Supplemental Material

This article contains the following supporting material:

• Figure S1 - Pairwise alignment of the upstream regions of the frq transcripts from Neurospora and Sordaria. The Accession number for the Sordaria frq sequence is L14467. This alignment was generated by Gene Inspector (Textco) and the conserved regions determined by BLAST, using default parameters for aligning two sequences except that the open gap penalty was reduced from 5 to 3. The regions found by BLAST to have significant similarity are shaded in green on both the sequence and the adjacent corresponding drawings, modified from Figure 6. As determined by sequencing gel-purified or cloned RT-PCR products and (for Neurospora) 5’RACE products, numerous major and minor splice site sequences are used and they are all outlined by shaded blue boxes (for 5’ splice sites) and red boxes (for 3’ splice sites). AUGs at the start of uORFs (in either or both species) are indicated by asterisks and ATG_L by a thick black line. In Neurospora, a seventh AUG is located within a uORF but in Sordaria, it begins one of the six uORFs; this AUG is indicated by a grey asterisk. For Neurospora, 13 relevant 5’RACE products generated with primer r1 (CAGAAGCGAGGGAGGGTGTCTCG) were sequenced and the minor splicing events not represented by Figure 1 were seen either once or twice among those products, along with one unspliced product. More than 30 gel analyses of RT-PCR products, however, indicate an overall frequency of such minor products of less than 5%. For Sordaria, one cloned RT-PCR product from the primer pair f1+r1 and 7 products from the pair f2+r1 were sequenced; intron 1b was seen in all the products, and the two minor upstream variants twice each. Intron 2 splicing was observed in one product.