgi trafficking (Chen et al.,
1993
), is not increased during in vitro myogenesis (Figure 3, lanes 5 and 6). It is estimated that VAMP5 mRNA levels are increased by ~8-
to 10-fold during in vitro myogenesis.
|
Characterization of VAMP5-specific Antibodies
To facilitate biochemical and cell biological
characterizations of VAMP5, we have raised rabbit antibodies against
VAMP5. The cytoplasmic region (residues 1-70) of VAMP5 was expressed in bacteria as a fusion protein with GST (GST-VAMP5), and the purified
GST-VAMP5 was used to immunize rabbits. Rabbit antisera were first
absorbed with immobilized GST to remove antibodies against the GST
portion of the fusion protein. Antibodies specific for VAMP5 were then
affinity purified with immobilized GST-VAMP5. Immunoblot
analysis (Figure 4) demonstrates that the
antibodies prepared in this way recognize specifically a 16-kDa
polypeptide in total extract of myotubes (Figure 4, lane 1). Detection
of this protein is abolished by preincubation of the antibodies with GST-VAMP5 (Figure 4, lane 2) but not with GST (Figure 4, lane 3),
GST-cellubrevin (Figure 4, lane 4), or GST-VAMP2 (Figure 4, lane 5).
These results establish that the affinity-purified antibodies are
specific for VAMP5. Although the apparent size of VAMP5 (16 kDa) is
~4.5 kDa larger than the predicted size (11.5 kDa), a similar
difference between the apparent size (18 kDa) and the predicted size
(13 kDa) for synaptobrevin1/VAMP1 has also been observed (Baumert
et al., 1989
). We thus conclude that the 16-kDa polypeptide
is VAMP5.
|
VAMP5 Levels Are Also Induced during In Vitro Myogenesis
Because the VAMP5 transcript level is increased during myogenesis,
we examined whether the protein level of VAMP5 is similarly induced
during myogenesis. Total detergent extracts of myoblasts and myotubes
were analyzed by immunoblot analysis to detect VAMP5. As
shown in Figure 5, the amount of VAMP5 is
clearly increased during myogenesis. The level of VAMP5 in myotubes
(Figure 5C, lane 2) is approximately sixfold higher than in myoblasts
(Figure 5C, lane 1), an estimation based on a series of dilutions of
myotube extract compared with a fixed amount of myoblast
extract. As a control, GS28 (also referred to as GOS-28), a
cis-Golgi SNARE involved in protein transport from the
endoplasmic reticulum to the Golgi and/or intra-Golgi transport
(Subramaniam et al., 1995
, 1996
; Nagahama et al.,
1996
), is present at similar levels in both myoblasts and myotubes
(Figure 5B).
|
VAMP5 Is an Integral Membrane Protein
The deduced amino acid sequence of VAMP5 suggests that it is an integral membrane protein. To biochemically verify this point, we prepared a total membrane fraction of myotubes and subjected it to different extraction conditions as detailed in Figure 6. The extracted supernatants (S) and the pellets (P) were analyzed for VAMP5 by immunoblotting. As shown, VAMP5 was not extracted by PBS, 1 M KCl, 2.5 M urea, or 0.15 M sodium bicarbonate (pH 11.5) (Figure 6, lanes 1-8) but was effectively extracted by detergents such as 1% Triton X-100 and 1% DOC (Figure 6, lanes 9-12), establishing that VAMP5 is indeed an integral membrane protein.
|
Association of VAMP5 with the Plasma Membrane and Intracellular Vesicular Structures in Myotubes
By indirect immunofluorescence microscopy, the affinity-purified antibodies against VAMP5 failed to reveal any specific labeling in several cell lines such as MDCK, NRK, A431, Hela, CHO, and growing C2C12 cells. To gain insight into its subcellular localization, we examined the subcellular localization of VAMP5 in differentiated C2C12 cells. After growing in differentiation medium for 5-6 d, ~40-60% of cells are in the form of fused multinuclear myotubes with the rest remaining as unfused myoblasts. Although only basal levels of labeling were detected in the majority of the unfused myoblasts, some unfused myoblasts have intense labeling on the cell surface (Figure 7A, a) and intracellular vesicular structures (7A, b), as is also obvious from the combined optical sections (7A, c). Strong labeling was detected in every myotube (Figures 8-11). Prominent labeling could be found on the plasma membrane and intracellular vesicular structures. These results not only demonstrate again that VAMP5 level is greatly enhanced during myogenesis but also that VAMP5 is associated with the plasma membrane and intracellular vesicular structures.
|
|
Two types of vesicular structures were observed in myotubes, one being
associated with broken ring-like structures around the nuclei, whereas
the other was distributed peripherally. To gain additional insight into
the intracellular vesicular structures, we performed double labeling
with rabbit antibodies against VAMP5 and a mouse monoclonal antibody
against GS28 (Subramaniam et al., 1995
, 1996
). As shown,
the broken ring-like structures of VAMP5 and GS28 colocalized (Figure
8). Colocalization of some of the peripheral structures of VAMP5 and
GS28 was also seen. However, the majority of peripheral labeling of
VAMP5 as well as the labeling on the plasma membrane was unique for
VAMP5. Also obvious in Figure 8 is that the majority of unfused
myoblasts (with the exception of one unfused myoblast in the bottom
right corner of a-c) did not exhibit detectable labeling for VAMP5,
although GS28 labeling was observed.
Nocodazole is known to fragment the Golgi apparatus (Yang and Storrie,
1998
), and we treated C2C12 cells after growing in differentiation
medium for 5-6 d with 10 µg/ml nocodazole for 1 h. The cells
were then processed for double labeling to detect VAMP5 and GS28
(Figure 9). The Golgi apparatus marked by
GS28 in unfused myoblasts (between the two myotubes) was clearly
fragmented (Figure 9, e and f). Interestingly, the Golgi apparatus
marked by GS28 in myotubes was less fragmented. Under this condition, the perinuclear labeling of VAMP5 seems to be segregated significantly from that of GS28, although their labeling patterns still show considerable overlap (Figure 9, c and f). These results indicate that
VAMP5 and GS28 may not reside in the same compartment, although they
appear to be colocalized under normal conditions.
|
BFA has dramatic effects on the secretory and endocytotic pathway
(Klausner et al., 1992
). When myotubes were treated with 10 µg/ml BFA for 5 min, the majority of the Golgi-like labeling of
VAMP5 was seen to be redistributed (Figure
10a), whereas the Golgi labeling of
GS28 remained prominent (Figure 10b). After a 25-min treatment with
BFA, both VAMP5 (Figure 10d) and GS28 (Figure 10e) were distributed
into small vesicle-like structures. Importantly, VAMP5 and GS28 were
associated with distinct structures that no longer colocalized (Figure
10f). This demonstrates that VAMP5 and GS28 are redistributed into
distinct structures by BFA treatment.
|
We have examined the expression and localization of VAMP5 during different times of differentiation. The results are consistent with the above in that every myotube exhibits strong labeling, whereas only a fraction of myoblasts has strong labeling on day 2 and onward after differentiation. However, it was observed that both surface and intracellular labeling of VAMP5 were evident in young myotubes (Figure 11a), whereas the surface labeling for VAMP5 became more predominant in more matured myotubes (Figure 11b-d).
|
Localization of Epitope-tagged Versions of VAMP5 in Transfected C2C12 Myoblasts
The subcellular localization of VAMP5 was also examined by stable expression of myc epitope- as well as HA epitope-tagged versions of VAMP5 in C2C12 cells. As revealed by indirect immunofluorescence microscopy (Figure 7B), both the myc-tagged version (myc-VAMP5) as well as the HA-tagged version (HA-VAMP5) are preferentially associated with the plasma membrane with some intracellular vesicular labeling. Labeling of myc-VAMP5 and HA-VAMP5 in myotubes was similar to that observed for endogenous VAMP5. These results further confirm the conclusion that VAMP5 is associated with the plasma membrane and intracellular vesicular structures.
Immunogold Labeling of VAMP5 in C2C12 Myotubes
The distribution of VAMP5 was further examined at the ultrastructural level on ultrathin frozen sections of differentiated C2C12 cells. Specific labeling was observed on the plasma membrane and internal membrane of myotubes (Figure 12). Undifferentiated myoblasts, which are also present in the cultures after differentiation, had very low labeling for VAMP5 (e.g., Figure 12a, cell marked mb), consistent with the above results and showing the specificity of the immunogold labeling. Labeling of both the plasma membrane and intracellular structures were observed in myotubes. Plasma membrane labeling was patchy but not particularly concentrated on identifiable features. Further work will be required to ascertain whether this represents a random distribution over the entire surface or some concentration in certain structures. The specific labeling of intracellular tubular-vesicular structures may represent the endosomal compartment (Figure 12, a and c), as well as uncoated vesicles and tubules in both cell periphery (Figure 12c) and in the perinuclear area (Figure 12b). These results further establish that VAMP5 is associated with the plasma membrane and intracellular structures of myotubes.
|
| |
DISCUSSION |
|---|
|
|
|---|
The skeletal muscle and the heart are unique tissues because they
are composed mainly of multinuclear myotubes derived from the fusion of
myoblasts. Two specific membrane trafficking processes are associated
with these two tissues. The first one is the fusion of myoblasts into
myotubes (Lassar et al., 1994
; Tam et al., 1995
; Molkentin and Olson, 1996
; Rawls and Olson, 1997
; Walsh and Perlman, 1997
). Although much remains to be investigated, a recent study has
shown that there exists a unique class of small vesicles that are
associated with the myoblast fusion process (Doberstein et al., 1997
). Second, like adipocytes, myotubes are the major cells expressing the glucose transporter 4 (GLUT4), which is normally sequestered intracellularly in storage compartments (James and Piper,
1994
). Upon stimulation by insulin, GLUT4 is transported to the plasma
membrane to mediate glucose uptake. It remains unclear whether there
exist specific SNAREs that are preferentially expressed in the skeletal
muscle and the heart to facilitate these two physiologically important
trafficking events. A recent study aiming to identify novel members of
the synaptobrevin/VAMP family in the skeletal muscle using the PCR
approach had revealed the expression of synaptobrevin 1 and 2 in the
skeletal muscle but failed to detect any novel members of this family
that are preferentially expressed in the skeletal muscle (Ralston
et al., 1994
).
In the present study, we have identified a novel member (VAMP5) of the synaptobrevin/VAMP family. We have provided evidence that the expression of VAMP5 is associated with myogenesis. First, the mRNA for VAMP5 is expressed at the highest levels in the skeletal muscle and the heart among the eight tissues examined by Northern blot analysis, suggesting that the VAMP5 transcript is preferentially expressed in the skeletal muscle and the heart. Second, during in vitro myogenesis of C2C12 cells, the mRNA for VAMP5 is increased ~8- to 10-fold in the myotubes compared with myoblasts. Because only ~40-60% of the C2C12 cells are fused into myotubes in our experiments, the mRNA extracted from myotubes also contains those derived from the unfused myoblasts. We estimate that only half of the mRNA is derived from authentic myotubes and that the mRNA for VAMP5 may actually be increased by a factor of ~15- to 20-fold in the myotubes. Third, immunoblot analysis of total cellular extracts of myotubes and myoblasts revealed that VAMP5 is increased approximately sixfold in the myotubes compared with the myoblasts. Again, because myotube extracts also contain those derived from unfused myoblasts, VAMP5 levels may be increased by a factor of 10 in the myotubes. Finally, indirect immunofluorescence and immunogold microscopy using affinity-purified antibodies against VAMP5 did not reveal specific labeling in myoblasts. In cells grown in differentiation medium, essentially all the myotubes exhibit strong labeling of the plasma membrane and intracellular vesicular structures, whereas the majority of the unfused myoblasts display only background labeling. Only a small fraction of unfused myoblasts contain strong VAMP5 labeling in the plasma membrane and intracellular structures. These results are consistent with the notion that the VAMP5 protein level is greatly increased in the myotubes. The preferential expression of VAMP5 mRNA in the skeletal muscle and the heart as well as the increased levels of VAMP5 mRNA and protein during in vitro myogenesis are further sustained by the observation that no specific labeling for VAMP5 is detected in diverse cell lines such as NRK, MDCK, A431, and Hela cells.
The results of indirect immunofluorescence microscopy not only support
the conclusion that the level of VAMP5 is greatly increased during
myogenesis but also reveal the subcellular localization of VAMP5. VAMP5
is clearly associated with the plasma membrane and intracellular
vesicular structures. The association of VAMP5 with the plasma membrane
is further supported by the observation that both myc and HA
epitope-tagged versions of VAMP5 are targeted to the cell surface in
stably transfected cells. The intracellular vesicular structures are
located both peripherally as well as in the Golgi region marked by
Golgi SNARE GS28 (Subramaniam et al., 1995
, 1996
; Nagahama
et al., 1996
). In cells treated with nocodazole, the
Golgi-like labeling of VAMP5 is segregated significantly from that of
GS28. In cells treated with BFA, VAMP5 is redistributed much faster
than GS28 and the Golgi-like labeling of VAMP5 is essentially
redistributed after 5-min treatment with BFA, whereas the Golgi
labeling of GS28 remains essentially intact. Furthermore, VAMP5 and
GS28 are seen to be redistributed into distinct smaller vesicular
structures after treatment with BFA for 25 min. Because GS28 behaves
like a protein of the Golgi stack and the intermediate compartment upon
treatment with BFA (Subramaniam et al., 1995
), the different
response of VAMP5 to BFA suggests that VAMP5 is not associated with the
cis-Golgi or the Golgi stack. The most likely possibility is
that VAMP5 is associated with structures associated with the trans
region of the Golgi apparatus. The distribution of VAMP5 in the plasma
membrane and intracellular structures was further established by
immuno-gold labeling of differentiated C2C12 cells.
The relationship between the surface and the intracellular pools of VAMP5 in myotubes remains unclear. Two possibilities exist. One is that the intracellular pool represents those VAMP5 molecules en route to the plasma membrane. Alternatively, the surface and the intracellular pools are in dynamic equilibrium and that VAMP5 cycles between these two locations. Future experiments are needed to distinguish between these two possibilities. Although the functional aspects of VAMP5 remain to be investigated, the preferential expression of VAMP5 in the skeletal muscle and heart, the increased expression of VAMP5 during in vitro myogenesis, and the observation that VAMP5 is undetectable by indirect immunofluorescence microscopy in diverse cell lines suggest that VAMP5 may participate in a trafficking event that is associated with myogenesis in these tissues. Whether VAMP5 plays a role in myoblast fusion and/or GLUT4 trafficking remains to be experimentally examined.
| |
ACKNOWLEDGMENTS |
|---|
We thank Drs. T.C. Südhof for the cDNA clone of cellubrevin and Tony Ting for plasmid expressing GST-VAMP2. We thank Dr. P. Singh for reading the manuscript and Dr. Y.H. Tan for his continuous support.
| |
FOOTNOTES |
|---|
§ Corresponding author. E-mail address: mcbhwj{at}imcb.nus.edu.sg.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
H. Mashima, J. Suzuki, T. Hirayama, Y. Yoshikumi, H. Ohno, H. Ohnishi, H. Yasuda, T. Fujita, and M. Omata Involvement of Vesicle-Associated Membrane Protein 7 in Human Gastric Epithelial Cell Vacuolation Induced by Helicobacter pylori-Produced VacA Infect. Immun., June 1, 2008; 76(6): 2296 - 2303. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. F. Wallace, L. Summerville, E. M. Crampton, and V. N. Subramaniam Defective trafficking and localization of mutated transferrin receptor 2: implications for type 3 hereditary hemochromatosis Am J Physiol Cell Physiol, February 1, 2008; 294(2): C383 - C390. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Williams and J. E. Pessin Mapping of R-SNARE function at distinct intracellular GLUT4 trafficking steps in adipocytes J. Cell Biol., January 28, 2008; 180(2): 375 - 387. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. H. T. Tran, Q. Zeng, and W. Hong VAMP4 cycles from the cell surface to the trans-Golgi network via sorting and recycling endosomes J. Cell Sci., March 15, 2007; 120(6): 1028 - 1041. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Balagopal, R. Olney, D. Darmaun, E. Mougey, M. Dokler, G. Sieck, and D. Hammond Oxandrolone enhances skeletal muscle myosin synthesis and alters global gene expression profile in Duchenne muscular dystrophy Am J Physiol Endocrinol Metab, March 1, 2006; 290(3): E530 - E539. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Neiman Ascospore Formation in the Yeast Saccharomyces cerevisiae Microbiol. Mol. Biol. Rev., December 1, 2005; 69(4): 565 - 584. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hasegawa, Z. Yang, L. Oltedal, S. Davanger, and J. C. Hay Intramolecular protein-protein and protein-lipid interactions control the conformation and subcellular targeting of neuronal Ykt6 J. Cell Sci., September 1, 2004; 117(19): 4495 - 4508. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Zeng, T. T. H. Tran, H.-X. Tan, and W. Hong The Cytoplasmic Domain of Vamp4 and Vamp5 Is Responsible for Their Correct Subcellular Targeting: THE N-TERMINAL EXTENSION OF VAMP4 CONTAINS A DOMINANT AUTONOMOUS TARGETING SIGNAL FOR THE TRANS-GOLGI NETWORK J. Biol. Chem., June 13, 2003; 278(25): 23046 - 23054. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hasegawa, S. Zinsser, Y. Rhee, E. O. Vik-Mo, S. Davanger, and J. C. Hay Mammalian Ykt6 Is a Neuronal SNARE Targeted to a Specialized Compartment by its Profilin-like Amino Terminal Domain Mol. Biol. Cell, February 1, 2003; 14(2): 698 - 720. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. K. Yechoor, M.-E. Patti, R. Saccone, and C. R. Kahn Coordinated patterns of gene expression for substrate and energy metabolism in skeletal muscle of diabetic mice PNAS, August 6, 2002; 99(16): 10587 - 10592. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Schiavo, M. Matteoli, and C. Montecucco Neurotoxins Affecting Neuroexocytosis Physiol Rev, April 1, 2000; 80(2): 717 - 766. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Prekeris, B. Yang, V. Oorschot, J. Klumperman, and R. H. Scheller Differential Roles of Syntaxin 7 and Syntaxin 8 in Endosomal Trafficking Mol. Biol. Cell, November 1, 1999; 10(11): 3891 - 3908. [Abstract] [Full Text] |
||||
![]() |
B. Yu, L. A. Poirier, and L. E. Nagy Mobilization of GLUT-4 from intracellular vesicles by insulin and K+ depolarization in cultured H9c2 myotubes Am J Physiol Endocrinol Metab, August 1, 1999; 277(2): E259 - E267. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Steegmaier, J. Klumperman, D. L. Foletti, J.-S. Yoo, and R. H. Scheller Vesicle-associated Membrane Protein 4 is Implicated in Trans-Golgi Network Vesicle Trafficking Mol. Biol. Cell, June 1, 1999; 10(6): 1957 - 1972. [Abstract] [Full Text] |
||||
![]() |
S. H. Wong, Y. Xu, T. Zhang, G. Griffiths, S. L. Lowe, V. N. Subramaniam, K. T. Seow, and W. Hong GS32, a Novel Golgi SNARE of 32 kDa, Interacts Preferentially with Syntaxin 6 Mol. Biol. Cell, January 1, 1999; 10(1): 119 - 134. [Abstract] [Full Text] |
||||
![]() |
M. Abdul-Ghani, P.-Y. Gougeon, D. C. Prosser, L. F. Da-Silva, and J. K. Ngsee PRA Isoforms Are Targeted to Distinct Membrane Compartments J. Biol. Chem., February 23, 2001; 276(9): 6225 - 6233. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||